Starting /dee2/code/volunteer_pipeline.sh SRR6232728 current disk space = 3049718685696 free memory = 1578861292 SRR6232728 SRAfilesize d12db15efd383fe60f0940b63c247e9a SRR6232728.sra SRR6232728.sra file validated SRR6232728 is paired end SRR6232728 is conventional basespace SRR6232728 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232728_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.56325 35.0 35.0 35.0 35.0 35.0 2 34.704 35.0 35.0 35.0 35.0 35.0 3 34.728 35.0 35.0 35.0 35.0 35.0 4 34.781 35.0 35.0 35.0 35.0 35.0 5 34.785 35.0 35.0 35.0 35.0 35.0 6 39.6235 40.0 40.0 40.0 39.0 40.0 7 39.6325 40.0 40.0 40.0 39.0 40.0 8 39.65925 40.0 40.0 40.0 39.0 40.0 9 39.6965 40.0 40.0 40.0 40.0 40.0 10-14 39.6469 40.0 40.0 40.0 39.0 40.0 15-19 39.67215 40.0 40.0 40.0 39.4 40.0 20-24 39.6395 40.0 40.0 40.0 39.0 40.0 25-29 39.62325 40.0 40.0 40.0 39.2 40.0 30-34 39.619299999999996 40.0 40.0 40.0 39.0 40.0 35-39 39.5797 40.0 40.0 40.0 39.0 40.0 40-44 39.585550000000005 40.0 40.0 40.0 39.0 40.0 45-49 39.57125 40.0 40.0 40.0 39.0 40.0 50-54 39.522200000000005 40.0 40.0 40.0 39.0 40.0 55-59 39.5313 40.0 40.0 40.0 39.0 40.0 60-64 39.452549999999995 40.0 40.0 40.0 39.0 40.0 65-69 39.407500000000006 40.0 40.0 40.0 39.0 40.0 70-74 39.46045 40.0 40.0 40.0 39.0 40.0 75-79 39.4294 40.0 40.0 40.0 39.0 40.0 80-84 39.41605 40.0 40.0 40.0 39.0 40.0 85-89 39.371649999999995 40.0 40.0 40.0 39.0 40.0 90-94 39.3573 40.0 40.0 40.0 39.0 40.0 95-99 39.3317 40.0 40.0 40.0 39.0 40.0 100-104 38.9016 39.8 39.4 39.8 38.2 40.0 105-109 39.3543 40.0 40.0 40.0 39.0 40.0 110-114 39.28405 40.0 40.0 40.0 39.0 40.0 115-119 39.313599999999994 40.0 40.0 40.0 39.0 40.0 120-124 39.22619999999999 40.0 40.0 40.0 39.0 40.0 125-129 39.1714 40.0 40.0 40.0 39.0 40.0 130-134 39.08855 40.0 40.0 40.0 38.8 40.0 135-139 39.011250000000004 40.0 40.0 40.0 38.4 40.0 140-144 38.96345 40.0 39.6 40.0 38.0 40.0 145-149 38.8156 40.0 39.0 40.0 38.0 40.0 150-151 36.954499999999996 39.5 36.5 39.5 32.5 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 3.0 25 1.0 26 4.0 27 6.0 28 10.0 29 9.0 30 25.0 31 20.0 32 23.0 33 29.0 34 27.0 35 27.0 36 63.0 37 84.0 38 214.0 39 3451.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.733938019652307 11.438649533887629 8.994708994708994 55.83270345175107 2 17.125 20.474999999999998 43.425000000000004 18.975 3 17.525 22.35 26.900000000000002 33.225 4 21.275 32.5 21.275 24.95 5 22.75 36.9 23.625 16.725 6 15.6 34.625 28.449999999999996 21.325 7 12.875 22.3 44.925 19.900000000000002 8 15.6 22.725 34.699999999999996 26.974999999999998 9 17.5 21.8 35.0 25.7 10-14 19.905 29.520000000000003 27.155 23.419999999999998 15-19 20.1 27.975 27.529999999999998 24.395 20-24 19.335 28.64 27.58 24.445 25-29 19.495 28.794999999999998 28.084999999999997 23.625 30-34 19.975 28.360000000000003 27.625 24.04 35-39 20.0 28.38 28.110000000000003 23.51 40-44 19.48 29.104999999999997 27.735 23.68 45-49 19.545 28.32 27.925 24.21 50-54 19.835 28.139999999999997 28.025 24.0 55-59 19.919999999999998 28.23 27.97 23.880000000000003 60-64 20.549999999999997 28.095 27.6 23.755000000000003 65-69 19.971997199719972 28.36283628362836 28.052805280528055 23.612361236123615 70-74 19.93199319931993 28.89288928892889 27.367736773677372 23.807380738073807 75-79 20.553221288515406 28.286314525810326 27.330932372949178 23.82953181272509 80-84 21.02815422313347 27.809171375706356 27.689153373005954 23.473521028154224 85-89 20.224044808961793 28.555711142228446 27.770554110822165 23.449689937987596 90-94 20.75122536761028 28.678603581074324 27.738321496448936 22.83184955486646 95-99 20.48922014906708 28.212695713070886 27.527387324295933 23.770696813566104 100-104 20.256076823046914 28.233470041012303 27.728318495548663 23.782134640392115 105-109 19.733946789357873 28.375675135027006 28.515703140628123 23.374674934987 110-114 20.975243810952737 27.696924231057764 28.24206051512878 23.085771442860715 115-119 21.065266316579145 28.10202550637659 27.506876719179797 23.325831457864467 120-124 20.618092713907085 28.50927639145872 27.32409861479222 23.54853227984198 125-129 20.912091209120913 28.137813781378142 27.262726272627262 23.687368736873687 130-134 21.498224733710057 28.614292143821572 26.8740311046657 23.01345201780267 135-139 21.69608480424021 28.651432571628582 26.521326066303313 23.131156557827893 140-144 21.395 28.360000000000003 27.015 23.23 145-149 20.91 28.665000000000003 26.979999999999997 23.445 150-151 20.9375 29.599999999999998 26.575 22.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 0.5 22 0.0 23 0.0 24 0.5 25 3.5 26 7.5 27 9.0 28 11.5 29 17.0 30 19.5 31 25.0 32 32.0 33 37.0 34 50.0 35 70.0 36 93.5 37 114.0 38 129.5 39 160.5 40 209.5 41 238.0 42 255.5 43 250.0 44 259.5 45 270.0 46 268.0 47 262.0 48 222.5 49 201.5 50 171.0 51 138.5 52 114.0 53 85.5 54 63.0 55 49.5 56 41.0 57 27.5 58 22.0 59 18.0 60 11.5 61 9.5 62 8.0 63 5.0 64 2.5 65 3.0 66 3.0 67 1.5 68 1.5 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.01 75-79 0.04 80-84 0.015 85-89 0.02 90-94 0.03 95-99 0.045 100-104 0.03 105-109 0.02 110-114 0.025 115-119 0.025 120-124 0.015 125-129 0.01 130-134 0.015 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.325 0.0 0.0 0.0 0.0 114-115 1.5875 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.1375 0.0 0.0 0.0 0.0 128-129 3.55 0.0 0.0 0.0 0.0 130-131 3.875 0.0 0.0 0.0 0.0 132-133 4.324999999999999 0.0 0.0 0.0 0.0 134-135 4.8 0.0 0.0 0.0 0.0 136-137 5.387499999999999 0.0 0.0 0.0 0.0 138-139 5.949999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCAAG 10 0.00692859 144.3125 5 >>END_MODULE SRR6232728 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232728_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.441 35.0 35.0 35.0 34.0 35.0 2 34.54975 35.0 35.0 35.0 35.0 35.0 3 34.51925 35.0 35.0 35.0 35.0 35.0 4 34.572 35.0 35.0 35.0 35.0 35.0 5 34.5995 35.0 35.0 35.0 35.0 35.0 6 39.454 40.0 40.0 40.0 39.0 40.0 7 39.48325 40.0 40.0 40.0 39.0 40.0 8 39.445 40.0 40.0 40.0 39.0 40.0 9 39.4315 40.0 40.0 40.0 39.0 40.0 10-14 39.4351 40.0 40.0 40.0 39.0 40.0 15-19 39.3919 40.0 40.0 40.0 39.0 40.0 20-24 39.3961 40.0 40.0 40.0 39.0 40.0 25-29 39.3847 40.0 40.0 40.0 39.0 40.0 30-34 39.36445 40.0 40.0 40.0 39.0 40.0 35-39 39.34975 40.0 40.0 40.0 39.0 40.0 40-44 39.26370000000001 40.0 40.0 40.0 39.0 40.0 45-49 39.25945 40.0 40.0 40.0 39.0 40.0 50-54 39.25365 40.0 40.0 40.0 39.0 40.0 55-59 39.24525 40.0 40.0 40.0 39.0 40.0 60-64 39.19134999999999 40.0 40.0 40.0 39.0 40.0 65-69 39.1465 40.0 40.0 40.0 39.0 40.0 70-74 39.14995 40.0 40.0 40.0 39.0 40.0 75-79 39.114549999999994 40.0 40.0 40.0 39.0 40.0 80-84 39.10025 40.0 40.0 40.0 39.0 40.0 85-89 39.042449999999995 40.0 40.0 40.0 38.6 40.0 90-94 38.917649999999995 40.0 40.0 40.0 38.0 40.0 95-99 38.93405 40.0 40.0 40.0 38.0 40.0 100-104 38.475899999999996 39.6 39.0 39.8 37.0 40.0 105-109 38.909749999999995 40.0 39.8 40.0 38.0 40.0 110-114 38.9006 40.0 39.6 40.0 38.0 40.0 115-119 38.7904 40.0 39.0 40.0 38.0 40.0 120-124 38.70815 40.0 39.0 40.0 37.6 40.0 125-129 38.5755 40.0 39.0 40.0 37.0 40.0 130-134 38.41224999999999 40.0 39.0 40.0 36.2 40.0 135-139 38.2743 40.0 39.0 40.0 36.0 40.0 140-144 38.07835 40.0 39.0 40.0 36.0 40.0 145-149 37.53325 39.6 38.8 40.0 34.6 40.0 150-151 34.77225 38.0 35.0 39.5 25.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 3.0 19 6.0 20 6.0 21 6.0 22 3.0 23 8.0 24 9.0 25 7.0 26 12.0 27 15.0 28 7.0 29 20.0 30 18.0 31 18.0 32 24.0 33 30.0 34 39.0 35 52.0 36 88.0 37 130.0 38 296.0 39 3197.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.85 15.575 15.125 44.45 2 21.575 24.875 40.375 13.175 3 17.849999999999998 28.425 30.75 22.975 4 21.25 33.0 24.625 21.125 5 24.975 35.05 23.65 16.325 6 18.775 37.5 26.424999999999997 17.299999999999997 7 16.875 18.175 43.9 21.05 8 20.150000000000002 21.925 31.45 26.474999999999998 9 20.599999999999998 22.825 32.5 24.075 10-14 22.755 27.834999999999997 27.0 22.41 15-19 22.88 28.23 27.245 21.645 20-24 22.439999999999998 28.705000000000002 27.915 20.94 25-29 22.07 28.044999999999998 28.235 21.65 30-34 22.5 27.805000000000003 28.26 21.435000000000002 35-39 22.61 28.544999999999998 28.005000000000003 20.84 40-44 22.42 28.08 28.22 21.279999999999998 45-49 23.169999999999998 27.560000000000002 27.965 21.305 50-54 22.935 27.834999999999997 28.005000000000003 21.224999999999998 55-59 22.585 27.85 28.035 21.529999999999998 60-64 22.884999999999998 27.83 27.26 22.025 65-69 23.11 27.534999999999997 27.63 21.725 70-74 22.925 28.09 27.894999999999996 21.09 75-79 22.93 28.215 28.084999999999997 20.77 80-84 23.145 28.189999999999998 28.015 20.65 85-89 23.225 28.18 27.255000000000003 21.34 90-94 23.205000000000002 27.185 28.27 21.34 95-99 23.195 27.750000000000004 27.944999999999997 21.11 100-104 23.535 27.805000000000003 27.650000000000002 21.01 105-109 23.93 27.534999999999997 27.560000000000002 20.974999999999998 110-114 23.84 27.52 27.894999999999996 20.745 115-119 23.24 28.03 27.650000000000002 21.08 120-124 23.985 27.48 27.889999999999997 20.645 125-129 24.09 27.415 27.935 20.560000000000002 130-134 24.47 27.38 27.815 20.335 135-139 24.47 27.77 27.500000000000004 20.26 140-144 25.180000000000003 28.49 27.08 19.25 145-149 25.21 28.044999999999998 26.83 19.915 150-151 25.575 28.1625 26.987499999999997 19.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 1.5 23 1.0 24 1.0 25 2.0 26 3.0 27 3.5 28 4.0 29 10.0 30 13.5 31 15.5 32 21.0 33 32.0 34 41.0 35 61.0 36 85.0 37 112.5 38 144.5 39 164.5 40 202.0 41 241.5 42 262.5 43 276.0 44 279.0 45 287.5 46 280.5 47 245.5 48 219.5 49 215.0 50 172.0 51 125.5 52 111.0 53 89.0 54 70.5 55 48.0 56 34.5 57 31.5 58 29.0 59 19.0 60 11.5 61 8.0 62 6.0 63 5.0 64 3.0 65 2.5 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.325 0.0 0.0 0.0 0.0 114-115 1.6125 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.1375 0.0 0.0 0.0 0.0 128-129 3.55 0.0 0.0 0.0 0.0 130-131 3.8875 0.0 0.0 0.0 0.0 132-133 4.35 0.0 0.0 0.0 0.0 134-135 4.825 0.0 0.0 0.0 0.0 136-137 5.4125 0.0 0.0 0.0 0.0 138-139 5.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAACAC 10 0.006830828 145.0 9 >>END_MODULE Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701922 spots for SRR6232728.sra Written 701922 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra Read 701906 spots for SRR6232728.sra Written 701906 spots for SRR6232728.sra SRR ids: ['SRR6232728.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d51yq2fq SRR6232728.sra spots: 14038136 blocks: [[1, 701906], [701907, 1403812], [1403813, 2105718], [2105719, 2807624], [2807625, 3509530], [3509531, 4211436], [4211437, 4913342], [4913343, 5615248], [5615249, 6317154], [6317155, 7019060], [7019061, 7720966], [7720967, 8422872], [8422873, 9124778], [9124779, 9826684], [9826685, 10528590], [10528591, 11230496], [11230497, 11932402], [11932403, 12634308], [12634309, 13336214], [13336215, 14038136]] SRR6232728 file size 4735363 SRR6232728 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6232728 SRR6232728_1.fastq SRR6232728_2.fastq Input file: SRR6232728_1.fastq Paired file: SRR6232728_2.fastq trimmed: SRR6232728-trimmed-pair1.fastq, SRR6232728-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:55:44 2025 >> started Wed Feb 12 07:55:59 2025 >> done (15.750s) 14038136 read pairs processed; of these: 1748 ( 0.01%) short read pairs filtered out after trimming by size control 5693 ( 0.04%) empty read pairs filtered out after trimming by size control 14030695 (99.95%) read pairs available; of these: 2402321 (17.12%) trimmed read pairs available after processing 11628374 (82.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 6 0.00% 21 5 0.00% 22 2 0.00% 23 5 0.00% 24 8 0.00% 25 2 0.00% 26 0 0.00% 27 7 0.00% 28 3 0.00% 29 3 0.00% 30 7 0.00% 31 4 0.00% 32 3 0.00% 33 8 0.00% 34 2 0.00% 35 7 0.00% 36 7 0.00% 37 6 0.00% 38 4 0.00% 39 12 0.00% 40 9 0.00% 41 10 0.00% 42 14 0.00% 43 15 0.00% 44 21 0.00% 45 20 0.00% 46 17 0.00% 47 30 0.00% 48 30 0.00% 49 33 0.00% 50 40 0.00% 51 30 0.00% 52 51 0.00% 53 57 0.00% 54 46 0.00% 55 69 0.00% 56 50 0.00% 57 66 0.00% 58 75 0.00% 59 96 0.00% 60 102 0.00% 61 131 0.00% 62 148 0.00% 63 144 0.00% 64 189 0.00% 65 191 0.00% 66 235 0.00% 67 213 0.00% 68 289 0.00% 69 306 0.00% 70 340 0.00% 71 390 0.00% 72 460 0.00% 73 529 0.00% 74 593 0.00% 75 657 0.00% 76 697 0.00% 77 825 0.01% 78 1016 0.01% 79 1096 0.01% 80 1197 0.01% 81 1375 0.01% 82 1616 0.01% 83 1734 0.01% 84 2032 0.01% 85 2356 0.02% 86 2594 0.02% 87 2970 0.02% 88 3321 0.02% 89 3572 0.03% 90 3968 0.03% 91 4517 0.03% 92 4972 0.04% 93 5437 0.04% 94 6176 0.04% 95 6561 0.05% 96 7023 0.05% 97 7697 0.05% 98 8259 0.06% 99 8826 0.06% 100 9555 0.07% 101 10291 0.07% 102 11048 0.08% 103 11714 0.08% 104 12765 0.09% 105 13529 0.10% 106 14668 0.10% 107 15384 0.11% 108 16233 0.12% 109 17356 0.12% 110 18541 0.13% 111 19157 0.14% 112 20614 0.15% 113 21149 0.15% 114 22276 0.16% 115 23460 0.17% 116 24406 0.17% 117 25529 0.18% 118 26175 0.19% 119 27102 0.19% 120 28152 0.20% 121 29286 0.21% 122 29984 0.21% 123 30819 0.22% 124 32189 0.23% 125 33314 0.24% 126 34153 0.24% 127 35879 0.26% 128 36809 0.26% 129 37764 0.27% 130 38939 0.28% 131 39670 0.28% 132 40480 0.29% 133 41959 0.30% 134 43349 0.31% 135 44338 0.32% 136 45951 0.33% 137 47906 0.34% 138 48819 0.35% 139 50461 0.36% 140 52067 0.37% 141 53622 0.38% 142 56088 0.40% 143 57112 0.41% 144 59212 0.42% 145 63626 0.45% 146 67167 0.48% 147 72892 0.52% 148 83662 0.60% 149 106135 0.76% 150 503919 3.59% 151 11628374 82.88% 14030695 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=36 prefix-density=0.14 prefix-fanout=2.0 sequence=AGTGGCTCGCAGTTTCTCTGGTTTCAGCCCCAACTTAGCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=408.35 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=33.0 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=33 prefix-density=0.16 prefix-fanout=2.0 sequence=TCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCAGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTCCAGGTGGGCCATGCTTGGAGCTCTTGGATGCGTCTTCCCCGAGCTCTTGTCCCGCAACGGTGTCAAGTTCGGCGAGGCTGTATGGTTCAAGGCTGGAGCCCAGATCTTCAGCGAGGGTGGACTTGACTACTTGGGCAACCCAAGCTTGATCCACGCACAAAGCATCTTGGCCATCTGGGCTACACAGGTGGTCTTGATGGGTGCCGTTGAGGGTTACAGAATTGCTGGCGGGCCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=638.21 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=20.7 sequence=TTCTTGCTTACCTCAAATCTCTTGAAAGATACTGAAAAGGTCTTAATTCGACGCATCTCGGCAATGGAGAGTCGTATGCCCAATATTGCTATAATTACCTTCACCCTCGTCATCTTCCTCTATGGAGCTCAATCTGTGACTTTCGACTTCACAAACAACTGTCCATACACAGTCTGGCCAGGAACTCTAACGGCTGCTGGCGGTCCATCTTTATCTTCAACTGGCTTC SRR6232728 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:56:45 Started mapping on | Feb 12 07:56:45 Finished on | Feb 12 07:58:41 Mapping speed, Million of reads per hour | 435.44 Number of input reads | 14030695 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13117410 Uniquely mapped reads % | 93.49% Average mapped length | 295.39 Number of splices: Total | 12581650 Number of splices: Annotated (sjdb) | 12328700 Number of splices: GT/AG | 12312824 Number of splices: GC/AG | 220435 Number of splices: AT/AC | 11133 Number of splices: Non-canonical | 37258 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 438583 % of reads mapped to multiple loci | 3.13% Number of reads mapped to too many loci | 79220 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 477000 477000 477000 N_multimapping 438583 438583 438583 N_noFeature 436111 12985107 507344 N_ambiguous 138580 1071 76686 UnstrandedReadsAssigned:12542719 PositiveStrandReadsAssigned:131232 NegativeStrandReadsAssigned:12533380 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6232728 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6232728-trimmed-pair1.fastq SRR6232728-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,030,695 reads, 12,633,865 reads pseudoaligned [quant] estimated average fragment length: 245.555 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR6232728.ke.tsv 34699 SRR6232728.se.tsv 87100 total ==> SRR6232728.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.45 331 14.8871 Potri.005G024800.1.v4.1 1035 790.445 40 4.03634 Potri.004G059700.1.v4.1 961 716.535 99 11.0204 Potri.007G009000.2.v4.1 1416 1171.45 0 0 Potri.003G141000.2.v4.1 2943 2698.45 336.152 9.93622 Potri.016G087400.1.v4.1 270 84.663 1236 1164.46 Potri.015G069301.1.v4.1 564 326.514 0 0 Potri.010G195200.1.v4.1 1773 1528.45 13 0.678411 Potri.012G127500.1.v4.1 977 732.499 1868 203.409 ==> SRR6232728.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 46 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR6232728 completed mapping pipeline successfully