Starting /dee2/code/volunteer_pipeline.sh SRR6053289 current disk space = 3053414412288 free memory = 1454082108 SRR6053289 SRAfilesize ce2acd7ece0087bb275d847a7024e74f SRR6053289.sra SRR6053289.sra file validated SRR6053289 is paired end SRR6053289 is conventional basespace SRR6053289 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053289_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7355 34.0 33.0 34.0 25.0 34.0 2 32.856 34.0 33.0 34.0 28.0 34.0 3 33.032 34.0 33.0 34.0 32.0 34.0 4 33.30425 34.0 33.0 34.0 32.0 34.0 5 33.245 34.0 33.0 34.0 33.0 34.0 6 36.80475 38.0 37.0 38.0 35.0 38.0 7 37.267 38.0 38.0 38.0 36.0 38.0 8 37.33725 38.0 38.0 38.0 37.0 38.0 9 37.40125 38.0 38.0 38.0 37.0 38.0 10-14 37.382999999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.389300000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.350350000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.3212 38.0 38.0 38.0 37.0 38.0 30-34 37.291250000000005 38.0 38.0 38.0 36.8 38.0 35-39 37.28485 38.0 38.0 38.0 37.0 38.0 40-44 37.26955 38.0 38.0 38.0 36.8 38.0 45-49 37.1847 38.0 38.0 38.0 36.2 38.0 50-54 37.11615 38.0 38.0 38.0 36.0 38.0 55-59 37.0808 38.0 38.0 38.0 36.0 38.0 60-64 37.09085 38.0 38.0 38.0 36.0 38.0 65-69 37.058899999999994 38.0 38.0 38.0 36.0 38.0 70-74 37.07035 38.0 38.0 38.0 36.0 38.0 75-79 36.983700000000006 38.0 38.0 38.0 36.0 38.0 80-84 36.90475 38.0 38.0 38.0 35.4 38.0 85-89 36.873000000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.771699999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.656549999999996 38.0 38.0 38.0 34.8 38.0 100-104 36.71385 38.0 38.0 38.0 35.0 38.0 105-109 36.583299999999994 38.0 38.0 38.0 34.2 38.0 110-114 36.45675 38.0 38.0 38.0 34.0 38.0 115-119 36.2916 38.0 38.0 38.0 34.0 38.0 120-124 36.2352 38.0 38.0 38.0 33.8 38.0 125-129 36.08995 38.0 37.6 38.0 33.4 38.0 130-134 35.984049999999996 38.0 37.2 38.0 33.0 38.0 135-139 35.80545 38.0 37.2 38.0 32.6 38.0 140-144 35.492000000000004 38.0 36.0 38.0 31.0 38.0 145-149 35.0361 38.0 36.0 38.0 30.4 38.0 150-151 32.674875 37.0 33.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 4.0 19 1.0 20 5.0 21 2.0 22 4.0 23 4.0 24 8.0 25 6.0 26 22.0 27 19.0 28 26.0 29 35.0 30 44.0 31 53.0 32 75.0 33 81.0 34 112.0 35 213.0 36 483.0 37 2801.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.90483958673192 11.33768352365416 14.845024469820556 48.91245241979337 2 21.05 18.4 37.0 23.549999999999997 3 19.425 22.85 24.525 33.2 4 23.175 30.925000000000004 20.825 25.074999999999996 5 21.5 35.175 24.875 18.45 6 17.325 35.725 26.25 20.7 7 14.899999999999999 21.4 45.225 18.475 8 18.175 22.325 32.45 27.05 9 16.925 23.175 33.45 26.450000000000003 10-14 19.935 28.799999999999997 27.35 23.915 15-19 20.13 28.575 27.215 24.08 20-24 20.05 27.810000000000002 27.785 24.355 25-29 20.285 27.79 27.455000000000002 24.47 30-34 19.994999999999997 27.834999999999997 27.77 24.4 35-39 20.605 27.91 27.68 23.805 40-44 19.965 27.839999999999996 27.915 24.279999999999998 45-49 20.135 27.87 27.500000000000004 24.495 50-54 20.09 27.279999999999998 28.189999999999998 24.44 55-59 20.419999999999998 28.360000000000003 27.245 23.974999999999998 60-64 19.825 27.3 28.12 24.755 65-69 20.34 27.54 27.705000000000002 24.415 70-74 20.294999999999998 27.32 28.02 24.365000000000002 75-79 20.405 27.644999999999996 28.050000000000004 23.9 80-84 20.765 27.275 27.685 24.275 85-89 20.54 27.634999999999998 27.1 24.725 90-94 20.674999999999997 27.26 27.900000000000002 24.165 95-99 20.015 28.225 27.49 24.27 100-104 20.575 27.845 27.62 23.96 105-109 20.59 27.525 27.779999999999998 24.104999999999997 110-114 20.8 27.16 27.584999999999997 24.455 115-119 20.465 27.98 27.47 24.085 120-124 20.53 27.529999999999998 27.605 24.335 125-129 21.16 27.35 27.529999999999998 23.96 130-134 21.154999999999998 28.18 26.605 24.060000000000002 135-139 21.13 27.985 26.755000000000003 24.13 140-144 21.4 28.044999999999998 27.095000000000002 23.46 145-149 21.51 28.599999999999998 26.35 23.54 150-151 21.95 27.962500000000002 25.8625 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.5 25 5.5 26 7.5 27 6.5 28 7.5 29 10.0 30 13.5 31 15.5 32 24.0 33 35.5 34 45.5 35 57.0 36 68.0 37 94.0 38 127.5 39 156.0 40 189.0 41 215.5 42 234.0 43 258.0 44 280.5 45 270.0 46 260.0 47 252.0 48 237.5 49 219.5 50 176.0 51 146.5 52 119.0 53 96.0 54 86.5 55 74.0 56 59.5 57 39.0 58 23.5 59 19.5 60 19.5 61 15.0 62 10.0 63 9.0 64 5.5 65 1.0 66 2.0 67 2.0 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52213279678068 98.925 2 0.4024144869215292 0.8 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.025150905432595575 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0125 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0125 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.0625 0.0 0.0 0.025 0.0 86-87 0.0875 0.0 0.0 0.025 0.0 88-89 0.125 0.0 0.0 0.025 0.0 90-91 0.1375 0.0 0.0 0.025 0.0 92-93 0.225 0.0 0.0 0.025 0.0 94-95 0.25 0.0 0.0 0.025 0.0 96-97 0.35 0.0 0.0 0.025 0.0 98-99 0.3875 0.0 0.0 0.025 0.0 100-101 0.55 0.0 0.0 0.025 0.0 102-103 0.7250000000000001 0.0 0.0 0.025 0.0 104-105 0.9 0.0 0.0 0.025 0.0 106-107 1.1749999999999998 0.0 0.0 0.025 0.0 108-109 1.4125 0.0 0.0 0.025 0.0 110-111 1.5625 0.0 0.0 0.025 0.0 112-113 1.7625 0.0 0.0 0.025 0.0 114-115 1.9875 0.0 0.0 0.025 0.0 116-117 2.275 0.0 0.0 0.025 0.0 118-119 2.5625 0.0 0.0 0.025 0.0 120-121 2.8375 0.0 0.0 0.025 0.0 122-123 3.1375 0.0 0.0 0.025 0.0 124-125 3.6624999999999996 0.0 0.0 0.025 0.0 126-127 3.9875 0.0 0.0 0.025 0.0 128-129 4.35 0.0 0.0 0.025 0.0 130-131 4.8625 0.0 0.0 0.025 0.0 132-133 5.325 0.0 0.0 0.025 0.0 134-135 5.887499999999999 0.0 0.0 0.025 0.0 136-137 6.5375 0.0 0.0 0.025 0.0 138-139 7.2625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6053289 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053289_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.46025 33.0 33.0 34.0 32.0 34.0 2 32.741 33.0 33.0 34.0 32.0 34.0 3 32.84975 33.0 33.0 34.0 32.0 34.0 4 32.72675 33.0 33.0 34.0 32.0 34.0 5 32.77625 33.0 33.0 34.0 32.0 34.0 6 36.9265 38.0 38.0 38.0 36.0 38.0 7 36.98625 38.0 38.0 38.0 36.0 38.0 8 36.832 38.0 38.0 38.0 36.0 38.0 9 36.82125 38.0 38.0 38.0 36.0 38.0 10-14 36.888349999999996 38.0 38.0 38.0 36.0 38.0 15-19 36.869899999999994 38.0 38.0 38.0 36.0 38.0 20-24 36.873749999999994 38.0 38.0 38.0 36.0 38.0 25-29 36.89785 38.0 38.0 38.0 36.0 38.0 30-34 36.8274 38.0 38.0 38.0 36.0 38.0 35-39 36.78935 38.0 38.0 38.0 35.6 38.0 40-44 36.856049999999996 38.0 38.0 38.0 35.8 38.0 45-49 36.7593 38.0 38.0 38.0 35.6 38.0 50-54 36.7374 38.0 38.0 38.0 35.4 38.0 55-59 36.69465 38.0 38.0 38.0 35.4 38.0 60-64 36.622 38.0 38.0 38.0 35.0 38.0 65-69 36.609 38.0 38.0 38.0 35.0 38.0 70-74 36.6017 38.0 38.0 38.0 34.6 38.0 75-79 36.65405 38.0 38.0 38.0 35.2 38.0 80-84 36.5388 38.0 38.0 38.0 34.4 38.0 85-89 36.44735 38.0 38.0 38.0 34.0 38.0 90-94 36.427 38.0 38.0 38.0 34.0 38.0 95-99 36.277300000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.228699999999996 38.0 38.0 38.0 34.0 38.0 105-109 35.96415 38.0 38.0 38.0 33.0 38.0 110-114 35.96535 38.0 38.0 38.0 33.2 38.0 115-119 35.812799999999996 38.0 37.6 38.0 31.8 38.0 120-124 35.6472 38.0 37.0 38.0 31.4 38.0 125-129 35.6699 38.0 37.2 38.0 31.4 38.0 130-134 35.4063 38.0 36.4 38.0 31.2 38.0 135-139 35.2841 38.0 36.0 38.0 30.6 38.0 140-144 34.869299999999996 38.0 36.0 38.0 27.8 38.0 145-149 34.3533 38.0 36.0 38.0 26.4 38.0 150-151 31.490625 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 2.0 5 1.0 6 1.0 7 1.0 8 0.0 9 2.0 10 2.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 5.0 17 3.0 18 2.0 19 3.0 20 7.0 21 7.0 22 12.0 23 10.0 24 18.0 25 23.0 26 24.0 27 36.0 28 32.0 29 33.0 30 46.0 31 72.0 32 73.0 33 85.0 34 124.0 35 222.0 36 445.0 37 2695.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.47795591182365 14.529058116232466 20.465931863727455 38.52705410821643 2 22.7 22.1 37.824999999999996 17.375 3 20.75 24.875 31.075000000000003 23.3 4 22.2 33.025 23.575 21.2 5 25.374999999999996 34.075 22.875 17.675 6 18.343343343343342 37.16216216216216 23.673673673673672 20.82082082082082 7 18.48886664998749 17.112834625969477 43.8829121841381 20.515386539904927 8 20.195195195195197 24.1991991991992 27.902902902902905 27.7027027027027 9 22.408612919379067 22.55883825738608 29.218828242363543 25.81372058087131 10-14 22.57337473705299 28.954222177702093 25.878994290293498 22.593408794951415 15-19 22.870157172890178 28.05085594153569 27.169886875563122 21.909100010011013 20-24 23.001051419416214 27.942722675612075 27.196715566014117 21.859510338957595 25-29 22.98453685632788 27.833658609818347 27.66851824050443 21.513286293349346 30-34 22.637637637637635 27.967967967967965 28.053053053053052 21.34134134134134 35-39 22.732049036777582 27.760820615461597 28.08606454841131 21.421065799349513 40-44 23.10657255844221 27.70185713570606 27.536667167242328 21.654903138609402 45-49 23.251275893125186 28.459921945361756 26.738717101971382 21.55008505954168 50-54 23.405213388702656 27.793065492570168 27.537899634762596 21.263821483964577 55-59 23.582403283118964 27.526149842350232 27.62624493268605 21.26520194184475 60-64 23.70277708281211 27.32549412059044 27.47060295221416 21.50112584438329 65-69 23.901071392810653 27.300490637829178 26.819865825573245 21.978572143786923 70-74 23.805947732051667 27.29548412936818 27.51076399319115 21.387804145389005 75-79 23.340342445178734 27.79112846700711 27.450685891659155 21.417843196155 80-84 24.280494519245206 28.009409880374392 26.60293307973372 21.10716252064668 85-89 24.10392470965158 27.953544253103722 26.977372847416902 20.965158189827793 90-94 23.831682177524264 28.15971179825878 26.5585910137096 21.450015010507357 95-99 24.310802021313854 27.84309801370891 27.052584179716817 20.793515785260418 100-104 23.810476809926453 27.28273377695502 27.037574423375194 21.869214989743334 105-109 24.20905086103324 27.523027633159792 27.25270324389267 21.0152182619143 110-114 23.977574210341892 27.42654052159984 27.58171897682335 21.014166291234922 115-119 24.896161737476856 27.613471450733122 26.767752589701242 20.722614222088776 120-124 24.2992992992993 27.832832832832832 26.99199199199199 20.875875875875877 125-129 24.593200821108496 28.03284433985881 26.831222149902366 20.542732689130325 130-134 25.097626914989483 27.665965755482127 26.619605487133274 20.616801842395112 135-139 25.21512907744647 28.372023213928355 26.120672403442065 20.29217530518311 140-144 25.226397158152796 28.403462250462802 26.182018311902738 20.188122279481664 145-149 25.436446400880396 27.81251563203442 26.64198889500275 20.10904907208244 150-151 25.581395348837212 28.59464866216554 26.39409852463116 19.42985746436609 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 2.0 25 2.5 26 3.5 27 4.5 28 6.0 29 8.0 30 10.5 31 14.0 32 17.5 33 24.5 34 28.0 35 43.0 36 59.5 37 75.5 38 117.0 39 151.0 40 183.0 41 213.5 42 243.0 43 275.0 44 282.5 45 279.5 46 286.5 47 280.5 48 243.5 49 220.5 50 192.0 51 143.5 52 116.0 53 95.0 54 84.5 55 71.0 56 55.5 57 46.5 58 37.0 59 26.5 60 15.5 61 10.0 62 8.0 63 7.0 64 3.0 65 1.5 66 1.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.075 8 0.1 9 0.15 10-14 0.16999999999999998 15-19 0.11 20-24 0.135 25-29 0.08499999999999999 30-34 0.1 35-39 0.075 40-44 0.11499999999999999 45-49 0.06999999999999999 50-54 0.065 55-59 0.095 60-64 0.075 65-69 0.13 70-74 0.13 75-79 0.13 80-84 0.105 85-89 0.12 90-94 0.06999999999999999 95-99 0.065 100-104 0.065 105-109 0.12 110-114 0.11499999999999999 115-119 0.08499999999999999 120-124 0.1 125-129 0.135 130-134 0.13 135-139 0.06 140-144 0.065 145-149 0.045 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3193849256365 98.5 2 0.5797832114948324 1.15 3 0.07562389715149988 0.22499999999999998 4 0.0 0.0 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7625 0.0 0.0 0.0 0.0 114-115 1.9875 0.0 0.0 0.0 0.0 116-117 2.275 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.1625 0.0 0.0 0.0 0.0 124-125 3.65 0.0 0.0 0.0 0.0 126-127 3.9625000000000004 0.0 0.0 0.0 0.0 128-129 4.324999999999999 0.0 0.0 0.0 0.0 130-131 4.8375 0.0 0.0 0.0 0.0 132-133 5.3 0.0 0.0 0.0 0.0 134-135 5.862500000000001 0.0 0.0 0.0 0.0 136-137 6.525 0.0 0.0 0.0 0.0 138-139 7.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGAGA 10 0.006830828 145.0 1 >>END_MODULE Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504891 spots for SRR6053289.sra Written 2504891 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra Read 2504874 spots for SRR6053289.sra Written 2504874 spots for SRR6053289.sra SRR ids: ['SRR6053289.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bafd3y7u SRR6053289.sra spots: 50097497 blocks: [[1, 2504874], [2504875, 5009748], [5009749, 7514622], [7514623, 10019496], [10019497, 12524370], [12524371, 15029244], [15029245, 17534118], [17534119, 20038992], [20038993, 22543866], [22543867, 25048740], [25048741, 27553614], [27553615, 30058488], [30058489, 32563362], [32563363, 35068236], [35068237, 37573110], [37573111, 40077984], [40077985, 42582858], [42582859, 45087732], [45087733, 47592606], [47592607, 50097497]] SRR6053289 file size 16954697 SRR6053289 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053289 SRR6053289_1.fastq SRR6053289_2.fastq Input file: SRR6053289_1.fastq Paired file: SRR6053289_2.fastq trimmed: SRR6053289-trimmed-pair1.fastq, SRR6053289-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:24:14 2025 >> started Tue Feb 11 18:25:17 2025 >> done (62.771s) 50097497 read pairs processed; of these: 35588 ( 0.07%) short read pairs filtered out after trimming by size control 39210 ( 0.08%) empty read pairs filtered out after trimming by size control 50022699 (99.85%) read pairs available; of these: 16576163 (33.14%) trimmed read pairs available after processing 33446536 (66.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 12 0.00% 20 6 0.00% 21 11 0.00% 22 3 0.00% 23 8 0.00% 24 7 0.00% 25 10 0.00% 26 9 0.00% 27 7 0.00% 28 7 0.00% 29 8 0.00% 30 17 0.00% 31 12 0.00% 32 11 0.00% 33 15 0.00% 34 16 0.00% 35 16 0.00% 36 19 0.00% 37 30 0.00% 38 30 0.00% 39 35 0.00% 40 35 0.00% 41 50 0.00% 42 44 0.00% 43 69 0.00% 44 55 0.00% 45 77 0.00% 46 72 0.00% 47 103 0.00% 48 113 0.00% 49 144 0.00% 50 172 0.00% 51 184 0.00% 52 180 0.00% 53 222 0.00% 54 240 0.00% 55 252 0.00% 56 295 0.00% 57 318 0.00% 58 351 0.00% 59 397 0.00% 60 469 0.00% 61 569 0.00% 62 609 0.00% 63 693 0.00% 64 691 0.00% 65 780 0.00% 66 965 0.00% 67 999 0.00% 68 1094 0.00% 69 1265 0.00% 70 1537 0.00% 71 1723 0.00% 72 1831 0.00% 73 2024 0.00% 74 2379 0.00% 75 2627 0.01% 76 2790 0.01% 77 3245 0.01% 78 3613 0.01% 79 4163 0.01% 80 4645 0.01% 81 5263 0.01% 82 5901 0.01% 83 6659 0.01% 84 8250 0.02% 85 9724 0.02% 86 10761 0.02% 87 11946 0.02% 88 13376 0.03% 89 14678 0.03% 90 16293 0.03% 91 17404 0.03% 92 18959 0.04% 93 20819 0.04% 94 23149 0.05% 95 25440 0.05% 96 27462 0.05% 97 30349 0.06% 98 32805 0.07% 99 35569 0.07% 100 37986 0.08% 101 41263 0.08% 102 43986 0.09% 103 46814 0.09% 104 50338 0.10% 105 53652 0.11% 106 58063 0.12% 107 62502 0.12% 108 66283 0.13% 109 70877 0.14% 110 74614 0.15% 111 78538 0.16% 112 83132 0.17% 113 86166 0.17% 114 90226 0.18% 115 96551 0.19% 116 101402 0.20% 117 105498 0.21% 118 111694 0.22% 119 116432 0.23% 120 121576 0.24% 121 127255 0.25% 122 130472 0.26% 123 134584 0.27% 124 140697 0.28% 125 145917 0.29% 126 150938 0.30% 127 157677 0.32% 128 163322 0.33% 129 166577 0.33% 130 172355 0.34% 131 178663 0.36% 132 182298 0.36% 133 190663 0.38% 134 196018 0.39% 135 203425 0.41% 136 210080 0.42% 137 218445 0.44% 138 227906 0.46% 139 237791 0.48% 140 248432 0.50% 141 260762 0.52% 142 278089 0.56% 143 295782 0.59% 144 325946 0.65% 145 361369 0.72% 146 418325 0.84% 147 508206 1.02% 148 698924 1.40% 149 1218957 2.44% 150 6651510 13.30% 151 33446536 66.86% 50022699 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=31 prefix-density=0.44 prefix-fanout=2.0 sequence=GGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=34 fanout-score=31.49 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.6 sequence=ACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=25 prefix-density=0.53 prefix-fanout=2.9 sequence=ACCGCACCCCGGCACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=88.65 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=6.1 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTT SRR6053289 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:26:02 Started mapping on | Feb 11 18:26:02 Finished on | Feb 11 18:32:07 Mapping speed, Million of reads per hour | 493.37 Number of input reads | 50022699 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 47036366 Uniquely mapped reads % | 94.03% Average mapped length | 293.30 Number of splices: Total | 47338123 Number of splices: Annotated (sjdb) | 46369366 Number of splices: GT/AG | 46359341 Number of splices: GC/AG | 770279 Number of splices: AT/AC | 31518 Number of splices: Non-canonical | 176985 Mismatch rate per base, % | 0.73% Deletion rate per base | 0.06% Deletion average length | 3.15 Insertion rate per base | 0.04% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1642014 % of reads mapped to multiple loci | 3.28% Number of reads mapped to too many loci | 389977 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.76% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1365796 1365796 1365796 N_multimapping 1642014 1642014 1642014 N_noFeature 1163863 46442134 1368853 N_ambiguous 684348 2343 294030 UnstrandedReadsAssigned:45188155 PositiveStrandReadsAssigned:591889 NegativeStrandReadsAssigned:45373483 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6053289 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053289-trimmed-pair1.fastq SRR6053289-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 50,022,699 reads, 44,539,380 reads pseudoaligned [quant] estimated average fragment length: 243.5 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,231 rounds 52401 SRR6053289.ke.tsv 34699 SRR6053289.se.tsv 87100 total ==> SRR6053289.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.5 2013 20.7622 Potri.005G024800.1.v4.1 1035 792.5 1100 25.4182 Potri.004G059700.1.v4.1 961 718.546 7 0.178399 Potri.007G009000.2.v4.1 1416 1173.5 0 0 Potri.003G141000.2.v4.1 2943 2700.5 3248.2 22.0267 Potri.016G087400.1.v4.1 270 84.5276 3345 724.682 Potri.015G069301.1.v4.1 564 327.722 0 0 Potri.010G195200.1.v4.1 1773 1530.5 103.922 1.24344 Potri.012G127500.1.v4.1 977 734.514 384 9.57374 ==> SRR6053289.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 461 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 724 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR6053289 completed mapping pipeline successfully