Starting /dee2/code/volunteer_pipeline.sh SRR6053288 current disk space = 3048618835968 free memory = 1416030904 SRR6053288 SRAfilesize 3244d298d772f740538e7ec6ece4007a SRR6053288.sra SRR6053288.sra file validated SRR6053288 is paired end SRR6053288 is conventional basespace SRR6053288 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053288_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.61725 34.0 33.0 34.0 32.0 34.0 2 33.0875 34.0 33.0 34.0 32.0 34.0 3 33.22825 34.0 33.0 34.0 32.0 34.0 4 33.404 34.0 33.0 34.0 33.0 34.0 5 33.39275 34.0 33.0 34.0 33.0 34.0 6 37.10025 38.0 37.0 38.0 36.0 38.0 7 37.27275 38.0 38.0 38.0 36.0 38.0 8 37.38875 38.0 38.0 38.0 37.0 38.0 9 37.403 38.0 38.0 38.0 37.0 38.0 10-14 37.436749999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.37865 38.0 38.0 38.0 37.0 38.0 20-24 37.385799999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.3175 38.0 38.0 38.0 37.0 38.0 30-34 37.2726 38.0 38.0 38.0 37.0 38.0 35-39 37.161950000000004 38.0 38.0 38.0 36.6 38.0 40-44 37.20635 38.0 38.0 38.0 36.2 38.0 45-49 37.12035 38.0 38.0 38.0 36.0 38.0 50-54 37.089749999999995 38.0 38.0 38.0 36.0 38.0 55-59 37.0735 38.0 38.0 38.0 35.8 38.0 60-64 37.0833 38.0 38.0 38.0 36.0 38.0 65-69 37.05795 38.0 38.0 38.0 36.0 38.0 70-74 36.96855 38.0 38.0 38.0 35.6 38.0 75-79 36.9531 38.0 38.0 38.0 36.0 38.0 80-84 36.952299999999994 38.0 38.0 38.0 35.8 38.0 85-89 36.81045 38.0 38.0 38.0 35.2 38.0 90-94 36.63935 38.0 38.0 38.0 34.6 38.0 95-99 36.600350000000006 38.0 38.0 38.0 34.2 38.0 100-104 36.571600000000004 38.0 38.0 38.0 34.2 38.0 105-109 36.54185 38.0 38.0 38.0 34.0 38.0 110-114 36.40395 38.0 38.0 38.0 34.0 38.0 115-119 36.22855 38.0 38.0 38.0 33.8 38.0 120-124 36.0544 38.0 37.2 38.0 33.4 38.0 125-129 35.9433 38.0 37.6 38.0 33.0 38.0 130-134 35.718 38.0 36.8 38.0 31.8 38.0 135-139 35.47685 38.0 36.4 38.0 30.2 38.0 140-144 35.18905 38.0 36.0 38.0 30.6 38.0 145-149 34.731700000000004 38.0 36.0 38.0 28.6 38.0 150-151 32.44775 37.0 33.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 3.0 17 0.0 18 1.0 19 4.0 20 4.0 21 7.0 22 3.0 23 9.0 24 11.0 25 15.0 26 17.0 27 20.0 28 30.0 29 32.0 30 42.0 31 52.0 32 66.0 33 92.0 34 117.0 35 224.0 36 467.0 37 2783.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.026490066225165 11.947019867549669 12.688741721854305 51.33774834437086 2 20.349999999999998 19.925 39.375 20.349999999999998 3 19.5 23.974999999999998 25.374999999999996 31.15 4 21.7 32.300000000000004 21.125 24.875 5 21.25 35.225 26.125 17.4 6 17.424999999999997 36.325 25.6 20.65 7 14.249999999999998 21.65 43.974999999999994 20.125 8 18.45 23.75 30.4 27.400000000000002 9 16.825000000000003 21.75 35.65 25.775 10-14 19.715 29.62 26.63 24.035 15-19 19.994999999999997 27.77 27.91 24.325 20-24 19.705000000000002 28.410000000000004 28.02 23.865 25-29 19.61 28.435 28.415000000000003 23.54 30-34 19.705000000000002 28.860000000000003 27.6 23.835 35-39 19.925 28.685 27.315 24.075 40-44 19.7 28.46 27.67 24.169999999999998 45-49 19.925 28.21 27.525 24.34 50-54 19.855 28.084999999999997 27.560000000000002 24.5 55-59 20.53 28.585 27.63 23.255 60-64 20.549999999999997 28.535 27.675 23.24 65-69 20.135 28.405 27.639999999999997 23.82 70-74 20.52 27.810000000000002 27.800000000000004 23.87 75-79 20.175 28.444999999999997 27.175 24.205 80-84 20.015 28.410000000000004 27.889999999999997 23.685000000000002 85-89 20.52 27.98 27.785 23.715 90-94 19.925 28.46 27.625 23.990000000000002 95-99 20.395 28.494999999999997 27.279999999999998 23.830000000000002 100-104 20.53 27.96 27.54 23.97 105-109 20.169999999999998 27.76 28.1 23.97 110-114 20.82 28.425 27.365000000000002 23.39 115-119 20.685000000000002 28.634999999999998 27.395000000000003 23.285 120-124 20.57 27.694999999999997 27.715 24.02 125-129 20.94 27.85 27.715 23.494999999999997 130-134 20.7 27.839999999999996 27.575 23.885 135-139 21.88 27.425 27.089999999999996 23.605 140-144 21.245 28.01 26.465 24.279999999999998 145-149 20.91 28.365000000000002 26.68 24.044999999999998 150-151 21.046700888944535 28.270940277951674 26.230123951421056 24.452234881682735 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.5 21 2.0 22 1.0 23 1.5 24 3.0 25 3.0 26 5.0 27 6.0 28 7.5 29 15.5 30 20.0 31 22.5 32 28.5 33 39.0 34 52.5 35 65.5 36 84.0 37 115.0 38 139.0 39 161.0 40 195.5 41 217.5 42 250.0 43 263.5 44 271.5 45 269.0 46 272.0 47 256.0 48 213.5 49 199.5 50 173.0 51 145.0 52 111.0 53 90.5 54 79.0 55 58.5 56 43.5 57 30.5 58 22.5 59 20.5 60 15.5 61 9.5 62 4.0 63 4.0 64 4.0 65 2.5 66 0.5 67 1.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0125 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.075 0.0 0.0 0.025 0.0 80-81 0.075 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.1 0.0 0.0 0.025 0.0 86-87 0.125 0.0 0.0 0.025 0.0 88-89 0.16249999999999998 0.0 0.0 0.025 0.0 90-91 0.175 0.0 0.0 0.025 0.0 92-93 0.21250000000000002 0.0 0.0 0.025 0.0 94-95 0.30000000000000004 0.0 0.0 0.025 0.0 96-97 0.35 0.0 0.0 0.025 0.0 98-99 0.4 0.0 0.0 0.025 0.0 100-101 0.5 0.0 0.0 0.025 0.0 102-103 0.6625000000000001 0.0 0.0 0.025 0.0 104-105 0.8 0.0 0.0 0.025 0.0 106-107 0.925 0.0 0.0 0.025 0.0 108-109 1.0625 0.0 0.0 0.025 0.0 110-111 1.275 0.0 0.0 0.025 0.0 112-113 1.5125 0.0 0.0 0.025 0.0 114-115 1.7625 0.0 0.0 0.025 0.0 116-117 1.9875 0.0 0.0 0.025 0.0 118-119 2.25 0.0 0.0 0.025 0.0 120-121 2.45 0.0 0.0 0.025 0.0 122-123 2.7375 0.0 0.0 0.025 0.0 124-125 3.1 0.0 0.0 0.025 0.0 126-127 3.625 0.0 0.0 0.025 0.0 128-129 4.1 0.0 0.0 0.025 0.0 130-131 4.4875 0.0 0.0 0.025 0.0 132-133 4.8375 0.0 0.0 0.025 0.0 134-135 5.2625 0.0 0.0 0.025 0.0 136-137 5.725 0.0 0.0 0.025 0.0 138-139 6.1375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGAAT 10 0.0068396386 144.9375 8 >>END_MODULE SRR6053288 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053288_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.724 33.0 33.0 34.0 32.0 34.0 2 32.8545 33.0 33.0 34.0 32.0 34.0 3 32.8955 34.0 33.0 34.0 32.0 34.0 4 32.685 33.0 33.0 34.0 32.0 34.0 5 32.767 34.0 33.0 34.0 32.0 34.0 6 36.983 38.0 38.0 38.0 36.0 38.0 7 37.05125 38.0 38.0 38.0 36.0 38.0 8 37.07275 38.0 38.0 38.0 36.0 38.0 9 36.906 38.0 38.0 38.0 36.0 38.0 10-14 37.04175 38.0 38.0 38.0 36.0 38.0 15-19 37.099450000000004 38.0 38.0 38.0 36.4 38.0 20-24 37.05195 38.0 38.0 38.0 36.0 38.0 25-29 37.02954999999999 38.0 38.0 38.0 36.0 38.0 30-34 37.05085 38.0 38.0 38.0 36.0 38.0 35-39 37.03815 38.0 38.0 38.0 36.0 38.0 40-44 36.98395 38.0 38.0 38.0 36.0 38.0 45-49 36.9989 38.0 38.0 38.0 36.0 38.0 50-54 36.9471 38.0 38.0 38.0 36.0 38.0 55-59 36.86645 38.0 38.0 38.0 36.0 38.0 60-64 36.750299999999996 38.0 38.0 38.0 35.4 38.0 65-69 36.77034999999999 38.0 38.0 38.0 35.6 38.0 70-74 36.733450000000005 38.0 38.0 38.0 35.2 38.0 75-79 36.71810000000001 38.0 38.0 38.0 35.2 38.0 80-84 36.6325 38.0 38.0 38.0 34.8 38.0 85-89 36.5955 38.0 38.0 38.0 34.6 38.0 90-94 36.52105 38.0 38.0 38.0 34.4 38.0 95-99 36.36965 38.0 38.0 38.0 34.0 38.0 100-104 36.27025 38.0 38.0 38.0 34.0 38.0 105-109 36.25170000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.1003 38.0 38.0 38.0 33.4 38.0 115-119 36.03345 38.0 38.0 38.0 33.0 38.0 120-124 35.91775 38.0 38.0 38.0 33.0 38.0 125-129 35.78320000000001 38.0 37.8 38.0 32.8 38.0 130-134 35.51925 38.0 36.8 38.0 31.0 38.0 135-139 35.307100000000005 38.0 36.2 38.0 30.6 38.0 140-144 35.0049 38.0 36.0 38.0 29.2 38.0 145-149 34.48305 38.0 36.0 38.0 27.0 38.0 150-151 31.7875 36.5 32.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 0.0 11 1.0 12 1.0 13 3.0 14 2.0 15 2.0 16 2.0 17 2.0 18 6.0 19 7.0 20 6.0 21 8.0 22 7.0 23 13.0 24 17.0 25 16.0 26 20.0 27 20.0 28 35.0 29 50.0 30 38.0 31 65.0 32 58.0 33 80.0 34 120.0 35 210.0 36 430.0 37 2772.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.324999999999996 15.575 17.525 41.575 2 24.68703054581873 22.058087130696045 37.58137205808713 15.673510265398097 3 19.203805708562843 25.7386079118678 32.42363545317977 22.633950926389584 4 21.813173052842476 32.88254445279239 23.491109441522664 21.813173052842476 5 24.749498997995993 34.569138276553105 23.972945891783567 16.708416833667332 6 17.57636454682023 38.70806209313971 24.486730095142715 19.228843264897346 7 17.250876314471707 17.651477215823736 43.01452178267401 22.083124687030544 8 19.594594594594593 23.373373373373376 28.753753753753752 28.27827827827828 9 21.22122122122122 24.3993993993994 29.854854854854857 24.524524524524523 10-14 22.384623085393933 27.68545399939934 27.089798778656522 22.840124136550205 15-19 21.90409450395435 28.276103714085494 27.675442987286015 22.14435879467414 20-24 22.541414343626446 28.206796456633803 27.646263950753212 21.605525248986538 25-29 22.71271271271271 28.613613613613616 28.003003003003002 20.67067067067067 30-34 21.83574395675892 28.29688203793604 27.89149692207597 21.97587708322907 35-39 22.182182182182185 27.66266266266266 28.31831831831832 21.836836836836838 40-44 22.41465612173391 27.7305035539093 27.985784362799077 21.869055961557713 45-49 22.684281639393483 28.314066956913376 27.863684131511786 21.137967272181353 50-54 22.983386709367494 27.772217774219378 27.48698959167334 21.757405924739793 55-59 23.135822240016015 27.19947953157842 28.730857771994796 20.93384045641077 60-64 23.22251151612257 26.842579611456042 28.09433206489085 21.840576807530542 65-69 22.98142864293938 27.84702407768934 27.571707463583124 21.599839815788158 70-74 22.691768475866212 27.914079711596234 27.333266573202486 22.060885239335068 75-79 23.315647211933126 27.49023926318951 27.725498047852636 21.468615477024727 80-84 23.562096410872506 27.47159233118086 27.832006807829003 21.134304450117636 85-89 23.302137030178667 27.656273459786796 27.526149842350232 21.515439667684298 90-94 23.297132275661877 28.281867774385667 27.381011961363296 21.03998798858916 95-99 23.94415532425941 27.58206565252202 27.51200960768615 20.961769415532423 100-104 23.39754816112084 27.98598949211909 27.10032524393295 21.51613710282712 105-109 23.907712326710374 27.35098343426255 27.846454131424853 20.894850107602224 110-114 23.593593593593592 28.058058058058062 28.088088088088085 20.26026026026026 115-119 24.00640704775253 27.550305335869457 28.00580638702573 20.437481229352287 120-124 24.24303087933537 27.856463640458433 27.055702917771885 20.84480256243431 125-129 24.14776993542574 27.326425389197578 27.51163838414176 21.014166291234922 130-134 24.29794263402913 28.257496120538622 27.02107423537068 20.42348701006157 135-139 24.50695765341876 28.105916508158973 26.734407848633495 20.65271798978877 140-144 24.70853139854891 27.685764323242434 27.235426569927444 20.37027770828121 145-149 25.576740229194815 27.388280038032324 27.143071610869242 19.89190812190362 150-151 25.271976991371766 28.460672752282107 26.034763036138553 20.23258722020758 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.0 25 3.0 26 3.0 27 3.0 28 8.0 29 9.5 30 12.0 31 17.0 32 23.0 33 32.5 34 39.5 35 56.0 36 85.0 37 115.0 38 134.5 39 156.5 40 194.5 41 227.0 42 237.0 43 250.5 44 269.0 45 293.0 46 286.0 47 258.0 48 226.0 49 196.5 50 179.0 51 147.5 52 112.0 53 90.0 54 77.5 55 50.5 56 50.5 57 48.5 58 29.0 59 20.0 60 17.5 61 14.0 62 6.5 63 4.5 64 3.0 65 0.5 66 1.0 67 2.5 68 1.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.15 4 0.17500000000000002 5 0.2 6 0.15 7 0.15 8 0.1 9 0.1 10-14 0.11 15-19 0.11 20-24 0.095 25-29 0.1 30-34 0.095 35-39 0.1 40-44 0.11 45-49 0.08499999999999999 50-54 0.08 55-59 0.09 60-64 0.13999999999999999 65-69 0.11499999999999999 70-74 0.13999999999999999 75-79 0.11 80-84 0.11499999999999999 85-89 0.095 90-94 0.095 95-99 0.08 100-104 0.075 105-109 0.095 110-114 0.1 115-119 0.11 120-124 0.095 125-129 0.11499999999999999 130-134 0.11499999999999999 135-139 0.11 140-144 0.075 145-149 0.08499999999999999 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96123638206232 97.65 2 0.9120851279452749 1.7999999999999998 3 0.05067139599695972 0.15 4 0.0 0.0 5 0.05067139599695972 0.25 6 0.02533569799847986 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit CACATTTATAGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7749999999999999 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.5125 0.0 0.0 0.0 0.0 114-115 1.7625 0.0 0.0 0.0 0.0 116-117 1.9875 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.475 0.0 0.0 0.0 0.0 122-123 2.7625 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.625 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.4875 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.2625 0.0 0.0 0.0 0.0 136-137 5.725 0.0 0.0 0.0 0.0 138-139 6.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTAAC 10 0.006830828 145.0 1 GTTATGA 10 0.006830828 145.0 145 >>END_MODULE Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216845 spots for SRR6053288.sra Written 2216845 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra Read 2216844 spots for SRR6053288.sra Written 2216844 spots for SRR6053288.sra SRR ids: ['SRR6053288.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zxlxuje8 SRR6053288.sra spots: 44336881 blocks: [[1, 2216844], [2216845, 4433688], [4433689, 6650532], [6650533, 8867376], [8867377, 11084220], [11084221, 13301064], [13301065, 15517908], [15517909, 17734752], [17734753, 19951596], [19951597, 22168440], [22168441, 24385284], [24385285, 26602128], [26602129, 28818972], [28818973, 31035816], [31035817, 33252660], [33252661, 35469504], [35469505, 37686348], [37686349, 39903192], [39903193, 42120036], [42120037, 44336881]] SRR6053288 file size 15002613 SRR6053288 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053288 SRR6053288_1.fastq SRR6053288_2.fastq Input file: SRR6053288_1.fastq Paired file: SRR6053288_2.fastq trimmed: SRR6053288-trimmed-pair1.fastq, SRR6053288-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:25:34 2025 >> started Tue Feb 11 17:26:49 2025 >> done (74.523s) 44336881 read pairs processed; of these: 31051 ( 0.07%) short read pairs filtered out after trimming by size control 45144 ( 0.10%) empty read pairs filtered out after trimming by size control 44260686 (99.83%) read pairs available; of these: 14971195 (33.83%) trimmed read pairs available after processing 29289491 (66.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 5 0.00% 20 7 0.00% 21 15 0.00% 22 10 0.00% 23 10 0.00% 24 9 0.00% 25 13 0.00% 26 14 0.00% 27 10 0.00% 28 15 0.00% 29 9 0.00% 30 14 0.00% 31 13 0.00% 32 17 0.00% 33 11 0.00% 34 13 0.00% 35 20 0.00% 36 34 0.00% 37 24 0.00% 38 37 0.00% 39 44 0.00% 40 47 0.00% 41 45 0.00% 42 70 0.00% 43 55 0.00% 44 67 0.00% 45 69 0.00% 46 85 0.00% 47 126 0.00% 48 142 0.00% 49 150 0.00% 50 165 0.00% 51 193 0.00% 52 208 0.00% 53 232 0.00% 54 224 0.00% 55 248 0.00% 56 241 0.00% 57 302 0.00% 58 333 0.00% 59 404 0.00% 60 494 0.00% 61 529 0.00% 62 556 0.00% 63 660 0.00% 64 712 0.00% 65 746 0.00% 66 859 0.00% 67 953 0.00% 68 1019 0.00% 69 1202 0.00% 70 1323 0.00% 71 1531 0.00% 72 1628 0.00% 73 1874 0.00% 74 2035 0.00% 75 2285 0.01% 76 2609 0.01% 77 2854 0.01% 78 3110 0.01% 79 3518 0.01% 80 3936 0.01% 81 4414 0.01% 82 4962 0.01% 83 5709 0.01% 84 6687 0.02% 85 7889 0.02% 86 8910 0.02% 87 9860 0.02% 88 10655 0.02% 89 12083 0.03% 90 13092 0.03% 91 14173 0.03% 92 15460 0.03% 93 16861 0.04% 94 18451 0.04% 95 20531 0.05% 96 22521 0.05% 97 24213 0.05% 98 26357 0.06% 99 28141 0.06% 100 30395 0.07% 101 31954 0.07% 102 34432 0.08% 103 36638 0.08% 104 39322 0.09% 105 42048 0.10% 106 45128 0.10% 107 48049 0.11% 108 51276 0.12% 109 54973 0.12% 110 57228 0.13% 111 60471 0.14% 112 63557 0.14% 113 65721 0.15% 114 69290 0.16% 115 73089 0.17% 116 77790 0.18% 117 81164 0.18% 118 86337 0.20% 119 89930 0.20% 120 93401 0.21% 121 98015 0.22% 122 99590 0.23% 123 104167 0.24% 124 108675 0.25% 125 112928 0.26% 126 117002 0.26% 127 121783 0.28% 128 127164 0.29% 129 129879 0.29% 130 135797 0.31% 131 140823 0.32% 132 146391 0.33% 133 150988 0.34% 134 155325 0.35% 135 161988 0.37% 136 169319 0.38% 137 178967 0.40% 138 185745 0.42% 139 193803 0.44% 140 207762 0.47% 141 223245 0.50% 142 254482 0.57% 143 257714 0.58% 144 296139 0.67% 145 334730 0.76% 146 441912 1.00% 147 596123 1.35% 148 620746 1.40% 149 1135265 2.56% 150 6423367 14.51% 151 29289491 66.17% 44260686 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=21 prefix-density=0.74 prefix-fanout=2.2 sequence=TTGCACTTGCCATCGTTCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=18.70 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.7 sequence=AGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTA criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=14 prefix-density=0.79 prefix-fanout=2.9 sequence=ACCGCACCCCGGCACAAGCCAACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=19.47 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC SRR6053288 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:27:49 Started mapping on | Feb 11 17:27:49 Finished on | Feb 11 17:36:27 Mapping speed, Million of reads per hour | 307.60 Number of input reads | 44260686 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 41707810 Uniquely mapped reads % | 94.23% Average mapped length | 293.77 Number of splices: Total | 41392200 Number of splices: Annotated (sjdb) | 40547179 Number of splices: GT/AG | 40531891 Number of splices: GC/AG | 676701 Number of splices: AT/AC | 26412 Number of splices: Non-canonical | 157196 Mismatch rate per base, % | 0.81% Deletion rate per base | 0.06% Deletion average length | 3.05 Insertion rate per base | 0.04% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1442290 % of reads mapped to multiple loci | 3.26% Number of reads mapped to too many loci | 316625 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.61% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1127111 1127111 1127111 N_multimapping 1442290 1442290 1442290 N_noFeature 1075590 41010490 1284827 N_ambiguous 775333 2183 286350 UnstrandedReadsAssigned:39856887 PositiveStrandReadsAssigned:695137 NegativeStrandReadsAssigned:40136633 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6053288 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053288-trimmed-pair1.fastq SRR6053288-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,260,686 reads, 39,212,970 reads pseudoaligned [quant] estimated average fragment length: 259.644 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR6053288.ke.tsv 34699 SRR6053288.se.tsv 87100 total ==> SRR6053288.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.36 1766 20.3526 Potri.005G024800.1.v4.1 1035 776.356 984 25.6991 Potri.004G059700.1.v4.1 961 702.499 47 1.35655 Potri.007G009000.2.v4.1 1416 1157.36 0 0 Potri.003G141000.2.v4.1 2943 2684.36 2360.02 17.8262 Potri.016G087400.1.v4.1 270 83.3862 2774 674.521 Potri.015G069301.1.v4.1 564 319.611 0 0 Potri.010G195200.1.v4.1 1773 1514.36 121 1.62009 Potri.012G127500.1.v4.1 977 718.443 747 21.082 ==> SRR6053288.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 917 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 646 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR6053288 completed mapping pipeline successfully