Starting /dee2/code/volunteer_pipeline.sh SRR6232744 current disk space = 3049793306624 free memory = 1484789100 SRR6232744 SRAfilesize fcbf58510b2e7793a87bc2942e8c2557 SRR6232744.sra SRR6232744.sra file validated SRR6232744 is paired end SRR6232744 is conventional basespace SRR6232744 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232744_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.59175 35.0 35.0 35.0 35.0 35.0 2 34.73875 35.0 35.0 35.0 35.0 35.0 3 34.7635 35.0 35.0 35.0 35.0 35.0 4 34.7965 35.0 35.0 35.0 35.0 35.0 5 34.8055 35.0 35.0 35.0 35.0 35.0 6 39.66775 40.0 40.0 40.0 39.0 40.0 7 39.676 40.0 40.0 40.0 39.0 40.0 8 39.639 40.0 40.0 40.0 39.0 40.0 9 39.6615 40.0 40.0 40.0 39.0 40.0 10-14 39.63405 40.0 40.0 40.0 39.0 40.0 15-19 39.6379 40.0 40.0 40.0 39.0 40.0 20-24 39.62565 40.0 40.0 40.0 39.0 40.0 25-29 39.62669999999999 40.0 40.0 40.0 39.0 40.0 30-34 39.6102 40.0 40.0 40.0 39.0 40.0 35-39 39.56945 40.0 40.0 40.0 39.0 40.0 40-44 39.5912 40.0 40.0 40.0 39.0 40.0 45-49 39.5509 40.0 40.0 40.0 39.0 40.0 50-54 39.4692 40.0 40.0 40.0 39.0 40.0 55-59 39.53095 40.0 40.0 40.0 39.0 40.0 60-64 39.47175 40.0 40.0 40.0 39.0 40.0 65-69 39.37905 40.0 40.0 40.0 39.0 40.0 70-74 39.443650000000005 40.0 40.0 40.0 39.0 40.0 75-79 39.394 40.0 40.0 40.0 39.0 40.0 80-84 39.4239 40.0 40.0 40.0 39.0 40.0 85-89 39.40145 40.0 40.0 40.0 39.0 40.0 90-94 39.3558 40.0 40.0 40.0 39.0 40.0 95-99 39.3378 40.0 40.0 40.0 39.0 40.0 100-104 38.86665 39.8 39.2 39.8 38.0 40.0 105-109 39.32275 40.0 40.0 40.0 39.0 40.0 110-114 39.3141 40.0 40.0 40.0 39.0 40.0 115-119 39.33045 40.0 40.0 40.0 39.0 40.0 120-124 39.275 40.0 40.0 40.0 39.0 40.0 125-129 39.21835 40.0 40.0 40.0 39.0 40.0 130-134 39.1375 40.0 40.0 40.0 38.6 40.0 135-139 39.0669 40.0 40.0 40.0 38.0 40.0 140-144 38.966449999999995 40.0 39.4 40.0 38.0 40.0 145-149 38.79639999999999 40.0 39.0 40.0 38.0 40.0 150-151 36.820875 39.0 36.5 39.5 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 2.0 23 0.0 24 1.0 25 2.0 26 2.0 27 5.0 28 10.0 29 9.0 30 10.0 31 14.0 32 21.0 33 33.0 34 42.0 35 42.0 36 54.0 37 116.0 38 235.0 39 3398.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.187311178247736 11.60624370594159 8.887210473313193 56.319234642497484 2 17.675 14.499999999999998 43.425000000000004 24.4 3 18.25 19.6 26.575 35.575 4 22.925 29.599999999999998 20.674999999999997 26.8 5 22.5 33.15 25.0 19.35 6 17.1 34.975 27.125 20.8 7 12.45 25.5 44.625 17.424999999999997 8 18.0 23.625 33.550000000000004 24.825 9 15.4 23.150000000000002 36.175000000000004 25.275 10-14 19.155 29.830000000000002 27.185 23.830000000000002 15-19 19.689999999999998 28.389999999999997 28.065 23.855 20-24 19.875 28.415000000000003 27.37 24.34 25-29 19.814999999999998 28.544999999999998 27.41 24.23 30-34 19.715 29.154999999999998 26.99 24.14 35-39 20.085 28.735 27.450000000000003 23.73 40-44 20.005 28.470000000000002 27.839999999999996 23.685000000000002 45-49 19.685 28.26 27.839999999999996 24.215 50-54 20.825 27.46 28.01 23.705000000000002 55-59 20.375 27.97 27.97 23.685000000000002 60-64 20.53 28.12 27.52 23.830000000000002 65-69 20.212021202120212 28.337833783378336 27.702770277027707 23.74737473747375 70-74 20.097009700970098 28.147814781478147 28.082808280828083 23.672367236723673 75-79 20.207020702070206 27.982798279827982 27.61276127612761 24.197419741974198 80-84 19.95699569956996 28.397839783978394 27.817781778177817 23.827382738273826 85-89 20.71 28.38 27.025 23.885 90-94 20.532053205320533 28.222822282228222 27.697769776977697 23.547354735473547 95-99 20.382038203820382 28.18781878187819 27.927792779277926 23.502350235023503 100-104 20.64 28.07 27.169999999999998 24.12 105-109 20.22 28.54 27.71 23.53 110-114 20.3 28.07 27.965 23.665 115-119 21.245 28.110000000000003 27.185 23.46 120-124 21.34 28.12 27.305 23.235 125-129 21.4 27.615000000000002 27.565 23.419999999999998 130-134 21.54 28.54 26.479999999999997 23.44 135-139 21.915000000000003 28.08 26.590000000000003 23.415 140-144 22.15 27.755000000000003 26.700000000000003 23.395 145-149 21.68 27.74 26.884999999999998 23.695 150-151 21.075 27.375 27.0625 24.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 2.0 24 2.0 25 3.0 26 4.0 27 8.0 28 10.5 29 12.5 30 17.5 31 21.0 32 26.0 33 39.0 34 56.5 35 69.0 36 85.0 37 107.0 38 138.5 39 173.5 40 194.5 41 214.0 42 229.5 43 246.5 44 274.5 45 266.0 46 253.5 47 263.5 48 243.5 49 196.5 50 163.5 51 150.0 52 127.0 53 95.5 54 71.0 55 55.5 56 41.5 57 31.5 58 26.0 59 24.0 60 18.5 61 8.0 62 5.5 63 5.5 64 3.0 65 1.5 66 0.5 67 1.0 68 3.0 69 2.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.01 75-79 0.01 80-84 0.01 85-89 0.0 90-94 0.01 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14032869785082 98.02499999999999 2 0.6573957016434893 1.3 3 0.12642225031605564 0.375 4 0.07585335018963338 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.5750000000000002 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.1 0.0 0.0 0.0 0.0 120-121 2.35 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.85 0.0 0.0 0.0 0.0 130-131 4.5125 0.0 0.0 0.0 0.0 132-133 5.15 0.0 0.0 0.0 0.0 134-135 5.625 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138-139 6.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGTCC 10 0.0068343505 144.975 145 >>END_MODULE SRR6232744 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232744_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.51375 35.0 35.0 35.0 34.0 35.0 2 34.5365 35.0 35.0 35.0 34.0 35.0 3 34.5675 35.0 35.0 35.0 35.0 35.0 4 34.5955 35.0 35.0 35.0 35.0 35.0 5 34.6635 35.0 35.0 35.0 35.0 35.0 6 39.5365 40.0 40.0 40.0 39.0 40.0 7 39.50275 40.0 40.0 40.0 39.0 40.0 8 39.50625 40.0 40.0 40.0 39.0 40.0 9 39.47475 40.0 40.0 40.0 39.0 40.0 10-14 39.496449999999996 40.0 40.0 40.0 39.0 40.0 15-19 39.49465 40.0 40.0 40.0 39.0 40.0 20-24 39.484950000000005 40.0 40.0 40.0 39.0 40.0 25-29 39.51995 40.0 40.0 40.0 39.0 40.0 30-34 39.49955 40.0 40.0 40.0 39.0 40.0 35-39 39.4258 40.0 40.0 40.0 39.0 40.0 40-44 39.3836 40.0 40.0 40.0 39.0 40.0 45-49 39.40985 40.0 40.0 40.0 39.0 40.0 50-54 39.3951 40.0 40.0 40.0 39.0 40.0 55-59 39.37755 40.0 40.0 40.0 39.0 40.0 60-64 39.32905000000001 40.0 40.0 40.0 39.0 40.0 65-69 39.2838 40.0 40.0 40.0 39.0 40.0 70-74 39.28515 40.0 40.0 40.0 39.0 40.0 75-79 39.28185 40.0 40.0 40.0 39.0 40.0 80-84 39.2709 40.0 40.0 40.0 39.0 40.0 85-89 39.202600000000004 40.0 40.0 40.0 39.0 40.0 90-94 39.07895 40.0 40.0 40.0 38.0 40.0 95-99 39.083400000000005 40.0 40.0 40.0 38.4 40.0 100-104 38.632799999999996 39.6 39.0 39.8 37.2 40.0 105-109 39.0828 40.0 40.0 40.0 38.6 40.0 110-114 39.06525 40.0 40.0 40.0 38.4 40.0 115-119 38.97385 40.0 39.6 40.0 38.0 40.0 120-124 38.911 40.0 39.0 40.0 38.0 40.0 125-129 38.7396 40.0 39.0 40.0 37.2 40.0 130-134 38.7017 40.0 39.0 40.0 37.2 40.0 135-139 38.407 40.0 39.0 40.0 36.2 40.0 140-144 38.284749999999995 40.0 39.0 40.0 36.0 40.0 145-149 37.74025 39.8 39.0 40.0 35.2 40.0 150-151 35.004125 38.5 35.0 39.5 25.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 3.0 17 2.0 18 0.0 19 0.0 20 2.0 21 6.0 22 2.0 23 6.0 24 10.0 25 6.0 26 5.0 27 5.0 28 8.0 29 13.0 30 16.0 31 14.0 32 19.0 33 33.0 34 36.0 35 50.0 36 88.0 37 159.0 38 314.0 39 3200.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.35 18.175 14.149999999999999 45.324999999999996 2 22.625 24.825 37.175000000000004 15.375 3 18.125 28.65 31.075000000000003 22.15 4 21.55 35.325 23.325000000000003 19.8 5 24.95 35.925000000000004 23.175 15.950000000000001 6 19.325 37.475 23.825 19.375 7 18.175 19.05 40.525 22.25 8 19.875 22.55 31.4 26.174999999999997 9 21.6 22.875 31.45 24.075 10-14 22.415 28.845 26.419999999999998 22.32 15-19 22.825 28.175 27.224999999999998 21.775 20-24 22.814999999999998 28.470000000000002 27.76 20.955 25-29 22.41 28.335 27.595 21.66 30-34 22.925 27.985 27.63 21.46 35-39 23.565 28.595 26.845000000000002 20.995 40-44 22.915 27.68 27.834999999999997 21.57 45-49 22.685 28.435 27.38 21.5 50-54 23.44 27.584999999999997 27.245 21.73 55-59 23.53 28.26 27.015 21.195 60-64 23.375 27.534999999999997 27.985 21.105 65-69 23.49 27.275 28.095 21.14 70-74 23.400000000000002 27.73 27.82 21.05 75-79 23.185 28.360000000000003 27.334999999999997 21.12 80-84 23.294999999999998 28.02 27.405 21.279999999999998 85-89 23.71 27.615000000000002 27.395000000000003 21.279999999999998 90-94 23.945 27.88 26.974999999999998 21.2 95-99 23.84 28.134999999999998 27.700000000000003 20.325 100-104 24.29 27.92 27.355 20.435 105-109 24.065 27.275 27.55 21.11 110-114 24.37 27.150000000000002 27.52 20.96 115-119 23.400000000000002 28.26 27.375 20.965 120-124 23.68 27.61 27.405 21.305 125-129 24.535 28.29 26.445 20.73 130-134 24.474999999999998 28.01 27.250000000000004 20.265 135-139 24.635 28.23 26.674999999999997 20.46 140-144 25.569999999999997 27.694999999999997 27.12 19.615 145-149 25.490000000000002 27.639999999999997 27.150000000000002 19.72 150-151 25.525 27.737499999999997 27.287499999999998 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 2.0 26 2.5 27 1.0 28 4.0 29 7.0 30 13.0 31 16.5 32 16.5 33 27.0 34 36.0 35 57.0 36 91.5 37 111.0 38 141.5 39 167.5 40 187.0 41 220.5 42 237.0 43 256.0 44 271.5 45 273.0 46 277.5 47 266.5 48 229.5 49 218.0 50 194.5 51 145.0 52 124.0 53 101.5 54 76.0 55 54.5 56 38.5 57 30.0 58 25.0 59 21.0 60 16.5 61 11.5 62 10.0 63 7.5 64 3.5 65 2.5 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06494819307557 98.0 2 0.8086934546373514 1.6 3 0.10108668182966893 0.3 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.5750000000000002 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.1 0.0 0.0 0.0 0.0 120-121 2.35 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.85 0.0 0.0 0.0 0.0 130-131 4.5125 0.0 0.0 0.0 0.0 132-133 5.15 0.0 0.0 0.0 0.0 134-135 5.6375 0.0 0.0 0.0 0.0 136-137 6.0625 0.0 0.0 0.0 0.0 138-139 6.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCC 10 0.006830828 145.0 2 >>END_MODULE Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564540 spots for SRR6232744.sra Written 564540 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra Read 564536 spots for SRR6232744.sra Written 564536 spots for SRR6232744.sra SRR ids: ['SRR6232744.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ju8vueed SRR6232744.sra spots: 11290724 blocks: [[1, 564536], [564537, 1129072], [1129073, 1693608], [1693609, 2258144], [2258145, 2822680], [2822681, 3387216], [3387217, 3951752], [3951753, 4516288], [4516289, 5080824], [5080825, 5645360], [5645361, 6209896], [6209897, 6774432], [6774433, 7338968], [7338969, 7903504], [7903505, 8468040], [8468041, 9032576], [9032577, 9597112], [9597113, 10161648], [10161649, 10726184], [10726185, 11290724]] SRR6232744 file size 3804355 SRR6232744 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6232744 SRR6232744_1.fastq SRR6232744_2.fastq Input file: SRR6232744_1.fastq Paired file: SRR6232744_2.fastq trimmed: SRR6232744-trimmed-pair1.fastq, SRR6232744-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:38:47 2025 >> started Wed Feb 12 07:38:59 2025 >> done (11.434s) 11290724 read pairs processed; of these: 1193 ( 0.01%) short read pairs filtered out after trimming by size control 4995 ( 0.04%) empty read pairs filtered out after trimming by size control 11284536 (99.95%) read pairs available; of these: 1757438 (15.57%) trimmed read pairs available after processing 9527098 (84.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 0 0.00% 21 1 0.00% 22 3 0.00% 23 1 0.00% 24 3 0.00% 25 3 0.00% 26 3 0.00% 27 4 0.00% 28 2 0.00% 29 5 0.00% 30 10 0.00% 31 2 0.00% 32 4 0.00% 33 4 0.00% 34 2 0.00% 35 7 0.00% 36 6 0.00% 37 3 0.00% 38 6 0.00% 39 3 0.00% 40 9 0.00% 41 9 0.00% 42 16 0.00% 43 8 0.00% 44 8 0.00% 45 12 0.00% 46 18 0.00% 47 18 0.00% 48 18 0.00% 49 23 0.00% 50 18 0.00% 51 32 0.00% 52 36 0.00% 53 29 0.00% 54 28 0.00% 55 35 0.00% 56 47 0.00% 57 32 0.00% 58 61 0.00% 59 57 0.00% 60 66 0.00% 61 64 0.00% 62 80 0.00% 63 82 0.00% 64 111 0.00% 65 89 0.00% 66 107 0.00% 67 126 0.00% 68 154 0.00% 69 147 0.00% 70 184 0.00% 71 211 0.00% 72 227 0.00% 73 267 0.00% 74 320 0.00% 75 308 0.00% 76 396 0.00% 77 378 0.00% 78 465 0.00% 79 478 0.00% 80 598 0.01% 81 585 0.01% 82 798 0.01% 83 801 0.01% 84 989 0.01% 85 1131 0.01% 86 1269 0.01% 87 1451 0.01% 88 1564 0.01% 89 1724 0.02% 90 1891 0.02% 91 2150 0.02% 92 2417 0.02% 93 2738 0.02% 94 3082 0.03% 95 3267 0.03% 96 3586 0.03% 97 4029 0.04% 98 4488 0.04% 99 4548 0.04% 100 5020 0.04% 101 5478 0.05% 102 5977 0.05% 103 6759 0.06% 104 7147 0.06% 105 7843 0.07% 106 8583 0.08% 107 9330 0.08% 108 9715 0.09% 109 10753 0.10% 110 11250 0.10% 111 11776 0.10% 112 12529 0.11% 113 13571 0.12% 114 14289 0.13% 115 15307 0.14% 116 16352 0.14% 117 17065 0.15% 118 18136 0.16% 119 18751 0.17% 120 19258 0.17% 121 19924 0.18% 122 20835 0.18% 123 21024 0.19% 124 22193 0.20% 125 23635 0.21% 126 25042 0.22% 127 25917 0.23% 128 27270 0.24% 129 28247 0.25% 130 28939 0.26% 131 29338 0.26% 132 30102 0.27% 133 30666 0.27% 134 32023 0.28% 135 32968 0.29% 136 34271 0.30% 137 35921 0.32% 138 36812 0.33% 139 38546 0.34% 140 39594 0.35% 141 41248 0.37% 142 42576 0.38% 143 43164 0.38% 144 45173 0.40% 145 47986 0.43% 146 51413 0.46% 147 56030 0.50% 148 64385 0.57% 149 82687 0.73% 150 406663 3.60% 151 9527098 84.43% 11284536 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=21 prefix-density=0.38 prefix-fanout=2.3 sequence=AACGAGCATTAAGTGTCCCAATGTGGAACCTTCTCCCCGCAATGTCAACATAAGGCGTTTCAGCATCAGGTGTGAAGAGACCAGAGTCTTGAAGGGCCTTTTCGTTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=385.29 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=34.5 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=24 prefix-density=0.55 prefix-fanout=2.1 sequence=TGGTAGTGATGGTGGTTGGGCTGCTGGTTTTGGCTCAGCAGTCCTTCCAAATGAGTTTGAGAAACCCTGTTGCTGAGACAAACAATTGCAAAATTGATTTCACTCGTTTAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=34.29 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.8 sequence=GTGTTTCTTGCTTACCTCAAATCTCTTGAAAGATACTGAAAAGGTCTTAATTCGACGCATCTCGGCAATGGAGAGTCGTATGCCCAATATTGCTATAATTACCTTCACCCTCGTCATCTTCCTCTATG SRR6232744 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:39:44 Started mapping on | Feb 12 07:39:44 Finished on | Feb 12 07:42:00 Mapping speed, Million of reads per hour | 298.71 Number of input reads | 11284536 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10245463 Uniquely mapped reads % | 90.79% Average mapped length | 296.43 Number of splices: Total | 9827692 Number of splices: Annotated (sjdb) | 9639934 Number of splices: GT/AG | 9618298 Number of splices: GC/AG | 174868 Number of splices: AT/AC | 8016 Number of splices: Non-canonical | 26510 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.03% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 544387 % of reads mapped to multiple loci | 4.82% Number of reads mapped to too many loci | 42201 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.87% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 495967 495967 495967 N_multimapping 544387 544387 544387 N_noFeature 259748 10147006 303088 N_ambiguous 123242 554 67776 UnstrandedReadsAssigned:9862473 PositiveStrandReadsAssigned:97903 NegativeStrandReadsAssigned:9874599 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6232744 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6232744-trimmed-pair1.fastq SRR6232744-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,284,536 reads, 10,072,477 reads pseudoaligned [quant] estimated average fragment length: 242.219 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR6232744.ke.tsv 34699 SRR6232744.se.tsv 87100 total ==> SRR6232744.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.78 239 11.5185 Potri.005G024800.1.v4.1 1035 793.781 20 2.15755 Potri.004G059700.1.v4.1 961 719.822 32 3.80676 Potri.007G009000.2.v4.1 1416 1174.78 0 0 Potri.003G141000.2.v4.1 2943 2701.78 180 5.70497 Potri.016G087400.1.v4.1 270 80.9446 934.558 988.665 Potri.015G069301.1.v4.1 564 328.004 0 0 Potri.010G195200.1.v4.1 1773 1531.78 9 0.503126 Potri.012G127500.1.v4.1 977 735.799 1205 140.236 ==> SRR6232744.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 163 Potri.001G212900.v4.1 715 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR6232744 completed mapping pipeline successfully