Starting /dee2/code/volunteer_pipeline.sh SRR6232740 current disk space = 3049748525056 free memory = 1580252808 SRR6232740 SRAfilesize 8bff6c2ffae982234fe9ec4dcd5a0245 SRR6232740.sra SRR6232740.sra file validated SRR6232740 is paired end SRR6232740 is conventional basespace SRR6232740 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232740_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.59975 35.0 35.0 35.0 35.0 35.0 2 34.72675 35.0 35.0 35.0 35.0 35.0 3 34.73775 35.0 35.0 35.0 35.0 35.0 4 34.75575 35.0 35.0 35.0 35.0 35.0 5 34.78725 35.0 35.0 35.0 35.0 35.0 6 39.56875 40.0 40.0 40.0 39.0 40.0 7 39.62 40.0 40.0 40.0 39.0 40.0 8 39.60225 40.0 40.0 40.0 39.0 40.0 9 39.63525 40.0 40.0 40.0 39.0 40.0 10-14 39.590149999999994 40.0 40.0 40.0 39.0 40.0 15-19 39.627649999999996 40.0 40.0 40.0 39.0 40.0 20-24 39.60695 40.0 40.0 40.0 39.0 40.0 25-29 39.6052 40.0 40.0 40.0 39.0 40.0 30-34 39.594100000000005 40.0 40.0 40.0 39.0 40.0 35-39 39.513549999999995 40.0 40.0 40.0 39.0 40.0 40-44 39.5484 40.0 40.0 40.0 39.0 40.0 45-49 39.5264 40.0 40.0 40.0 39.0 40.0 50-54 39.47305 40.0 40.0 40.0 39.0 40.0 55-59 39.506049999999995 40.0 40.0 40.0 39.0 40.0 60-64 39.42705 40.0 40.0 40.0 39.0 40.0 65-69 39.3655 40.0 40.0 40.0 39.0 40.0 70-74 39.4281 40.0 40.0 40.0 39.0 40.0 75-79 39.42935 40.0 40.0 40.0 39.0 40.0 80-84 39.4088 40.0 40.0 40.0 39.0 40.0 85-89 39.33645 40.0 40.0 40.0 39.0 40.0 90-94 39.3176 40.0 40.0 40.0 39.0 40.0 95-99 39.32165 40.0 40.0 40.0 39.0 40.0 100-104 38.867 39.8 39.2 39.8 37.8 40.0 105-109 39.2748 40.0 40.0 40.0 39.0 40.0 110-114 39.20285 40.0 40.0 40.0 39.0 40.0 115-119 39.2225 40.0 40.0 40.0 39.0 40.0 120-124 39.186099999999996 40.0 40.0 40.0 39.0 40.0 125-129 39.139149999999994 40.0 40.0 40.0 39.0 40.0 130-134 39.0564 40.0 40.0 40.0 38.4 40.0 135-139 38.9594 40.0 40.0 40.0 38.0 40.0 140-144 38.9184 40.0 39.6 40.0 38.0 40.0 145-149 38.70705 40.0 39.0 40.0 37.4 40.0 150-151 36.792 39.0 36.5 39.5 32.5 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 0.0 22 1.0 23 2.0 24 3.0 25 3.0 26 4.0 27 8.0 28 9.0 29 13.0 30 15.0 31 8.0 32 27.0 33 25.0 34 45.0 35 50.0 36 58.0 37 90.0 38 213.0 39 3421.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.563805688396677 12.006040775232822 9.16184243644601 58.26831109992449 2 17.724999999999998 16.225 45.975 20.075000000000003 3 18.625 21.05 27.375 32.95 4 22.400000000000002 30.85 20.424999999999997 26.325 5 21.725 35.55 24.45 18.275 6 16.125 37.525 26.474999999999998 19.875 7 13.350000000000001 23.825 43.2 19.625 8 16.45 23.45 34.575 25.525 9 16.55 21.85 36.525 25.074999999999996 10-14 19.685 29.67 26.865 23.78 15-19 19.55 28.655 27.315 24.48 20-24 19.41 28.689999999999998 27.450000000000003 24.45 25-29 19.78 29.04 27.395000000000003 23.785 30-34 19.535 28.485 27.675 24.305 35-39 20.075000000000003 28.689999999999998 26.83 24.404999999999998 40-44 20.16 28.115000000000002 28.09 23.635 45-49 19.869999999999997 28.585 27.485 24.060000000000002 50-54 20.47 28.549999999999997 27.485 23.494999999999997 55-59 20.31 28.54 27.35 23.799999999999997 60-64 20.005 28.18 28.03 23.785 65-69 20.397039703970396 28.03780378037804 27.39273927392739 24.172417241724172 70-74 19.731973197319732 28.56785678567857 27.71277127712771 23.98739873987399 75-79 19.609804902451224 27.938969484742373 28.169084542271133 24.282141070535268 80-84 19.98899779955991 27.795559111822364 28.205641128225643 24.00980196039208 85-89 19.87894552548647 27.792506627982593 27.692461607723473 24.636086238807465 90-94 20.664298934520534 27.2822770246611 27.372317542894304 24.681106497924066 95-99 20.475237618809405 28.039019509754876 27.433716858429214 24.052026013006504 100-104 20.747261541539537 27.644675636472765 27.849747411594056 23.75831541039364 105-109 20.458183273309324 27.761104441776713 27.806122448979593 23.974589835934374 110-114 20.686205861758527 27.72331699509853 27.943383014904473 23.64709412823847 115-119 21.034465509479265 27.782502125956682 27.622430093542093 23.56060227102196 120-124 20.902315810533686 28.444955734507076 26.88440954334017 23.768318911619065 125-129 21.1902975743936 27.95198799699925 27.121780445111277 23.735933983495876 130-134 21.061318395518654 28.518555566670003 26.72801840552166 23.692107632289687 135-139 20.97209720972097 28.20782078207821 26.737673767376734 24.082408240824083 140-144 21.215 27.925 26.939999999999998 23.919999999999998 145-149 21.349999999999998 28.09 26.179999999999996 24.38 150-151 21.512500000000003 27.212500000000002 26.5375 24.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 4.0 26 7.0 27 5.0 28 5.5 29 13.0 30 21.5 31 24.5 32 33.0 33 45.0 34 58.5 35 71.0 36 86.5 37 111.0 38 134.0 39 159.5 40 196.5 41 222.5 42 228.0 43 242.0 44 265.0 45 277.5 46 270.5 47 254.0 48 231.5 49 202.0 50 173.0 51 142.5 52 102.0 53 81.0 54 77.5 55 61.5 56 45.5 57 34.5 58 25.0 59 25.5 60 22.5 61 10.5 62 8.0 63 7.0 64 4.0 65 2.5 66 1.0 67 2.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.01 75-79 0.05 80-84 0.02 85-89 0.045 90-94 0.045 95-99 0.05 100-104 0.034999999999999996 105-109 0.04 110-114 0.03 115-119 0.045 120-124 0.034999999999999996 125-129 0.025 130-134 0.03 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.1124999999999998 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.55 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.7125 0.0 0.0 0.0 0.0 126-127 4.3625 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.1375 0.0 0.0 0.0 0.0 132-133 5.675 0.0 0.0 0.0 0.0 134-135 6.35 0.0 0.0 0.0 0.0 136-137 6.9875 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTGAA 10 0.006830828 145.0 4 >>END_MODULE SRR6232740 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232740_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.5255 35.0 35.0 35.0 34.0 35.0 2 34.53825 35.0 35.0 35.0 35.0 35.0 3 34.4825 35.0 35.0 35.0 34.0 35.0 4 34.52175 35.0 35.0 35.0 34.0 35.0 5 34.59825 35.0 35.0 35.0 35.0 35.0 6 39.41425 40.0 40.0 40.0 39.0 40.0 7 39.351 40.0 40.0 40.0 39.0 40.0 8 39.231 40.0 40.0 40.0 39.0 40.0 9 39.227 40.0 40.0 40.0 39.0 40.0 10-14 39.356550000000006 40.0 40.0 40.0 39.0 40.0 15-19 39.3987 40.0 40.0 40.0 39.0 40.0 20-24 39.44415 40.0 40.0 40.0 39.0 40.0 25-29 39.39955 40.0 40.0 40.0 39.0 40.0 30-34 39.39095 40.0 40.0 40.0 39.0 40.0 35-39 39.33560000000001 40.0 40.0 40.0 39.0 40.0 40-44 39.299899999999994 40.0 40.0 40.0 39.0 40.0 45-49 39.28865 40.0 40.0 40.0 39.0 40.0 50-54 39.2962 40.0 40.0 40.0 39.0 40.0 55-59 39.2442 40.0 40.0 40.0 39.0 40.0 60-64 39.235949999999995 40.0 40.0 40.0 39.0 40.0 65-69 39.208200000000005 40.0 40.0 40.0 39.0 40.0 70-74 39.1948 40.0 40.0 40.0 39.0 40.0 75-79 39.1696 40.0 40.0 40.0 39.0 40.0 80-84 39.1349 40.0 40.0 40.0 39.0 40.0 85-89 39.082499999999996 40.0 40.0 40.0 38.8 40.0 90-94 38.9304 40.0 39.8 40.0 38.0 40.0 95-99 38.9786 40.0 40.0 40.0 38.0 40.0 100-104 38.576299999999996 39.6 39.0 39.8 37.2 40.0 105-109 38.98845 40.0 39.8 40.0 38.2 40.0 110-114 38.9557 40.0 39.8 40.0 38.0 40.0 115-119 38.83935 40.0 39.2 40.0 38.0 40.0 120-124 38.81034999999999 40.0 39.0 40.0 38.0 40.0 125-129 38.71635 40.0 39.0 40.0 37.2 40.0 130-134 38.4923 40.0 39.0 40.0 36.4 40.0 135-139 38.263200000000005 40.0 39.0 40.0 36.0 40.0 140-144 38.097899999999996 40.0 39.0 40.0 36.0 40.0 145-149 37.6485 39.6 38.8 40.0 34.6 40.0 150-151 34.885875 38.0 35.0 39.5 25.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 1.0 20 3.0 21 2.0 22 5.0 23 6.0 24 10.0 25 12.0 26 4.0 27 14.0 28 12.0 29 13.0 30 18.0 31 19.0 32 32.0 33 36.0 34 42.0 35 48.0 36 64.0 37 145.0 38 307.0 39 3199.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.675 17.45 14.025000000000002 45.85 2 20.549999999999997 23.325000000000003 41.425 14.7 3 18.2 26.575 32.275 22.95 4 21.9 32.574999999999996 25.025 20.5 5 24.45 36.25 23.075000000000003 16.225 6 17.95 39.025 24.425 18.6 7 18.675 17.1 42.3 21.925 8 19.35 22.95 30.825000000000003 26.875 9 20.925 23.7 32.025 23.35 10-14 23.04 27.29 27.115000000000002 22.555 15-19 22.405 27.625 28.095 21.875 20-24 22.945 28.315 26.784999999999997 21.955 25-29 22.994999999999997 27.875 27.825 21.305 30-34 23.485 28.32 27.439999999999998 20.755000000000003 35-39 23.369999999999997 28.139999999999997 27.3 21.19 40-44 22.935 28.065 27.534999999999997 21.465 45-49 22.835 28.03 27.375 21.759999999999998 50-54 23.395 28.235 27.200000000000003 21.17 55-59 23.425 27.944999999999997 27.47 21.16 60-64 23.51 27.565 27.644999999999996 21.279999999999998 65-69 23.415 27.71 27.994999999999997 20.880000000000003 70-74 23.655 27.575 27.779999999999998 20.990000000000002 75-79 23.465 27.525 27.865000000000002 21.145 80-84 23.494999999999997 28.065 27.38 21.060000000000002 85-89 23.735 27.97 27.665 20.630000000000003 90-94 23.745 27.48 27.700000000000003 21.075 95-99 23.455000000000002 27.944999999999997 27.800000000000004 20.8 100-104 23.225 27.955000000000002 27.779999999999998 21.04 105-109 23.919999999999998 27.700000000000003 27.465 20.915 110-114 24.21 27.815 27.694999999999997 20.28 115-119 24.19 27.655 27.76 20.395 120-124 24.05 28.52 26.640000000000004 20.79 125-129 24.645 28.115000000000002 27.07 20.169999999999998 130-134 24.610000000000003 27.71 27.084999999999997 20.595 135-139 25.03 28.060000000000002 27.01 19.900000000000002 140-144 25.540000000000003 27.24 26.900000000000002 20.32 145-149 26.215 28.095 26.150000000000002 19.54 150-151 25.724999999999998 28.1375 26.674999999999997 19.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 1.5 24 1.5 25 2.0 26 4.0 27 5.5 28 7.0 29 8.5 30 9.0 31 16.5 32 19.0 33 23.5 34 43.5 35 59.5 36 79.0 37 107.0 38 136.0 39 157.0 40 186.5 41 229.0 42 244.5 43 258.0 44 284.5 45 288.0 46 276.5 47 256.0 48 230.5 49 205.5 50 170.0 51 149.5 52 127.0 53 97.5 54 77.0 55 56.5 56 44.0 57 32.0 58 24.0 59 22.0 60 16.5 61 12.0 62 11.5 63 7.5 64 2.5 65 0.5 66 0.5 67 2.5 68 2.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59798994974875 99.1 2 0.35175879396984927 0.7000000000000001 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.02512562814070352 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCAATCGTAAATCACAAATACATACACGTTTACTCATCAGCTCGAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.1124999999999998 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.1624999999999996 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 4.8875 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.7125 0.0 0.0 0.0 0.0 134-135 6.35 0.0 0.0 0.0 0.0 136-137 6.9875 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCATG 10 0.006830828 145.0 145 CCTCTCC 10 0.006830828 145.0 6 >>END_MODULE Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639032 spots for SRR6232740.sra Written 639032 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra Read 639014 spots for SRR6232740.sra Written 639014 spots for SRR6232740.sra SRR ids: ['SRR6232740.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0atl68li SRR6232740.sra spots: 12780298 blocks: [[1, 639014], [639015, 1278028], [1278029, 1917042], [1917043, 2556056], [2556057, 3195070], [3195071, 3834084], [3834085, 4473098], [4473099, 5112112], [5112113, 5751126], [5751127, 6390140], [6390141, 7029154], [7029155, 7668168], [7668169, 8307182], [8307183, 8946196], [8946197, 9585210], [9585211, 10224224], [10224225, 10863238], [10863239, 11502252], [11502253, 12141266], [12141267, 12780298]] SRR6232740 file size 4309123 SRR6232740 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6232740 SRR6232740_1.fastq SRR6232740_2.fastq Input file: SRR6232740_1.fastq Paired file: SRR6232740_2.fastq trimmed: SRR6232740-trimmed-pair1.fastq, SRR6232740-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 08:00:01 2025 >> started Wed Feb 12 08:00:17 2025 >> done (16.035s) 12780298 read pairs processed; of these: 3407 ( 0.03%) short read pairs filtered out after trimming by size control 8105 ( 0.06%) empty read pairs filtered out after trimming by size control 12768786 (99.91%) read pairs available; of these: 2211339 (17.32%) trimmed read pairs available after processing 10557447 (82.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 1 0.00% 21 1 0.00% 22 3 0.00% 23 1 0.00% 24 9 0.00% 25 2 0.00% 26 4 0.00% 27 4 0.00% 28 3 0.00% 29 2 0.00% 30 8 0.00% 31 2 0.00% 32 7 0.00% 33 9 0.00% 34 6 0.00% 35 3 0.00% 36 9 0.00% 37 8 0.00% 38 7 0.00% 39 9 0.00% 40 11 0.00% 41 10 0.00% 42 9 0.00% 43 11 0.00% 44 11 0.00% 45 12 0.00% 46 25 0.00% 47 21 0.00% 48 25 0.00% 49 24 0.00% 50 32 0.00% 51 45 0.00% 52 38 0.00% 53 42 0.00% 54 52 0.00% 55 58 0.00% 56 54 0.00% 57 62 0.00% 58 85 0.00% 59 78 0.00% 60 103 0.00% 61 132 0.00% 62 122 0.00% 63 120 0.00% 64 130 0.00% 65 139 0.00% 66 171 0.00% 67 202 0.00% 68 208 0.00% 69 226 0.00% 70 272 0.00% 71 338 0.00% 72 330 0.00% 73 393 0.00% 74 438 0.00% 75 474 0.00% 76 525 0.00% 77 576 0.00% 78 616 0.00% 79 781 0.01% 80 836 0.01% 81 925 0.01% 82 1058 0.01% 83 1241 0.01% 84 1438 0.01% 85 1712 0.01% 86 1849 0.01% 87 2081 0.02% 88 2261 0.02% 89 2487 0.02% 90 2739 0.02% 91 3182 0.02% 92 3427 0.03% 93 3919 0.03% 94 4505 0.04% 95 4770 0.04% 96 5213 0.04% 97 5818 0.05% 98 6231 0.05% 99 6706 0.05% 100 7196 0.06% 101 7846 0.06% 102 8524 0.07% 103 9305 0.07% 104 10194 0.08% 105 11211 0.09% 106 11697 0.09% 107 12651 0.10% 108 13589 0.11% 109 14837 0.12% 110 15552 0.12% 111 16351 0.13% 112 17731 0.14% 113 18623 0.15% 114 19496 0.15% 115 20785 0.16% 116 21888 0.17% 117 23148 0.18% 118 24089 0.19% 119 25146 0.20% 120 25788 0.20% 121 27221 0.21% 122 27938 0.22% 123 28941 0.23% 124 30348 0.24% 125 31188 0.24% 126 32409 0.25% 127 33962 0.27% 128 35718 0.28% 129 36479 0.29% 130 37766 0.30% 131 38132 0.30% 132 39260 0.31% 133 40088 0.31% 134 41320 0.32% 135 42853 0.34% 136 43826 0.34% 137 45755 0.36% 138 46781 0.37% 139 48900 0.38% 140 50251 0.39% 141 51543 0.40% 142 53055 0.42% 143 53928 0.42% 144 56264 0.44% 145 59226 0.46% 146 62686 0.49% 147 68104 0.53% 148 77614 0.61% 149 98813 0.77% 150 465818 3.65% 151 10557447 82.68% 12768786 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=4.26 fanout-score-rank=32 prefix-density=0.15 prefix-fanout=3.2 sequence=TCTGTGGAAGGACTGATTTTGTAGGAGATGGATACACCACACTTTGAAGGGAGGCCAGCAGCCACGCCATAGTTGATGCCAGAGATCTTACCAGCCAAGGATTTCAAACAGTTGCAGACCCCTTGGCGGTCGGCGGTGGTCGTGGCTGCAGAATTAAGTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGGAGGTAGGTTATACATTGTGCCAAGCTGCTTGACACCTGGCCACATGAGATGGCAGCTTCTGCTAGTGGTGCACTAACAACCATCGCTACAAGCATGGCACAGGCCAGCTTCAAGCTCATTGAAGAAGCCATTATATGCTAGCAGAATATTACAACTGGAATTATAAGAAGATTTTAGAGTATGGTTTAAGACTAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=3 fanout-score=409.67 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=38.9 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=37 prefix-density=0.21 prefix-fanout=2.0 sequence=TCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=10 fanout-score=372.74 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=31.5 sequence=AAGAAGAAGAAA SRR6232740 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 08:01:04 Started mapping on | Feb 12 08:01:04 Finished on | Feb 12 08:02:47 Mapping speed, Million of reads per hour | 446.29 Number of input reads | 12768786 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11896734 Uniquely mapped reads % | 93.17% Average mapped length | 295.56 Number of splices: Total | 11500911 Number of splices: Annotated (sjdb) | 11274329 Number of splices: GT/AG | 11276238 Number of splices: GC/AG | 181167 Number of splices: AT/AC | 10405 Number of splices: Non-canonical | 33101 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.03% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 423996 % of reads mapped to multiple loci | 3.32% Number of reads mapped to too many loci | 87687 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.69% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 451038 451038 451038 N_multimapping 423996 423996 423996 N_noFeature 344509 11767548 407580 N_ambiguous 137592 802 70930 UnstrandedReadsAssigned:11414633 PositiveStrandReadsAssigned:128384 NegativeStrandReadsAssigned:11418224 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6232740 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6232740-trimmed-pair1.fastq SRR6232740-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,768,786 reads, 11,496,640 reads pseudoaligned [quant] estimated average fragment length: 240.823 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR6232740.ke.tsv 34699 SRR6232740.se.tsv 87100 total ==> SRR6232740.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.18 270 12.4167 Potri.005G024800.1.v4.1 1035 795.177 21 2.1596 Potri.004G059700.1.v4.1 961 721.216 57 6.46291 Potri.007G009000.2.v4.1 1416 1176.18 1 0.0695258 Potri.003G141000.2.v4.1 2943 2703.18 293 8.86363 Potri.016G087400.1.v4.1 270 84.684 1299.26 1254.62 Potri.015G069301.1.v4.1 564 330.005 0 0 Potri.010G195200.1.v4.1 1773 1533.18 1 0.0533367 Potri.012G127500.1.v4.1 977 737.19 1782 197.673 ==> SRR6232740.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 223 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR6232740 completed mapping pipeline successfully