Starting /dee2/code/volunteer_pipeline.sh SRR6232743 current disk space = 3049718149120 free memory = 1295772652 SRR6232743 SRAfilesize e22eb9094fc8d3efb2682df03c625d41 SRR6232743.sra SRR6232743.sra file validated SRR6232743 is paired end SRR6232743 is conventional basespace SRR6232743 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232743_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.67675 35.0 35.0 35.0 35.0 35.0 2 34.7325 35.0 35.0 35.0 35.0 35.0 3 34.7755 35.0 35.0 35.0 35.0 35.0 4 34.742 35.0 35.0 35.0 35.0 35.0 5 34.7635 35.0 35.0 35.0 35.0 35.0 6 39.619 40.0 40.0 40.0 39.0 40.0 7 39.645 40.0 40.0 40.0 39.0 40.0 8 39.59575 40.0 40.0 40.0 39.0 40.0 9 39.602 40.0 40.0 40.0 39.0 40.0 10-14 39.575 40.0 40.0 40.0 39.0 40.0 15-19 39.61385 40.0 40.0 40.0 39.0 40.0 20-24 39.60395 40.0 40.0 40.0 39.0 40.0 25-29 39.575199999999995 40.0 40.0 40.0 39.0 40.0 30-34 39.5712 40.0 40.0 40.0 39.0 40.0 35-39 39.5239 40.0 40.0 40.0 39.0 40.0 40-44 39.55095000000001 40.0 40.0 40.0 39.0 40.0 45-49 39.497550000000004 40.0 40.0 40.0 39.0 40.0 50-54 39.465250000000005 40.0 40.0 40.0 39.0 40.0 55-59 39.4726 40.0 40.0 40.0 39.0 40.0 60-64 39.41465 40.0 40.0 40.0 39.0 40.0 65-69 39.33815 40.0 40.0 40.0 39.0 40.0 70-74 39.39565 40.0 40.0 40.0 39.0 40.0 75-79 39.35455 40.0 40.0 40.0 39.0 40.0 80-84 39.36655 40.0 40.0 40.0 39.0 40.0 85-89 39.3352 40.0 40.0 40.0 39.0 40.0 90-94 39.32685 40.0 40.0 40.0 39.0 40.0 95-99 39.32215 40.0 40.0 40.0 39.0 40.0 100-104 38.86065 39.6 39.2 39.8 37.8 40.0 105-109 39.3163 40.0 40.0 40.0 39.0 40.0 110-114 39.247 40.0 40.0 40.0 39.0 40.0 115-119 39.20775 40.0 40.0 40.0 39.0 40.0 120-124 39.15785 40.0 40.0 40.0 39.0 40.0 125-129 39.10055 40.0 40.0 40.0 38.6 40.0 130-134 38.9814 40.0 39.8 40.0 38.0 40.0 135-139 38.9429 40.0 39.4 40.0 38.0 40.0 140-144 38.817400000000006 40.0 39.0 40.0 37.8 40.0 145-149 38.681200000000004 40.0 39.0 40.0 37.4 40.0 150-151 36.806 39.0 36.5 39.5 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 4.0 24 0.0 25 1.0 26 4.0 27 7.0 28 10.0 29 14.0 30 17.0 31 17.0 32 28.0 33 31.0 34 40.0 35 35.0 36 73.0 37 103.0 38 223.0 39 3389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.682730923694777 11.295180722891567 8.559236947791165 59.46285140562249 2 16.55 16.5 45.6 21.349999999999998 3 18.575 19.725 26.75 34.949999999999996 4 22.575 29.375 21.099999999999998 26.950000000000003 5 20.5 35.35 25.55 18.6 6 16.625 34.825 27.675 20.875 7 13.725000000000001 21.45 45.675 19.15 8 16.7 22.325 34.849999999999994 26.125 9 16.35 21.775 36.449999999999996 25.424999999999997 10-14 19.46 28.4 27.6 24.54 15-19 19.785 27.74 28.115000000000002 24.36 20-24 19.695 28.035 28.470000000000002 23.799999999999997 25-29 19.375 28.15 28.065 24.41 30-34 20.080000000000002 28.095 27.46 24.365000000000002 35-39 20.150000000000002 28.125 28.125 23.599999999999998 40-44 20.71 28.27 27.725 23.294999999999998 45-49 20.244999999999997 27.76 27.915 24.08 50-54 20.11 28.000000000000004 27.975 23.915 55-59 20.294999999999998 27.73 27.825 24.15 60-64 20.23 27.93 27.860000000000003 23.98 65-69 20.580000000000002 27.950000000000003 27.839999999999996 23.630000000000003 70-74 20.424999999999997 27.800000000000004 28.000000000000004 23.775 75-79 20.380000000000003 27.875 28.02 23.724999999999998 80-84 20.474999999999998 27.88 27.715 23.93 85-89 19.415 29.189999999999998 27.345000000000002 24.05 90-94 20.57 27.82 27.375 24.235 95-99 20.685000000000002 27.87 27.79 23.655 100-104 20.585 28.915000000000003 27.155 23.345 105-109 20.39 27.99 27.765 23.855 110-114 20.64 29.099999999999998 26.900000000000002 23.36 115-119 20.95 28.389999999999997 27.065 23.595 120-124 21.15 28.02 27.465 23.365 125-129 21.25 28.134999999999998 27.625 22.99 130-134 21.185000000000002 28.29 26.905 23.62 135-139 20.855 28.185 27.345000000000002 23.615 140-144 21.404999999999998 27.855 27.26 23.48 145-149 21.32 28.51 27.01 23.16 150-151 19.7 28.6375 27.1375 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.0 21 0.5 22 0.0 23 0.5 24 1.5 25 2.0 26 3.5 27 6.0 28 8.5 29 16.5 30 20.0 31 22.0 32 31.0 33 38.5 34 41.5 35 66.0 36 87.5 37 98.5 38 132.5 39 154.5 40 180.5 41 221.0 42 236.5 43 251.5 44 293.0 45 304.5 46 272.0 47 240.5 48 224.5 49 213.5 50 183.0 51 142.5 52 102.0 53 83.0 54 74.0 55 59.0 56 45.0 57 36.5 58 31.0 59 20.5 60 15.0 61 11.5 62 6.0 63 1.5 64 3.5 65 2.0 66 1.0 67 2.5 68 2.5 69 2.0 70 1.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.975 0.0 0.0 0.0 0.0 122-123 2.4000000000000004 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 3.0375 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 3.9375 0.0 0.0 0.0 0.0 134-135 4.3375 0.0 0.0 0.0 0.0 136-137 4.8125 0.0 0.0 0.0 0.0 138-139 5.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTCCA 45 0.008957279 48.333332 145 GAACTCC 20 0.00593511 29.0 140-144 >>END_MODULE SRR6232743 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232743_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.359 35.0 35.0 35.0 33.0 35.0 2 34.42675 35.0 35.0 35.0 34.0 35.0 3 34.4595 35.0 35.0 35.0 35.0 35.0 4 34.4655 35.0 35.0 35.0 35.0 35.0 5 34.454 35.0 35.0 35.0 35.0 35.0 6 39.2985 40.0 40.0 40.0 39.0 40.0 7 39.3115 40.0 40.0 40.0 39.0 40.0 8 39.33425 40.0 40.0 40.0 39.0 40.0 9 39.2805 40.0 40.0 40.0 39.0 40.0 10-14 39.324799999999996 40.0 40.0 40.0 39.0 40.0 15-19 39.31425 40.0 40.0 40.0 39.0 40.0 20-24 39.32615 40.0 40.0 40.0 39.0 40.0 25-29 39.321549999999995 40.0 40.0 40.0 39.0 40.0 30-34 39.330949999999994 40.0 40.0 40.0 39.0 40.0 35-39 39.25665 40.0 40.0 40.0 39.0 40.0 40-44 39.1982 40.0 40.0 40.0 39.0 40.0 45-49 39.179 40.0 40.0 40.0 39.0 40.0 50-54 39.15375 40.0 40.0 40.0 39.0 40.0 55-59 39.12185000000001 40.0 40.0 40.0 39.0 40.0 60-64 39.08305 40.0 40.0 40.0 39.0 40.0 65-69 39.01905 40.0 40.0 40.0 38.8 40.0 70-74 39.0408 40.0 40.0 40.0 39.0 40.0 75-79 39.0125 40.0 40.0 40.0 38.6 40.0 80-84 39.002449999999996 40.0 40.0 40.0 38.8 40.0 85-89 38.9204 40.0 40.0 40.0 38.0 40.0 90-94 38.78345 40.0 39.2 40.0 37.8 40.0 95-99 38.8047 40.0 39.0 40.0 37.8 40.0 100-104 38.309000000000005 39.6 38.6 39.8 36.2 40.0 105-109 38.781099999999995 40.0 39.0 40.0 38.0 40.0 110-114 38.73385 40.0 39.0 40.0 37.8 40.0 115-119 38.639599999999994 40.0 39.0 40.0 37.0 40.0 120-124 38.61625 40.0 39.0 40.0 37.2 40.0 125-129 38.4791 40.0 39.0 40.0 36.2 40.0 130-134 38.3245 40.0 39.0 40.0 36.0 40.0 135-139 38.0771 40.0 39.0 40.0 35.6 40.0 140-144 37.9853 40.0 39.0 40.0 35.2 40.0 145-149 37.48525 39.6 38.8 40.0 34.2 40.0 150-151 34.635374999999996 38.0 34.5 39.5 25.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 3.0 17 1.0 18 2.0 19 3.0 20 6.0 21 2.0 22 11.0 23 14.0 24 7.0 25 12.0 26 13.0 27 11.0 28 6.0 29 12.0 30 28.0 31 23.0 32 26.0 33 36.0 34 49.0 35 58.0 36 80.0 37 146.0 38 311.0 39 3134.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.175 16.7 13.825000000000001 47.3 2 19.650000000000002 24.9 41.525 13.925 3 16.925 27.625 32.824999999999996 22.625 4 20.875 33.825 24.224999999999998 21.075 5 24.349999999999998 35.825 23.075000000000003 16.75 6 18.175 37.275000000000006 25.25 19.3 7 18.175 18.525 41.4 21.9 8 18.175 22.925 31.825 27.075 9 19.35 23.25 32.625 24.775 10-14 21.634999999999998 28.310000000000002 27.32 22.735 15-19 22.03 28.02 27.644999999999996 22.305 20-24 21.475 28.54 28.215 21.77 25-29 21.69 28.410000000000004 28.055000000000003 21.845 30-34 21.46 28.389999999999997 28.405 21.745 35-39 22.36 27.625 28.48 21.535 40-44 22.425 27.52 28.74 21.315 45-49 22.02 27.750000000000004 28.405 21.825 50-54 22.165000000000003 27.944999999999997 28.235 21.654999999999998 55-59 22.205 27.88 28.449999999999996 21.465 60-64 22.655 28.405 27.79 21.15 65-69 22.865 27.925 27.92 21.29 70-74 22.8 28.015 27.900000000000002 21.285 75-79 22.785 27.575 27.93 21.709999999999997 80-84 22.745 27.82 27.63 21.805 85-89 23.405 27.61 27.48 21.505 90-94 23.445 27.72 27.794999999999998 21.04 95-99 23.200000000000003 27.79 27.810000000000002 21.2 100-104 23.18 27.889999999999997 27.715 21.215 105-109 23.345 28.000000000000004 27.794999999999998 20.86 110-114 23.419999999999998 27.755000000000003 28.265 20.560000000000002 115-119 23.73 27.544999999999998 28.23 20.495 120-124 23.93 27.415 27.785 20.87 125-129 23.865 27.544999999999998 27.339999999999996 21.25 130-134 24.0 27.689999999999998 27.435 20.875 135-139 24.13 27.99 26.805 21.075 140-144 24.25 28.660000000000004 27.029999999999998 20.06 145-149 25.135 27.71 27.05 20.105 150-151 25.424999999999997 28.549999999999997 26.625 19.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 2.0 22 2.0 23 0.5 24 0.5 25 1.0 26 2.5 27 3.0 28 7.0 29 14.5 30 22.5 31 25.5 32 29.0 33 36.0 34 55.5 35 80.0 36 86.0 37 104.0 38 132.5 39 168.5 40 212.5 41 244.0 42 265.0 43 265.5 44 261.0 45 255.5 46 247.5 47 257.0 48 233.5 49 201.0 50 173.0 51 138.0 52 108.5 53 85.0 54 67.0 55 47.0 56 39.5 57 29.0 58 24.0 59 18.0 60 11.0 61 9.0 62 10.0 63 8.0 64 2.5 65 4.0 66 3.0 67 0.5 68 0.5 69 0.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.36250000000000004 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.5499999999999998 0.0 0.0 0.0 0.0 120-121 2.025 0.0 0.0 0.0 0.0 122-123 2.45 0.0 0.0 0.0 0.0 124-125 2.8125 0.0 0.0 0.0 0.0 126-127 3.0875 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.6875 0.0 0.0 0.0 0.0 132-133 3.9625000000000004 0.0 0.0 0.0 0.0 134-135 4.3625 0.0 0.0 0.0 0.0 136-137 4.8375 0.0 0.0 0.0 0.0 138-139 5.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACTCC 10 0.006830828 145.0 6 GTTGGTT 10 0.006830828 145.0 1 GGAAAGA 45 0.008957279 48.333332 145 >>END_MODULE Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456876 spots for SRR6232743.sra Written 456876 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra Read 456871 spots for SRR6232743.sra Written 456871 spots for SRR6232743.sra SRR ids: ['SRR6232743.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oyk7fihb SRR6232743.sra spots: 9137425 blocks: [[1, 456871], [456872, 913742], [913743, 1370613], [1370614, 1827484], [1827485, 2284355], [2284356, 2741226], [2741227, 3198097], [3198098, 3654968], [3654969, 4111839], [4111840, 4568710], [4568711, 5025581], [5025582, 5482452], [5482453, 5939323], [5939324, 6396194], [6396195, 6853065], [6853066, 7309936], [7309937, 7766807], [7766808, 8223678], [8223679, 8680549], [8680550, 9137425]] SRR6232743 file size 3076357 SRR6232743 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6232743 SRR6232743_1.fastq SRR6232743_2.fastq Input file: SRR6232743_1.fastq Paired file: SRR6232743_2.fastq trimmed: SRR6232743-trimmed-pair1.fastq, SRR6232743-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 08:00:08 2025 >> started Wed Feb 12 08:00:17 2025 >> done (9.340s) 9137425 read pairs processed; of these: 1268 ( 0.01%) short read pairs filtered out after trimming by size control 4207 ( 0.05%) empty read pairs filtered out after trimming by size control 9131950 (99.94%) read pairs available; of these: 1315670 (14.41%) trimmed read pairs available after processing 7816280 (85.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 6 0.00% 22 1 0.00% 23 2 0.00% 24 1 0.00% 25 1 0.00% 26 10 0.00% 27 4 0.00% 28 3 0.00% 29 4 0.00% 30 6 0.00% 31 4 0.00% 32 3 0.00% 33 4 0.00% 34 5 0.00% 35 3 0.00% 36 5 0.00% 37 2 0.00% 38 8 0.00% 39 10 0.00% 40 4 0.00% 41 8 0.00% 42 15 0.00% 43 9 0.00% 44 12 0.00% 45 9 0.00% 46 21 0.00% 47 15 0.00% 48 16 0.00% 49 30 0.00% 50 30 0.00% 51 28 0.00% 52 21 0.00% 53 34 0.00% 54 41 0.00% 55 33 0.00% 56 36 0.00% 57 55 0.00% 58 52 0.00% 59 56 0.00% 60 54 0.00% 61 69 0.00% 62 68 0.00% 63 85 0.00% 64 69 0.00% 65 88 0.00% 66 129 0.00% 67 96 0.00% 68 125 0.00% 69 134 0.00% 70 154 0.00% 71 172 0.00% 72 195 0.00% 73 229 0.00% 74 266 0.00% 75 301 0.00% 76 298 0.00% 77 366 0.00% 78 407 0.00% 79 414 0.00% 80 485 0.01% 81 603 0.01% 82 650 0.01% 83 754 0.01% 84 873 0.01% 85 968 0.01% 86 1102 0.01% 87 1235 0.01% 88 1329 0.01% 89 1483 0.02% 90 1674 0.02% 91 1835 0.02% 92 2021 0.02% 93 2287 0.03% 94 2662 0.03% 95 2728 0.03% 96 3017 0.03% 97 3345 0.04% 98 3601 0.04% 99 3698 0.04% 100 4055 0.04% 101 4505 0.05% 102 4804 0.05% 103 5239 0.06% 104 5656 0.06% 105 6070 0.07% 106 6578 0.07% 107 6897 0.08% 108 7482 0.08% 109 7946 0.09% 110 8703 0.10% 111 8772 0.10% 112 9416 0.10% 113 9799 0.11% 114 10413 0.11% 115 11129 0.12% 116 11684 0.13% 117 12396 0.14% 118 13015 0.14% 119 13082 0.14% 120 13769 0.15% 121 14453 0.16% 122 14871 0.16% 123 15223 0.17% 124 16274 0.18% 125 16540 0.18% 126 17140 0.19% 127 18193 0.20% 128 19084 0.21% 129 19268 0.21% 130 19963 0.22% 131 20646 0.23% 132 20947 0.23% 133 21807 0.24% 134 22540 0.25% 135 23185 0.25% 136 23969 0.26% 137 25279 0.28% 138 26083 0.29% 139 27418 0.30% 140 28208 0.31% 141 28840 0.32% 142 30267 0.33% 143 31419 0.34% 144 33064 0.36% 145 35296 0.39% 146 37551 0.41% 147 42010 0.46% 148 48126 0.53% 149 63545 0.70% 150 332368 3.64% 151 7816280 85.59% 9131950 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=5.74 fanout-score-rank=18 prefix-density=0.17 prefix-fanout=3.5 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=7 fanout-score=451.24 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=38.7 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=6.64 fanout-score-rank=17 prefix-density=0.58 prefix-fanout=4.4 sequence=AATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCAGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTCCAGGTGGGCCATGCTTGGAGCTCTTGGATGCGTCTTCCCCGAGCTCTTGTCCCGCAACGGTGTCAAGTTCGGCGAGGCTGTATGGTTCAAGGCTGGAGCCCAGATCTTCAGCGAGGGTGGACTTGACTACTTGGGCAACCCAAGCTTGATCCACGCACAAAGCATCTTGGCCATCTGGGCTACACAGGTGGTCTTGATGGGTGCCGTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=349.93 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=33.2 sequence=AAGAAGAAGAAA SRR6232743 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 08:01:04 Started mapping on | Feb 12 08:01:04 Finished on | Feb 12 08:02:10 Mapping speed, Million of reads per hour | 498.11 Number of input reads | 9131950 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 8565346 Uniquely mapped reads % | 93.80% Average mapped length | 296.90 Number of splices: Total | 8200461 Number of splices: Annotated (sjdb) | 8049002 Number of splices: GT/AG | 8046373 Number of splices: GC/AG | 128091 Number of splices: AT/AC | 5867 Number of splices: Non-canonical | 20130 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.03% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264852 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 29729 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 303539 303539 303539 N_multimapping 264852 264852 264852 N_noFeature 253315 8483037 294792 N_ambiguous 87071 422 45970 UnstrandedReadsAssigned:8224960 PositiveStrandReadsAssigned:81887 NegativeStrandReadsAssigned:8224584 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6232743 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6232743-trimmed-pair1.fastq SRR6232743-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,131,950 reads, 8,274,130 reads pseudoaligned [quant] estimated average fragment length: 255.156 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,001 rounds 52401 SRR6232743.ke.tsv 34699 SRR6232743.se.tsv 87100 total ==> SRR6232743.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.84 189 13.7818 Potri.005G024800.1.v4.1 1035 780.844 36 5.92983 Potri.004G059700.1.v4.1 961 706.933 29 5.27624 Potri.007G009000.2.v4.1 1416 1161.84 0 0 Potri.003G141000.2.v4.1 2943 2688.84 198 9.47117 Potri.016G087400.1.v4.1 270 79.531 538 870.062 Potri.015G069301.1.v4.1 564 317.565 0 0 Potri.010G195200.1.v4.1 1773 1518.84 3 0.254046 Potri.012G127500.1.v4.1 977 722.884 1002 178.28 ==> SRR6232743.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 113 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR6232743 completed mapping pipeline successfully