Starting /dee2/code/volunteer_pipeline.sh SRR6232733 current disk space = 3049745489920 free memory = 1582610856 SRR6232733 SRAfilesize 90a2be1cf6ca9eb46c92a6ecd47b598f SRR6232733.sra SRR6232733.sra file validated SRR6232733 is paired end SRR6232733 is conventional basespace SRR6232733 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232733_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.5275 35.0 35.0 35.0 35.0 35.0 2 34.7205 35.0 35.0 35.0 35.0 35.0 3 34.747 35.0 35.0 35.0 35.0 35.0 4 34.7795 35.0 35.0 35.0 35.0 35.0 5 34.81225 35.0 35.0 35.0 35.0 35.0 6 39.60675 40.0 40.0 40.0 39.0 40.0 7 39.661 40.0 40.0 40.0 39.0 40.0 8 39.62875 40.0 40.0 40.0 39.0 40.0 9 39.649 40.0 40.0 40.0 39.0 40.0 10-14 39.62295 40.0 40.0 40.0 39.0 40.0 15-19 39.6317 40.0 40.0 40.0 39.4 40.0 20-24 39.6372 40.0 40.0 40.0 39.0 40.0 25-29 39.620850000000004 40.0 40.0 40.0 39.0 40.0 30-34 39.597750000000005 40.0 40.0 40.0 39.2 40.0 35-39 39.57135 40.0 40.0 40.0 39.0 40.0 40-44 39.575900000000004 40.0 40.0 40.0 39.0 40.0 45-49 39.54275 40.0 40.0 40.0 39.0 40.0 50-54 39.49485 40.0 40.0 40.0 39.0 40.0 55-59 39.526250000000005 40.0 40.0 40.0 39.0 40.0 60-64 39.4519 40.0 40.0 40.0 39.0 40.0 65-69 39.44305 40.0 40.0 40.0 39.0 40.0 70-74 39.44745 40.0 40.0 40.0 39.0 40.0 75-79 39.421499999999995 40.0 40.0 40.0 39.0 40.0 80-84 39.449299999999994 40.0 40.0 40.0 39.0 40.0 85-89 39.36735 40.0 40.0 40.0 39.0 40.0 90-94 39.35015 40.0 40.0 40.0 39.0 40.0 95-99 39.32795 40.0 40.0 40.0 39.0 40.0 100-104 38.886 39.8 39.2 39.8 38.2 40.0 105-109 39.289249999999996 40.0 40.0 40.0 39.0 40.0 110-114 39.29215 40.0 40.0 40.0 39.0 40.0 115-119 39.27505000000001 40.0 40.0 40.0 39.0 40.0 120-124 39.200849999999996 40.0 40.0 40.0 39.0 40.0 125-129 39.1439 40.0 40.0 40.0 39.0 40.0 130-134 39.091300000000004 40.0 40.0 40.0 38.8 40.0 135-139 38.994749999999996 40.0 40.0 40.0 38.0 40.0 140-144 38.95255 40.0 39.8 40.0 38.0 40.0 145-149 38.762750000000004 40.0 39.0 40.0 38.0 40.0 150-151 36.8435 39.5 36.5 39.5 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 3.0 25 1.0 26 4.0 27 7.0 28 8.0 29 9.0 30 23.0 31 18.0 32 20.0 33 30.0 34 26.0 35 49.0 36 69.0 37 98.0 38 191.0 39 3440.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.974798387096776 11.23991935483871 10.206653225806452 53.578629032258064 2 19.525000000000002 17.65 41.65 21.175 3 19.1 20.375 25.474999999999998 35.05 4 22.25 29.525000000000002 22.05 26.174999999999997 5 21.55 35.3 24.05 19.1 6 17.2 35.525 25.775 21.5 7 13.775 24.075 44.074999999999996 18.075 8 16.55 23.775 33.324999999999996 26.35 9 17.45 22.400000000000002 34.125 26.025 10-14 19.27 29.845 26.995 23.89 15-19 19.63 28.139999999999997 27.595 24.635 20-24 19.259999999999998 28.939999999999998 27.92 23.880000000000003 25-29 19.81 28.744999999999997 27.815 23.630000000000003 30-34 19.89 28.59 27.555000000000003 23.965 35-39 20.315 28.49 27.41 23.785 40-44 20.215 29.195 26.995 23.595 45-49 19.830000000000002 28.49 27.36 24.32 50-54 19.645000000000003 28.185 28.305000000000003 23.865 55-59 19.865 28.59 27.750000000000004 23.794999999999998 60-64 20.385 28.025 27.595 23.995 65-69 20.14 28.355000000000004 27.48 24.025 70-74 20.165 27.939999999999998 27.750000000000004 24.145 75-79 20.24 28.249999999999996 27.575 23.935000000000002 80-84 20.27 27.96 27.24 24.529999999999998 85-89 20.474999999999998 28.000000000000004 28.01 23.515 90-94 20.485 27.61 27.495000000000005 24.41 95-99 20.51 28.139999999999997 27.87 23.48 100-104 20.615 27.845 27.839999999999996 23.7 105-109 20.919999999999998 27.939999999999998 27.450000000000003 23.69 110-114 20.78 28.055000000000003 27.615000000000002 23.549999999999997 115-119 20.815 28.57 26.88 23.735 120-124 20.635 28.12 27.500000000000004 23.745 125-129 20.715 27.250000000000004 27.83 24.205 130-134 20.849999999999998 28.265 27.08 23.805 135-139 21.215 28.425 26.745 23.615 140-144 21.005 27.834999999999997 27.515 23.645 145-149 21.08 28.055000000000003 26.755000000000003 24.11 150-151 20.8625 28.075 26.6125 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 3.0 25 3.5 26 3.5 27 7.5 28 9.0 29 10.0 30 18.5 31 23.0 32 29.0 33 36.5 34 41.0 35 61.5 36 89.5 37 117.0 38 144.0 39 153.5 40 180.0 41 216.5 42 243.0 43 260.5 44 268.5 45 276.0 46 280.0 47 269.5 48 245.0 49 210.0 50 171.5 51 143.0 52 120.5 53 92.0 54 60.0 55 44.0 56 35.5 57 31.0 58 25.0 59 18.0 60 14.5 61 10.5 62 7.5 63 6.5 64 5.5 65 5.0 66 3.0 67 1.0 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0125 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.0875 0.0 0.0 0.025 0.0 88-89 0.1 0.0 0.0 0.025 0.0 90-91 0.1 0.0 0.0 0.025 0.0 92-93 0.1125 0.0 0.0 0.025 0.0 94-95 0.1375 0.0 0.0 0.025 0.0 96-97 0.175 0.0 0.0 0.025 0.0 98-99 0.23750000000000002 0.0 0.0 0.025 0.0 100-101 0.36250000000000004 0.0 0.0 0.025 0.0 102-103 0.45 0.0 0.0 0.025 0.0 104-105 0.5625 0.0 0.0 0.025 0.0 106-107 0.75 0.0 0.0 0.025 0.0 108-109 0.975 0.0 0.0 0.025 0.0 110-111 1.2125 0.0 0.0 0.025 0.0 112-113 1.3125 0.0 0.0 0.025 0.0 114-115 1.3875000000000002 0.0 0.0 0.025 0.0 116-117 1.575 0.0 0.0 0.025 0.0 118-119 1.875 0.0 0.0 0.025 0.0 120-121 2.1125 0.0 0.0 0.025 0.0 122-123 2.45 0.0 0.0 0.025 0.0 124-125 2.8375000000000004 0.0 0.0 0.025 0.0 126-127 3.175 0.0 0.0 0.025 0.0 128-129 3.6375 0.0 0.0 0.025 0.0 130-131 4.1625 0.0 0.0 0.025 0.0 132-133 4.6125 0.0 0.0 0.025 0.0 134-135 4.949999999999999 0.0 0.0 0.025 0.0 136-137 5.425 0.0 0.0 0.025 0.0 138-139 5.9125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGTAA 10 0.006832588 144.9875 2 CGGTAAT 10 0.006832588 144.9875 3 TCGGAAG 30 0.0014445208 24.164585 140-144 >>END_MODULE SRR6232733 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232733_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.55225 35.0 35.0 35.0 34.0 35.0 2 34.5945 35.0 35.0 35.0 35.0 35.0 3 34.607 35.0 35.0 35.0 35.0 35.0 4 34.60675 35.0 35.0 35.0 35.0 35.0 5 34.64575 35.0 35.0 35.0 35.0 35.0 6 39.46325 40.0 40.0 40.0 39.0 40.0 7 39.50625 40.0 40.0 40.0 39.0 40.0 8 39.53225 40.0 40.0 40.0 39.0 40.0 9 39.51675 40.0 40.0 40.0 39.0 40.0 10-14 39.490700000000004 40.0 40.0 40.0 39.0 40.0 15-19 39.46095 40.0 40.0 40.0 39.0 40.0 20-24 39.439099999999996 40.0 40.0 40.0 39.0 40.0 25-29 39.43695 40.0 40.0 40.0 39.0 40.0 30-34 39.453250000000004 40.0 40.0 40.0 39.0 40.0 35-39 39.3839 40.0 40.0 40.0 39.0 40.0 40-44 39.34445000000001 40.0 40.0 40.0 39.0 40.0 45-49 39.3584 40.0 40.0 40.0 39.0 40.0 50-54 39.3306 40.0 40.0 40.0 39.0 40.0 55-59 39.30385 40.0 40.0 40.0 39.0 40.0 60-64 39.25775 40.0 40.0 40.0 39.0 40.0 65-69 39.24445 40.0 40.0 40.0 39.0 40.0 70-74 39.211349999999996 40.0 40.0 40.0 39.0 40.0 75-79 39.1926 40.0 40.0 40.0 39.0 40.0 80-84 39.17035 40.0 40.0 40.0 39.0 40.0 85-89 39.07905 40.0 40.0 40.0 39.0 40.0 90-94 38.9847 40.0 40.0 40.0 38.2 40.0 95-99 39.0067 40.0 40.0 40.0 38.2 40.0 100-104 38.5278 39.6 39.2 39.8 37.2 40.0 105-109 38.94205 40.0 39.8 40.0 38.0 40.0 110-114 38.92115 40.0 40.0 40.0 38.4 40.0 115-119 38.82755 40.0 39.6 40.0 38.0 40.0 120-124 38.7952 40.0 39.0 40.0 38.0 40.0 125-129 38.66845 40.0 39.0 40.0 37.4 40.0 130-134 38.54365 40.0 39.0 40.0 36.6 40.0 135-139 38.2857 40.0 39.0 40.0 36.2 40.0 140-144 38.10995 40.0 39.0 40.0 36.0 40.0 145-149 37.59195 39.6 39.0 40.0 34.6 40.0 150-151 34.927875 38.0 35.0 39.5 25.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 0.0 17 2.0 18 2.0 19 2.0 20 3.0 21 5.0 22 10.0 23 9.0 24 7.0 25 7.0 26 13.0 27 13.0 28 8.0 29 13.0 30 21.0 31 18.0 32 25.0 33 20.0 34 35.0 35 54.0 36 64.0 37 140.0 38 285.0 39 3240.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.025 17.150000000000002 15.049999999999999 41.775 2 22.175 25.25 37.375 15.2 3 17.825 27.575 31.45 23.150000000000002 4 21.95 34.525 22.55 20.974999999999998 5 22.625 38.574999999999996 22.025 16.775000000000002 6 18.75 37.824999999999996 24.925 18.5 7 18.3 18.4 41.9 21.4 8 19.1 24.05 29.875 26.974999999999998 9 20.925 24.175 30.45 24.45 10-14 22.255 28.915000000000003 26.650000000000002 22.18 15-19 22.23 27.975 27.450000000000003 22.345000000000002 20-24 22.935 27.775 27.77 21.52 25-29 21.82 28.68 27.794999999999998 21.705 30-34 22.63 28.08 28.315 20.974999999999998 35-39 22.59 27.884999999999998 28.155 21.37 40-44 22.78 28.34 27.48 21.4 45-49 22.58 27.505000000000003 28.349999999999998 21.565 50-54 23.335 27.785 27.975 20.905 55-59 22.64 27.955000000000002 28.345 21.060000000000002 60-64 23.625 27.400000000000002 27.935 21.04 65-69 23.375 27.705000000000002 27.845 21.075 70-74 23.165 28.12 27.834999999999997 20.880000000000003 75-79 23.3 27.955000000000002 27.694999999999997 21.05 80-84 23.544999999999998 27.860000000000003 28.105000000000004 20.49 85-89 23.645 27.35 27.675 21.33 90-94 23.44 27.83 28.084999999999997 20.645 95-99 23.015 28.13 27.560000000000002 21.295 100-104 24.16 27.834999999999997 27.505000000000003 20.5 105-109 23.955000000000002 27.74 27.85 20.455000000000002 110-114 23.815 27.615000000000002 27.650000000000002 20.919999999999998 115-119 23.79 27.91 27.58 20.72 120-124 24.610000000000003 28.24 26.729999999999997 20.419999999999998 125-129 24.154999999999998 27.765 27.35 20.73 130-134 24.84 27.97 27.27 19.919999999999998 135-139 24.52 28.000000000000004 27.560000000000002 19.919999999999998 140-144 25.369999999999997 27.675 27.26 19.695 145-149 25.645 27.595 26.56 20.200000000000003 150-151 25.937500000000004 28.812500000000004 26.5875 18.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 1.5 26 4.5 27 7.0 28 7.0 29 10.0 30 21.0 31 23.5 32 30.0 33 42.5 34 52.0 35 64.0 36 71.0 37 98.5 38 137.5 39 166.0 40 198.0 41 232.0 42 251.0 43 262.5 44 284.0 45 286.5 46 251.5 47 241.0 48 235.5 49 195.5 50 168.0 51 139.5 52 114.0 53 96.5 54 82.5 55 60.0 56 36.5 57 28.5 58 26.0 59 22.5 60 12.5 61 7.5 62 6.0 63 5.5 64 6.0 65 5.5 66 1.5 67 0.0 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4778672032193159 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025150905432595575 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATTAATTAGCTCTAAATTGTCCCTCTCCTCATTTCAACACTACGTGCTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.23750000000000002 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.575 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.475 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.6625 0.0 0.0 0.0 0.0 130-131 4.1875 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 5.0 0.0 0.0 0.0 0.0 136-137 5.475 0.0 0.0 0.0 0.0 138-139 5.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGAAG 10 0.006830828 145.0 8 CTACTCT 10 0.006830828 145.0 6 CGTTCTG 10 0.006830828 145.0 8 TCGGAAG 35 0.0035366106 20.714287 140-144 >>END_MODULE Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774748 spots for SRR6232733.sra Written 774748 spots for SRR6232733.sra Read 774767 spots for SRR6232733.sra Written 774767 spots for SRR6232733.sra SRR ids: ['SRR6232733.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c1tx4l8_ SRR6232733.sra spots: 15494979 blocks: [[1, 774748], [774749, 1549496], [1549497, 2324244], [2324245, 3098992], [3098993, 3873740], [3873741, 4648488], [4648489, 5423236], [5423237, 6197984], [6197985, 6972732], [6972733, 7747480], [7747481, 8522228], [8522229, 9296976], [9296977, 10071724], [10071725, 10846472], [10846473, 11621220], [11621221, 12395968], [12395969, 13170716], [13170717, 13945464], [13945465, 14720212], [14720213, 15494979]] SRR6232733 file size 5229039 SRR6232733 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6232733 SRR6232733_1.fastq SRR6232733_2.fastq Input file: SRR6232733_1.fastq Paired file: SRR6232733_2.fastq trimmed: SRR6232733-trimmed-pair1.fastq, SRR6232733-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:44:34 2025 >> started Wed Feb 12 07:44:51 2025 >> done (17.016s) 15494979 read pairs processed; of these: 1753 ( 0.01%) short read pairs filtered out after trimming by size control 6209 ( 0.04%) empty read pairs filtered out after trimming by size control 15487017 (99.95%) read pairs available; of these: 2549879 (16.46%) trimmed read pairs available after processing 12937138 (83.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 6 0.00% 21 1 0.00% 22 2 0.00% 23 4 0.00% 24 4 0.00% 25 5 0.00% 26 1 0.00% 27 8 0.00% 28 2 0.00% 29 5 0.00% 30 3 0.00% 31 2 0.00% 32 3 0.00% 33 5 0.00% 34 4 0.00% 35 9 0.00% 36 14 0.00% 37 8 0.00% 38 7 0.00% 39 6 0.00% 40 13 0.00% 41 18 0.00% 42 14 0.00% 43 22 0.00% 44 15 0.00% 45 11 0.00% 46 19 0.00% 47 20 0.00% 48 24 0.00% 49 31 0.00% 50 36 0.00% 51 38 0.00% 52 48 0.00% 53 50 0.00% 54 41 0.00% 55 42 0.00% 56 77 0.00% 57 72 0.00% 58 82 0.00% 59 72 0.00% 60 93 0.00% 61 117 0.00% 62 130 0.00% 63 145 0.00% 64 145 0.00% 65 172 0.00% 66 177 0.00% 67 201 0.00% 68 197 0.00% 69 249 0.00% 70 312 0.00% 71 314 0.00% 72 369 0.00% 73 424 0.00% 74 443 0.00% 75 519 0.00% 76 554 0.00% 77 620 0.00% 78 698 0.00% 79 849 0.01% 80 903 0.01% 81 999 0.01% 82 1182 0.01% 83 1327 0.01% 84 1610 0.01% 85 1709 0.01% 86 2009 0.01% 87 2201 0.01% 88 2451 0.02% 89 2790 0.02% 90 3050 0.02% 91 3364 0.02% 92 3803 0.02% 93 4269 0.03% 94 4876 0.03% 95 5126 0.03% 96 5673 0.04% 97 6258 0.04% 98 6908 0.04% 99 7332 0.05% 100 7850 0.05% 101 8503 0.05% 102 9317 0.06% 103 10157 0.07% 104 11116 0.07% 105 12264 0.08% 106 13255 0.09% 107 14082 0.09% 108 15093 0.10% 109 16449 0.11% 110 17317 0.11% 111 17661 0.11% 112 19707 0.13% 113 20327 0.13% 114 21598 0.14% 115 22867 0.15% 116 24318 0.16% 117 26124 0.17% 118 27086 0.17% 119 28186 0.18% 120 29164 0.19% 121 30468 0.20% 122 31199 0.20% 123 32582 0.21% 124 33750 0.22% 125 36128 0.23% 126 37103 0.24% 127 38612 0.25% 128 40540 0.26% 129 41426 0.27% 130 42900 0.28% 131 43557 0.28% 132 44395 0.29% 133 45879 0.30% 134 47191 0.30% 135 48989 0.32% 136 50640 0.33% 137 52469 0.34% 138 54103 0.35% 139 56174 0.36% 140 58048 0.37% 141 59543 0.38% 142 61632 0.40% 143 63548 0.41% 144 65947 0.43% 145 69597 0.45% 146 73482 0.47% 147 79948 0.52% 148 91533 0.59% 149 115480 0.75% 150 555157 3.58% 151 12937138 83.54% 15487017 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=6.77 fanout-score-rank=14 prefix-density=0.38 prefix-fanout=4.4 sequence=AAAGCAACAGCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=10 fanout-score=370.04 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=37.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=28 prefix-density=0.25 prefix-fanout=2.5 sequence=TTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAACGATCGTGAAACTGGAAGATCTCGCGGCTTTGGATTTGTTACCTTCAACAACGAGAAGGCAAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=15 fanout-score=373.37 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=31.9 sequence=AAGAAGAAGAAA SRR6232733 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:45:39 Started mapping on | Feb 12 07:45:39 Finished on | Feb 12 07:47:50 Mapping speed, Million of reads per hour | 425.60 Number of input reads | 15487017 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14565175 Uniquely mapped reads % | 94.05% Average mapped length | 296.00 Number of splices: Total | 14342328 Number of splices: Annotated (sjdb) | 14052055 Number of splices: GT/AG | 14068160 Number of splices: GC/AG | 224528 Number of splices: AT/AC | 12584 Number of splices: Non-canonical | 37056 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.03% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 505300 % of reads mapped to multiple loci | 3.26% Number of reads mapped to too many loci | 54462 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.24% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 418858 418858 418858 N_multimapping 505300 505300 505300 N_noFeature 463771 14416455 539016 N_ambiguous 164524 1268 90069 UnstrandedReadsAssigned:13936880 PositiveStrandReadsAssigned:147452 NegativeStrandReadsAssigned:13936090 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6232733 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6232733-trimmed-pair1.fastq SRR6232733-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,487,017 reads, 13,959,156 reads pseudoaligned [quant] estimated average fragment length: 246.982 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 961 rounds 52401 SRR6232733.ke.tsv 34699 SRR6232733.se.tsv 87100 total ==> SRR6232733.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.02 249 9.76995 Potri.005G024800.1.v4.1 1035 789.018 33 2.90796 Potri.004G059700.1.v4.1 961 715.08 57 5.54218 Potri.007G009000.2.v4.1 1416 1170.02 1 0.0594249 Potri.003G141000.2.v4.1 2943 2697.02 338 8.71352 Potri.016G087400.1.v4.1 270 83.4155 1243 1036.06 Potri.015G069301.1.v4.1 564 325.29 0 0 Potri.010G195200.1.v4.1 1773 1527.02 4 0.182128 Potri.012G127500.1.v4.1 977 731.044 2235 212.566 ==> SRR6232733.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 41 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 202 Potri.001G212900.v4.1 155 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 156 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR6232733 completed mapping pipeline successfully