Starting /dee2/code/volunteer_pipeline.sh SRR6232739 current disk space = 3049321005056 free memory = 1582654244 SRR6232739 SRAfilesize 444e4c7e53d7a3ced22e51686ebf0064 SRR6232739.sra SRR6232739.sra file validated SRR6232739 is paired end SRR6232739 is conventional basespace SRR6232739 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232739_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.577 35.0 35.0 35.0 35.0 35.0 2 34.70125 35.0 35.0 35.0 35.0 35.0 3 34.748 35.0 35.0 35.0 35.0 35.0 4 34.7285 35.0 35.0 35.0 35.0 35.0 5 34.7565 35.0 35.0 35.0 35.0 35.0 6 39.532 40.0 40.0 40.0 39.0 40.0 7 39.614 40.0 40.0 40.0 39.0 40.0 8 39.5645 40.0 40.0 40.0 39.0 40.0 9 39.579 40.0 40.0 40.0 39.0 40.0 10-14 39.5865 40.0 40.0 40.0 39.0 40.0 15-19 39.6131 40.0 40.0 40.0 39.0 40.0 20-24 39.594100000000005 40.0 40.0 40.0 39.0 40.0 25-29 39.572500000000005 40.0 40.0 40.0 39.0 40.0 30-34 39.556349999999995 40.0 40.0 40.0 39.0 40.0 35-39 39.4568 40.0 40.0 40.0 39.0 40.0 40-44 39.5019 40.0 40.0 40.0 39.0 40.0 45-49 39.48105 40.0 40.0 40.0 39.0 40.0 50-54 39.439150000000005 40.0 40.0 40.0 39.0 40.0 55-59 39.4738 40.0 40.0 40.0 39.0 40.0 60-64 39.39945 40.0 40.0 40.0 39.0 40.0 65-69 39.36835 40.0 40.0 40.0 39.0 40.0 70-74 39.400999999999996 40.0 40.0 40.0 39.0 40.0 75-79 39.366200000000006 40.0 40.0 40.0 39.0 40.0 80-84 39.35235 40.0 40.0 40.0 39.0 40.0 85-89 39.291549999999994 40.0 40.0 40.0 39.0 40.0 90-94 39.31365 40.0 40.0 40.0 39.0 40.0 95-99 39.2936 40.0 40.0 40.0 39.0 40.0 100-104 38.82125 39.6 39.2 39.8 37.6 40.0 105-109 39.29129999999999 40.0 40.0 40.0 39.0 40.0 110-114 39.208450000000006 40.0 40.0 40.0 39.0 40.0 115-119 39.24885 40.0 40.0 40.0 39.0 40.0 120-124 39.17945 40.0 40.0 40.0 39.0 40.0 125-129 39.05495 40.0 40.0 40.0 38.8 40.0 130-134 38.9644 40.0 40.0 40.0 38.2 40.0 135-139 38.843849999999996 40.0 39.4 40.0 38.0 40.0 140-144 38.783049999999996 40.0 39.0 40.0 37.8 40.0 145-149 38.569100000000006 40.0 39.0 40.0 37.0 40.0 150-151 36.615375 39.0 36.5 39.5 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 1.0 22 0.0 23 4.0 24 2.0 25 4.0 26 5.0 27 11.0 28 11.0 29 15.0 30 15.0 31 20.0 32 26.0 33 21.0 34 27.0 35 59.0 36 62.0 37 104.0 38 241.0 39 3369.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.90566037735849 11.874213836477987 9.836477987421384 57.383647798742146 2 18.95 18.025 42.725 20.3 3 18.775 22.8 25.124999999999996 33.300000000000004 4 22.475 30.375000000000004 19.950000000000003 27.200000000000003 5 21.825 35.6 24.95 17.625 6 16.675 34.625 29.049999999999997 19.650000000000002 7 14.674999999999999 22.075 43.45 19.8 8 17.599999999999998 21.525 35.099999999999994 25.775 9 17.175 22.175 36.15 24.5 10-14 19.99 29.395 26.965 23.65 15-19 19.695 28.305000000000003 28.035 23.965 20-24 19.98 28.29 27.560000000000002 24.169999999999998 25-29 20.195 28.4 27.49 23.915 30-34 20.085 28.475 27.195000000000004 24.245 35-39 20.455000000000002 28.544999999999998 27.41 23.59 40-44 20.53 28.685 28.04 22.745 45-49 20.59 28.17 27.485 23.755000000000003 50-54 20.325 27.91 27.54 24.224999999999998 55-59 20.0 28.110000000000003 27.855 24.035 60-64 20.155 27.435 27.639999999999997 24.77 65-69 20.611030551527577 28.21141057052853 27.881394069703486 23.296164808240412 70-74 20.376018800940045 27.631381569078457 27.841392069603483 24.15120756037802 75-79 19.694923730932736 28.68217054263566 27.501875468867215 24.121030257564392 80-84 19.93199319931993 28.297829782978294 27.93279327932793 23.837383738373838 85-89 20.685171292823206 28.152038009502377 27.101775443860966 24.06101525381345 90-94 20.51512878219555 27.866966741685424 27.38184546136534 24.23605901475369 95-99 20.605151287821954 28.122030507626906 27.341835458864715 23.93098274568642 100-104 20.729145829165834 27.920584116823367 26.835367073414684 24.51490298059612 105-109 20.914182836567313 28.200640128025604 27.0754150830166 23.809761952390478 110-114 20.553082962444368 28.239235885382808 27.2590888633295 23.948592288843326 115-119 20.675168792198047 28.327081770442607 26.846711677919483 24.151037759439863 120-124 20.734146829365873 28.105621124224843 27.19543908781756 23.96479295859172 125-129 20.99814972245837 28.02420363054458 27.139070860629094 23.838575786367954 130-134 21.408211231684753 28.05420813121968 26.363954593188975 24.173626043906584 135-139 21.5960798039902 27.78138906945347 26.48132406620331 24.141207060353018 140-144 21.375 27.875 26.575 24.175 145-149 21.355 27.894999999999996 26.325 24.425 150-151 20.9875 27.575 26.6 24.837500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 2.0 24 1.0 25 2.5 26 4.0 27 5.0 28 8.5 29 13.0 30 17.0 31 23.5 32 34.5 33 40.5 34 53.0 35 72.0 36 84.0 37 116.0 38 142.0 39 163.5 40 186.5 41 210.0 42 233.0 43 247.5 44 251.5 45 263.5 46 273.0 47 250.5 48 228.0 49 207.0 50 180.5 51 141.0 52 113.5 53 93.5 54 72.5 55 52.5 56 41.5 57 39.5 58 29.0 59 25.5 60 22.5 61 13.5 62 9.0 63 6.5 64 5.0 65 3.0 66 3.0 67 4.5 68 3.0 69 1.0 70 0.0 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.005 75-79 0.025 80-84 0.01 85-89 0.025 90-94 0.025 95-99 0.025 100-104 0.02 105-109 0.02 110-114 0.015 115-119 0.025 120-124 0.02 125-129 0.015 130-134 0.015 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.655076845553036 1.3 3 0.02519526329050139 0.075 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.2000000000000002 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.825 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.8375 0.0 0.0 0.0 0.0 124-125 4.325 0.0 0.0 0.0 0.0 126-127 4.862500000000001 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 5.775 0.0 0.0 0.0 0.0 132-133 6.2125 0.0 0.0 0.0 0.0 134-135 7.050000000000001 0.0 0.0 0.0 0.0 136-137 7.574999999999999 0.0 0.0 0.0 0.0 138-139 8.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTCAA 10 0.006832588 144.9875 6 AGTTTCA 10 0.006832588 144.9875 5 >>END_MODULE SRR6232739 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232739_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.3815 35.0 35.0 35.0 33.0 35.0 2 34.58625 35.0 35.0 35.0 35.0 35.0 3 34.532 35.0 35.0 35.0 35.0 35.0 4 34.58025 35.0 35.0 35.0 35.0 35.0 5 34.55575 35.0 35.0 35.0 35.0 35.0 6 39.34825 40.0 40.0 40.0 39.0 40.0 7 39.41275 40.0 40.0 40.0 39.0 40.0 8 39.4015 40.0 40.0 40.0 39.0 40.0 9 39.373 40.0 40.0 40.0 39.0 40.0 10-14 39.37405 40.0 40.0 40.0 39.0 40.0 15-19 39.37965 40.0 40.0 40.0 39.0 40.0 20-24 39.44605 40.0 40.0 40.0 39.0 40.0 25-29 39.42334999999999 40.0 40.0 40.0 39.0 40.0 30-34 39.403499999999994 40.0 40.0 40.0 39.0 40.0 35-39 39.36355 40.0 40.0 40.0 39.0 40.0 40-44 39.2743 40.0 40.0 40.0 39.0 40.0 45-49 39.29785 40.0 40.0 40.0 39.0 40.0 50-54 39.24695 40.0 40.0 40.0 39.0 40.0 55-59 39.237249999999996 40.0 40.0 40.0 39.0 40.0 60-64 39.1926 40.0 40.0 40.0 39.0 40.0 65-69 39.1457 40.0 40.0 40.0 39.0 40.0 70-74 39.1098 40.0 40.0 40.0 39.0 40.0 75-79 39.14175000000001 40.0 40.0 40.0 39.0 40.0 80-84 39.11675 40.0 40.0 40.0 39.0 40.0 85-89 39.033550000000005 40.0 40.0 40.0 38.2 40.0 90-94 38.895 40.0 39.2 40.0 38.0 40.0 95-99 38.90565 40.0 39.4 40.0 38.0 40.0 100-104 38.463049999999996 39.6 38.8 39.8 36.8 40.0 105-109 38.91705 40.0 39.0 40.0 38.0 40.0 110-114 38.84225 40.0 39.2 40.0 38.0 40.0 115-119 38.76475000000001 40.0 39.0 40.0 37.6 40.0 120-124 38.7011 40.0 39.0 40.0 37.4 40.0 125-129 38.536249999999995 40.0 39.0 40.0 37.0 40.0 130-134 38.362849999999995 40.0 39.0 40.0 36.2 40.0 135-139 38.04600000000001 40.0 39.0 40.0 35.6 40.0 140-144 37.873000000000005 40.0 39.0 40.0 35.2 40.0 145-149 37.2952 39.6 38.6 40.0 32.8 40.0 150-151 34.373374999999996 37.5 34.5 39.5 23.5 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 0.0 17 1.0 18 2.0 19 9.0 20 2.0 21 5.0 22 7.0 23 2.0 24 5.0 25 13.0 26 11.0 27 8.0 28 7.0 29 10.0 30 20.0 31 24.0 32 30.0 33 30.0 34 49.0 35 64.0 36 107.0 37 136.0 38 336.0 39 3116.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.549999999999997 15.925 14.924999999999999 45.6 2 21.275 24.9 38.725 15.1 3 18.475 27.35 31.25 22.925 4 22.8 32.925 22.95 21.325 5 23.825 36.199999999999996 23.125 16.85 6 17.45 37.25 24.675 20.625 7 17.724999999999998 17.474999999999998 43.675000000000004 21.125 8 18.75 23.125 31.2 26.924999999999997 9 21.15 22.875 32.074999999999996 23.9 10-14 22.59 28.065 26.375 22.97 15-19 22.6 27.88 27.544999999999998 21.975 20-24 22.795 28.555000000000003 27.13 21.52 25-29 22.195 28.155 27.37 22.28 30-34 22.905 27.779999999999998 27.794999999999998 21.52 35-39 22.869999999999997 27.96 27.455000000000002 21.715 40-44 22.905 27.6 27.91 21.584999999999997 45-49 23.285 27.639999999999997 27.655 21.42 50-54 23.165 27.775 27.529999999999998 21.529999999999998 55-59 23.315 27.224999999999998 27.955000000000002 21.505 60-64 23.48 27.705000000000002 27.644999999999996 21.17 65-69 23.39 27.365000000000002 27.365000000000002 21.88 70-74 23.195 28.065 27.245 21.495 75-79 23.68 27.450000000000003 27.925 20.945 80-84 24.135 27.91 27.11 20.845 85-89 23.87 27.155 27.805000000000003 21.17 90-94 23.21 27.595 27.544999999999998 21.65 95-99 22.985 28.244999999999997 27.3 21.47 100-104 22.99 28.095 27.46 21.455 105-109 23.835 27.779999999999998 27.43 20.955 110-114 23.98 28.075 27.195000000000004 20.75 115-119 24.23 27.355 27.66 20.755000000000003 120-124 24.060000000000002 27.925 27.52 20.495 125-129 24.285 28.16 27.62 19.935 130-134 24.905 27.67 27.169999999999998 20.255000000000003 135-139 25.09 27.655 26.974999999999998 20.28 140-144 25.805 28.53 26.174999999999997 19.49 145-149 25.580000000000002 28.125 26.479999999999997 19.814999999999998 150-151 26.75 28.000000000000004 26.2875 18.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 3.5 27 6.0 28 8.5 29 9.0 30 14.5 31 21.5 32 24.5 33 31.0 34 43.5 35 59.0 36 82.0 37 98.5 38 120.5 39 159.0 40 183.0 41 218.5 42 245.0 43 248.0 44 269.0 45 283.5 46 279.0 47 246.5 48 219.0 49 206.0 50 168.0 51 139.0 52 121.5 53 103.0 54 87.0 55 68.0 56 47.0 57 39.0 58 34.0 59 26.0 60 21.0 61 16.5 62 14.0 63 9.0 64 6.5 65 5.5 66 2.5 67 1.0 68 1.0 69 1.0 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26896899420217 98.45 2 0.6301991429291656 1.25 3 0.10083186286866651 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.8 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.7 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.8375 0.0 0.0 0.0 0.0 124-125 4.325 0.0 0.0 0.0 0.0 126-127 4.862500000000001 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 5.775 0.0 0.0 0.0 0.0 132-133 6.2125 0.0 0.0 0.0 0.0 134-135 7.050000000000001 0.0 0.0 0.0 0.0 136-137 7.6 0.0 0.0 0.0 0.0 138-139 8.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705450 spots for SRR6232739.sra Written 705450 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra Read 705446 spots for SRR6232739.sra Written 705446 spots for SRR6232739.sra SRR ids: ['SRR6232739.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_773_l3ny SRR6232739.sra spots: 14108924 blocks: [[1, 705446], [705447, 1410892], [1410893, 2116338], [2116339, 2821784], [2821785, 3527230], [3527231, 4232676], [4232677, 4938122], [4938123, 5643568], [5643569, 6349014], [6349015, 7054460], [7054461, 7759906], [7759907, 8465352], [8465353, 9170798], [9170799, 9876244], [9876245, 10581690], [10581691, 11287136], [11287137, 11992582], [11992583, 12698028], [12698029, 13403474], [13403475, 14108924]] SRR6232739 file size 4759351 SRR6232739 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6232739 SRR6232739_1.fastq SRR6232739_2.fastq Input file: SRR6232739_1.fastq Paired file: SRR6232739_2.fastq trimmed: SRR6232739-trimmed-pair1.fastq, SRR6232739-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 08:25:24 2025 >> started Wed Feb 12 08:25:38 2025 >> done (14.775s) 14108924 read pairs processed; of these: 2050 ( 0.01%) short read pairs filtered out after trimming by size control 6595 ( 0.05%) empty read pairs filtered out after trimming by size control 14100279 (99.94%) read pairs available; of these: 2691908 (19.09%) trimmed read pairs available after processing 11408371 (80.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 10 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 5 0.00% 25 2 0.00% 26 5 0.00% 27 6 0.00% 28 6 0.00% 29 2 0.00% 30 11 0.00% 31 4 0.00% 32 5 0.00% 33 6 0.00% 34 5 0.00% 35 8 0.00% 36 9 0.00% 37 5 0.00% 38 13 0.00% 39 17 0.00% 40 10 0.00% 41 18 0.00% 42 18 0.00% 43 12 0.00% 44 26 0.00% 45 27 0.00% 46 24 0.00% 47 29 0.00% 48 41 0.00% 49 46 0.00% 50 48 0.00% 51 44 0.00% 52 64 0.00% 53 73 0.00% 54 75 0.00% 55 94 0.00% 56 87 0.00% 57 101 0.00% 58 93 0.00% 59 101 0.00% 60 115 0.00% 61 159 0.00% 62 160 0.00% 63 187 0.00% 64 211 0.00% 65 239 0.00% 66 260 0.00% 67 295 0.00% 68 331 0.00% 69 365 0.00% 70 400 0.00% 71 472 0.00% 72 528 0.00% 73 615 0.00% 74 672 0.00% 75 763 0.01% 76 834 0.01% 77 917 0.01% 78 1010 0.01% 79 1194 0.01% 80 1329 0.01% 81 1419 0.01% 82 1607 0.01% 83 1916 0.01% 84 2139 0.02% 85 2476 0.02% 86 2905 0.02% 87 2988 0.02% 88 3268 0.02% 89 3640 0.03% 90 4202 0.03% 91 4626 0.03% 92 5060 0.04% 93 5577 0.04% 94 6441 0.05% 95 6898 0.05% 96 7520 0.05% 97 8300 0.06% 98 8893 0.06% 99 9436 0.07% 100 10414 0.07% 101 11186 0.08% 102 11945 0.08% 103 13277 0.09% 104 14291 0.10% 105 15553 0.11% 106 16467 0.12% 107 17677 0.13% 108 18728 0.13% 109 20165 0.14% 110 21328 0.15% 111 21737 0.15% 112 23631 0.17% 113 24530 0.17% 114 25682 0.18% 115 27068 0.19% 116 28371 0.20% 117 29993 0.21% 118 31344 0.22% 119 32155 0.23% 120 32845 0.23% 121 34118 0.24% 122 35542 0.25% 123 36262 0.26% 124 37892 0.27% 125 39250 0.28% 126 40475 0.29% 127 42085 0.30% 128 43950 0.31% 129 44811 0.32% 130 46041 0.33% 131 46807 0.33% 132 46753 0.33% 133 48459 0.34% 134 49454 0.35% 135 51178 0.36% 136 52021 0.37% 137 54200 0.38% 138 56025 0.40% 139 58145 0.41% 140 59330 0.42% 141 60388 0.43% 142 61979 0.44% 143 63518 0.45% 144 65854 0.47% 145 69258 0.49% 146 72733 0.52% 147 78922 0.56% 148 89444 0.63% 149 113172 0.80% 150 543921 3.86% 151 11408371 80.91% 14100279 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.95 fanout-score-rank=15 prefix-density=0.28 prefix-fanout=3.9 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACCGCCTTTCCGGCTAGCGAAGGGGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=399.54 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=32.3 sequence=TTCTTCTTCTTCCT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=25 prefix-density=0.27 prefix-fanout=2.0 sequence=TCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=106.48 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.8 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR6232739 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 08:26:23 Started mapping on | Feb 12 08:26:23 Finished on | Feb 12 08:28:29 Mapping speed, Million of reads per hour | 402.87 Number of input reads | 14100279 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12896922 Uniquely mapped reads % | 91.47% Average mapped length | 294.71 Number of splices: Total | 12372713 Number of splices: Annotated (sjdb) | 12138479 Number of splices: GT/AG | 12140497 Number of splices: GC/AG | 188741 Number of splices: AT/AC | 10605 Number of splices: Non-canonical | 32870 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.03% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514441 % of reads mapped to multiple loci | 3.65% Number of reads mapped to too many loci | 260798 % of reads mapped to too many loci | 1.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 691244 691244 691244 N_multimapping 514441 514441 514441 N_noFeature 420862 12752769 489284 N_ambiguous 164602 1207 87964 UnstrandedReadsAssigned:12311458 PositiveStrandReadsAssigned:142946 NegativeStrandReadsAssigned:12319674 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6232739 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6232739-trimmed-pair1.fastq SRR6232739-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,100,279 reads, 12,583,355 reads pseudoaligned [quant] estimated average fragment length: 236.196 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,013 rounds 52401 SRR6232739.ke.tsv 34699 SRR6232739.se.tsv 87100 total ==> SRR6232739.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.8 240 10.0446 Potri.005G024800.1.v4.1 1035 799.804 16 1.49266 Potri.004G059700.1.v4.1 961 725.828 28 2.87839 Potri.007G009000.2.v4.1 1416 1180.8 0 0 Potri.003G141000.2.v4.1 2943 2707.8 208.095 5.73415 Potri.016G087400.1.v4.1 270 86.8954 963 826.903 Potri.015G069301.1.v4.1 564 334.207 0 0 Potri.010G195200.1.v4.1 1773 1537.8 3 0.145561 Potri.012G127500.1.v4.1 977 741.822 2218 223.093 ==> SRR6232739.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 180 Potri.001G212900.v4.1 195 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR6232739 completed mapping pipeline successfully