Starting /dee2/code/volunteer_pipeline.sh SRR6232745 current disk space = 3049603719168 free memory = 1582688428 SRR6232745 SRAfilesize f8ecc30c2ef85926887507254c941838 SRR6232745.sra SRR6232745.sra file validated SRR6232745 is paired end SRR6232745 is conventional basespace SRR6232745 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232745_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.6165 35.0 35.0 35.0 35.0 35.0 2 34.75975 35.0 35.0 35.0 35.0 35.0 3 34.76575 35.0 35.0 35.0 35.0 35.0 4 34.74975 35.0 35.0 35.0 35.0 35.0 5 34.80775 35.0 35.0 35.0 35.0 35.0 6 39.58775 40.0 40.0 40.0 39.0 40.0 7 39.67025 40.0 40.0 40.0 39.0 40.0 8 39.6525 40.0 40.0 40.0 39.0 40.0 9 39.66375 40.0 40.0 40.0 39.0 40.0 10-14 39.62845 40.0 40.0 40.0 39.0 40.0 15-19 39.650800000000004 40.0 40.0 40.0 39.0 40.0 20-24 39.616550000000004 40.0 40.0 40.0 39.0 40.0 25-29 39.604699999999994 40.0 40.0 40.0 39.0 40.0 30-34 39.60355 40.0 40.0 40.0 39.0 40.0 35-39 39.54735 40.0 40.0 40.0 39.0 40.0 40-44 39.59804999999999 40.0 40.0 40.0 39.0 40.0 45-49 39.566950000000006 40.0 40.0 40.0 39.0 40.0 50-54 39.489250000000006 40.0 40.0 40.0 39.0 40.0 55-59 39.529900000000005 40.0 40.0 40.0 39.0 40.0 60-64 39.4539 40.0 40.0 40.0 39.0 40.0 65-69 39.39045 40.0 40.0 40.0 39.0 40.0 70-74 39.44775 40.0 40.0 40.0 39.0 40.0 75-79 39.3995 40.0 40.0 40.0 39.0 40.0 80-84 39.4191 40.0 40.0 40.0 39.0 40.0 85-89 39.345600000000005 40.0 40.0 40.0 39.0 40.0 90-94 39.31725 40.0 40.0 40.0 39.0 40.0 95-99 39.323699999999995 40.0 40.0 40.0 39.0 40.0 100-104 38.8583 39.6 39.2 39.8 37.8 40.0 105-109 39.277049999999996 40.0 40.0 40.0 39.0 40.0 110-114 39.241949999999996 40.0 40.0 40.0 39.0 40.0 115-119 39.19525 40.0 40.0 40.0 39.0 40.0 120-124 39.1651 40.0 40.0 40.0 39.0 40.0 125-129 39.128049999999995 40.0 40.0 40.0 39.0 40.0 130-134 39.0364 40.0 40.0 40.0 38.6 40.0 135-139 38.94855 40.0 39.8 40.0 38.0 40.0 140-144 38.87675 40.0 39.8 40.0 38.2 40.0 145-149 38.688900000000004 40.0 39.0 40.0 37.2 40.0 150-151 36.88275 39.5 36.5 39.5 32.5 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 2.0 20 0.0 21 0.0 22 1.0 23 1.0 24 3.0 25 5.0 26 3.0 27 10.0 28 6.0 29 10.0 30 14.0 31 15.0 32 22.0 33 26.0 34 38.0 35 45.0 36 66.0 37 108.0 38 206.0 39 3417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.1579476861167 12.449698189134809 9.180080482897385 56.212273641851105 2 18.05 17.150000000000002 44.425 20.375 3 19.15 21.45 25.900000000000002 33.5 4 22.1 30.8 21.175 25.924999999999997 5 22.55 35.199999999999996 23.45 18.8 6 17.224999999999998 35.75 26.825 20.200000000000003 7 14.649999999999999 23.225 43.675000000000004 18.45 8 17.349999999999998 22.5 33.95 26.200000000000003 9 16.45 20.95 36.55 26.05 10-14 19.575 29.07 27.05 24.305 15-19 20.055 27.860000000000003 27.615000000000002 24.47 20-24 19.41 28.139999999999997 28.315 24.135 25-29 19.939999999999998 28.499999999999996 27.794999999999998 23.765 30-34 19.615 27.865000000000002 28.425 24.095 35-39 19.994999999999997 28.249999999999996 27.62 24.135 40-44 20.29 28.505000000000003 27.91 23.294999999999998 45-49 19.665 28.21 27.845 24.279999999999998 50-54 19.845 28.34 28.065 23.75 55-59 20.31 28.115000000000002 28.044999999999998 23.53 60-64 19.955000000000002 27.644999999999996 28.1 24.3 65-69 20.04800720108016 28.05420813121968 27.309096364454668 24.588688303245487 70-74 19.807971195679354 28.389258388758314 27.714157123568533 24.0886132919938 75-79 19.956974184510706 28.357014208525115 27.38643185911547 24.29957974784871 80-84 20.37111133340002 28.473542062618783 27.588276482944885 23.56707012103631 85-89 20.20106031809543 28.388516554966493 27.938381514454335 23.472041612483746 90-94 20.34517258629315 28.009004502251127 27.68384192096048 23.961980990495245 95-99 20.564395076553588 28.189732812969076 27.259081356949867 23.98679075352747 100-104 20.531292210715893 28.86587623192756 27.36004802641453 23.242783530942017 105-109 20.801240372111636 28.218465539661896 27.30319095728719 23.67710313093928 110-114 20.569256165274375 28.332749737381825 27.332299534790653 23.76569456255315 115-119 20.924415987194237 28.242709219148615 27.07218248211695 23.760692311540193 120-124 20.739147829565912 28.105621124224843 27.460492098419685 23.69473894778956 125-129 20.525131282820706 27.926981745436358 27.881970492623154 23.66591647911978 130-134 21.213181977296593 28.234235135270293 27.054058108716305 23.49852477871681 135-139 21.172117211721172 27.86278627862786 27.242724272427242 23.72237223722372 140-144 21.506075303765186 27.901395069753487 26.941347067353366 23.651182559127957 145-149 21.279999999999998 28.38 26.790000000000003 23.549999999999997 150-151 21.25 27.737499999999997 27.3875 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 0.5 24 1.5 25 4.0 26 7.0 27 7.0 28 11.0 29 17.0 30 18.0 31 19.0 32 29.5 33 41.5 34 46.5 35 65.5 36 86.0 37 102.0 38 140.5 39 172.0 40 189.0 41 212.5 42 235.0 43 261.0 44 267.0 45 273.5 46 285.5 47 266.5 48 223.5 49 193.5 50 174.5 51 149.0 52 110.0 53 80.5 54 71.0 55 56.0 56 44.5 57 32.0 58 23.0 59 22.5 60 17.5 61 10.5 62 8.0 63 3.5 64 3.5 65 5.0 66 3.0 67 2.5 68 2.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.015 70-74 0.015 75-79 0.06 80-84 0.03 85-89 0.03 90-94 0.05 95-99 0.06999999999999999 100-104 0.055 105-109 0.03 110-114 0.045 115-119 0.045 120-124 0.02 125-129 0.025 130-134 0.015 135-139 0.01 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.6298815822625347 1.25 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.9125000000000001 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.8250000000000002 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.525 0.0 0.0 0.0 0.0 124-125 3.0125 0.0 0.0 0.0 0.0 126-127 3.6 0.0 0.0 0.0 0.0 128-129 4.1375 0.0 0.0 0.0 0.0 130-131 4.5875 0.0 0.0 0.0 0.0 132-133 5.1 0.0 0.0 0.0 0.0 134-135 5.6125 0.0 0.0 0.0 0.0 136-137 6.175 0.0 0.0 0.0 0.0 138-139 6.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAACT 10 0.006830828 145.0 2 GTCCATG 10 0.006830828 145.0 9 >>END_MODULE SRR6232745 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232745_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.499 35.0 35.0 35.0 34.0 35.0 2 34.53075 35.0 35.0 35.0 34.0 35.0 3 34.642 35.0 35.0 35.0 35.0 35.0 4 34.57775 35.0 35.0 35.0 35.0 35.0 5 34.47025 35.0 35.0 35.0 34.0 35.0 6 39.40125 40.0 40.0 40.0 39.0 40.0 7 39.44575 40.0 40.0 40.0 39.0 40.0 8 39.40075 40.0 40.0 40.0 39.0 40.0 9 39.4375 40.0 40.0 40.0 39.0 40.0 10-14 39.45870000000001 40.0 40.0 40.0 39.0 40.0 15-19 39.45585 40.0 40.0 40.0 39.0 40.0 20-24 39.45615 40.0 40.0 40.0 39.0 40.0 25-29 39.4219 40.0 40.0 40.0 39.0 40.0 30-34 39.41785 40.0 40.0 40.0 39.0 40.0 35-39 39.396300000000004 40.0 40.0 40.0 39.0 40.0 40-44 39.30825 40.0 40.0 40.0 39.0 40.0 45-49 39.29155 40.0 40.0 40.0 39.0 40.0 50-54 39.3061 40.0 40.0 40.0 39.0 40.0 55-59 39.21615 40.0 40.0 40.0 39.0 40.0 60-64 39.24155 40.0 40.0 40.0 39.0 40.0 65-69 39.20615 40.0 40.0 40.0 39.0 40.0 70-74 39.169149999999995 40.0 40.0 40.0 39.0 40.0 75-79 39.15335 40.0 40.0 40.0 39.0 40.0 80-84 39.11025000000001 40.0 40.0 40.0 39.0 40.0 85-89 39.0293 40.0 40.0 40.0 38.6 40.0 90-94 38.923899999999996 40.0 40.0 40.0 38.0 40.0 95-99 38.932900000000004 40.0 40.0 40.0 38.0 40.0 100-104 38.522149999999996 39.6 39.0 39.8 37.2 40.0 105-109 38.9295 40.0 39.6 40.0 38.0 40.0 110-114 38.86675 40.0 39.6 40.0 38.0 40.0 115-119 38.806799999999996 40.0 39.0 40.0 38.0 40.0 120-124 38.812 40.0 39.0 40.0 38.0 40.0 125-129 38.63195 40.0 39.0 40.0 37.0 40.0 130-134 38.45815 40.0 39.0 40.0 36.4 40.0 135-139 38.22965000000001 40.0 39.0 40.0 36.0 40.0 140-144 38.14175 40.0 39.0 40.0 36.0 40.0 145-149 37.66335 39.6 39.0 40.0 34.6 40.0 150-151 34.85275 38.0 35.0 39.5 25.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 2.0 18 3.0 19 1.0 20 4.0 21 3.0 22 6.0 23 5.0 24 8.0 25 9.0 26 6.0 27 12.0 28 14.0 29 18.0 30 25.0 31 13.0 32 27.0 33 25.0 34 44.0 35 53.0 36 78.0 37 122.0 38 304.0 39 3212.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.849999999999998 16.175 14.424999999999999 45.550000000000004 2 21.224999999999998 23.575 40.825 14.374999999999998 3 17.625 28.275 31.874999999999996 22.225 4 21.525 34.325 23.425 20.724999999999998 5 24.474999999999998 35.525 24.3 15.7 6 18.224999999999998 37.35 24.525 19.900000000000002 7 16.375 17.75 44.775 21.099999999999998 8 18.775 22.55 31.45 27.224999999999998 9 21.0 23.025000000000002 31.55 24.425 10-14 22.665 27.96 26.884999999999998 22.49 15-19 22.71 28.375 27.439999999999998 21.475 20-24 22.935 28.595 27.235 21.235 25-29 22.15 28.64 27.93 21.279999999999998 30-34 21.715 28.549999999999997 27.875 21.86 35-39 23.015 27.99 27.985 21.01 40-44 22.195 27.82 28.18 21.805 45-49 22.814999999999998 27.445000000000004 27.98 21.759999999999998 50-54 23.27 27.77 27.589999999999996 21.37 55-59 23.32 27.245 28.389999999999997 21.044999999999998 60-64 22.759999999999998 27.200000000000003 28.455000000000002 21.584999999999997 65-69 23.455000000000002 27.639999999999997 27.279999999999998 21.625 70-74 23.265 27.815 28.005000000000003 20.915 75-79 22.75 28.485 27.279999999999998 21.485000000000003 80-84 23.365 28.325 27.33 20.979999999999997 85-89 23.34 27.52 27.83 21.310000000000002 90-94 23.150000000000002 27.794999999999998 27.575 21.48 95-99 23.78 28.04 27.015 21.165 100-104 23.48 27.51 27.800000000000004 21.21 105-109 23.625 27.689999999999998 27.455000000000002 21.23 110-114 24.01 27.51 27.54 20.94 115-119 23.45 28.165000000000003 27.615000000000002 20.77 120-124 23.810000000000002 28.065 27.13 20.995 125-129 24.4 27.800000000000004 27.465 20.335 130-134 25.005 28.52 26.215 20.26 135-139 24.54 28.494999999999997 26.985 19.98 140-144 25.009999999999998 28.175 26.855 19.96 145-149 26.029999999999998 28.215 26.095000000000002 19.66 150-151 25.7625 28.0625 26.6625 19.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.0 23 2.0 24 3.5 25 3.5 26 5.0 27 5.5 28 2.5 29 7.0 30 16.5 31 23.5 32 23.5 33 31.0 34 46.0 35 59.5 36 73.5 37 99.0 38 137.5 39 170.5 40 188.0 41 206.5 42 245.5 43 278.5 44 282.0 45 291.0 46 289.5 47 268.5 48 239.0 49 200.5 50 167.0 51 147.5 52 124.5 53 85.5 54 64.5 55 47.5 56 34.5 57 33.0 58 27.0 59 18.0 60 13.5 61 8.0 62 5.0 63 4.0 64 2.5 65 3.0 66 2.0 67 1.5 68 1.0 69 1.5 70 2.5 71 2.0 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29221435793731 98.2 2 0.5308392315470172 1.05 3 0.07583417593528817 0.22499999999999998 4 0.0 0.0 5 0.07583417593528817 0.375 6 0.02527805864509606 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGAAATGAGGTTCTGGGCACTTGCAGTTTTATCTTTATTGTTGTCTCTA 6 0.15 No Hit CTTCTCAGTTAGCTAATTAATTTCCGAGTTTCTTAGCAACCAGTCTACAA 5 0.125 No Hit CTCTAAACAACGTCTCTCTCGCCTCAGATCTCTAGAATGTCGAGCGTTAA 5 0.125 No Hit CTTCTCTTCATTGTTTGCTTTAGAAAAAATCATGGAAGTTCTCACATTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.9125000000000001 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.8250000000000002 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.575 0.0 0.0 0.0 0.0 128-129 4.1125 0.0 0.0 0.0 0.0 130-131 4.5625 0.0 0.0 0.0 0.0 132-133 5.074999999999999 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 6.1625 0.0 0.0 0.0 0.0 138-139 6.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCATG 10 0.006830828 145.0 6 CAAAGAT 45 0.008957279 48.333332 1 >>END_MODULE Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656655 spots for SRR6232745.sra Written 656655 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra Read 656650 spots for SRR6232745.sra Written 656650 spots for SRR6232745.sra SRR ids: ['SRR6232745.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__fzl9yny SRR6232745.sra spots: 13133005 blocks: [[1, 656650], [656651, 1313300], [1313301, 1969950], [1969951, 2626600], [2626601, 3283250], [3283251, 3939900], [3939901, 4596550], [4596551, 5253200], [5253201, 5909850], [5909851, 6566500], [6566501, 7223150], [7223151, 7879800], [7879801, 8536450], [8536451, 9193100], [9193101, 9849750], [9849751, 10506400], [10506401, 11163050], [11163051, 11819700], [11819701, 12476350], [12476351, 13133005]] SRR6232745 file size 4428644 SRR6232745 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6232745 SRR6232745_1.fastq SRR6232745_2.fastq Input file: SRR6232745_1.fastq Paired file: SRR6232745_2.fastq trimmed: SRR6232745-trimmed-pair1.fastq, SRR6232745-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:18:34 2025 >> started Wed Feb 12 09:18:48 2025 >> done (13.388s) 13133005 read pairs processed; of these: 1491 ( 0.01%) short read pairs filtered out after trimming by size control 5215 ( 0.04%) empty read pairs filtered out after trimming by size control 13126299 (99.95%) read pairs available; of these: 2205851 (16.80%) trimmed read pairs available after processing 10920448 (83.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 7 0.00% 20 0 0.00% 21 6 0.00% 22 7 0.00% 23 5 0.00% 24 4 0.00% 25 3 0.00% 26 0 0.00% 27 4 0.00% 28 4 0.00% 29 4 0.00% 30 9 0.00% 31 4 0.00% 32 3 0.00% 33 6 0.00% 34 2 0.00% 35 4 0.00% 36 5 0.00% 37 4 0.00% 38 3 0.00% 39 15 0.00% 40 8 0.00% 41 8 0.00% 42 11 0.00% 43 12 0.00% 44 19 0.00% 45 18 0.00% 46 19 0.00% 47 22 0.00% 48 26 0.00% 49 30 0.00% 50 32 0.00% 51 25 0.00% 52 39 0.00% 53 40 0.00% 54 36 0.00% 55 54 0.00% 56 47 0.00% 57 62 0.00% 58 68 0.00% 59 66 0.00% 60 103 0.00% 61 111 0.00% 62 98 0.00% 63 120 0.00% 64 127 0.00% 65 173 0.00% 66 173 0.00% 67 182 0.00% 68 201 0.00% 69 245 0.00% 70 285 0.00% 71 295 0.00% 72 340 0.00% 73 404 0.00% 74 405 0.00% 75 481 0.00% 76 497 0.00% 77 601 0.00% 78 614 0.00% 79 773 0.01% 80 772 0.01% 81 910 0.01% 82 1075 0.01% 83 1206 0.01% 84 1468 0.01% 85 1629 0.01% 86 1771 0.01% 87 2027 0.02% 88 2208 0.02% 89 2587 0.02% 90 2834 0.02% 91 3201 0.02% 92 3423 0.03% 93 3987 0.03% 94 4469 0.03% 95 4790 0.04% 96 5220 0.04% 97 5760 0.04% 98 6386 0.05% 99 6652 0.05% 100 7237 0.06% 101 7880 0.06% 102 8532 0.06% 103 9280 0.07% 104 9948 0.08% 105 10733 0.08% 106 11790 0.09% 107 12516 0.10% 108 13101 0.10% 109 14374 0.11% 110 15265 0.12% 111 15964 0.12% 112 17324 0.13% 113 18112 0.14% 114 18864 0.14% 115 20072 0.15% 116 21530 0.16% 117 22264 0.17% 118 23298 0.18% 119 24520 0.19% 120 24793 0.19% 121 26102 0.20% 122 26907 0.20% 123 28204 0.21% 124 29125 0.22% 125 30618 0.23% 126 31049 0.24% 127 32689 0.25% 128 34212 0.26% 129 35455 0.27% 130 36171 0.28% 131 36486 0.28% 132 37659 0.29% 133 38495 0.29% 134 39481 0.30% 135 41419 0.32% 136 42688 0.33% 137 44184 0.34% 138 45687 0.35% 139 47505 0.36% 140 48519 0.37% 141 50002 0.38% 142 52767 0.40% 143 53574 0.41% 144 56125 0.43% 145 58977 0.45% 146 62382 0.48% 147 68951 0.53% 148 78149 0.60% 149 100517 0.77% 150 495010 3.77% 151 10920448 83.20% 13126299 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=31 prefix-density=0.17 prefix-fanout=2.6 sequence=GCCTCAAACTTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=406.01 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=37.8 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=31 prefix-density=0.24 prefix-fanout=2.5 sequence=GATGAAGTCTACATTGTTGGTGTGGTTCTCCTTTCTTCTCTTTGCCTTTGTTCTCTCAGTGCCATCAACAGAAGCTTATACTGAGCCGGTGCTTGACATTCAGGGCGAAGAACTTAAAGCAGGCACGGAATACATCATCAGTTCTATTTTCTGGGGAGCTAGAGGCGGGGATGTTTCTGCTACCAATAAAACTTGCCCGGATGATGTTATTAAATACTCCTCGGACAGGTTACAAGGTCTTCCAGTTACCTTCTCACCTGCCAGCTCCGAAGATGATGTCATCCGAGTTTCTACTGATCTTAACATCAAGTTTTCTATTAAGAAAGCCTGTGACCACTCATCAGTCTGGAAGATTCAGAAATCTTCCAACTCAGAGGTACAATGGTTTGTGACAACGGGTGGGGAAGAAGGAAATCCTGGTATTGATACATTAACCAACTGGTTCAAGATTGAGAAGGCTGGCATAGGGTACAAGCTAGTTTCCTGTCCTGAAGACATTTGTCACTGCGGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=107.28 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=14.0 sequence=CCTCTCTCTCTTTGCATATCAATATCAAAACTCCCTTCAGGAGTAGCGAAAATGAGAAGCAATATTCTA SRR6232745 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:19:33 Started mapping on | Feb 12 09:19:33 Finished on | Feb 12 09:21:52 Mapping speed, Million of reads per hour | 339.96 Number of input reads | 13126299 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11888702 Uniquely mapped reads % | 90.57% Average mapped length | 295.45 Number of splices: Total | 11204746 Number of splices: Annotated (sjdb) | 10969080 Number of splices: GT/AG | 10971117 Number of splices: GC/AG | 183566 Number of splices: AT/AC | 9726 Number of splices: Non-canonical | 40337 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.03% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 522728 % of reads mapped to multiple loci | 3.98% Number of reads mapped to too many loci | 180265 % of reads mapped to too many loci | 1.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.84% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 716941 716941 716941 N_multimapping 522728 522728 522728 N_noFeature 424723 11754682 498042 N_ambiguous 151068 1717 88934 UnstrandedReadsAssigned:11312911 PositiveStrandReadsAssigned:132303 NegativeStrandReadsAssigned:11301726 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6232745 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6232745-trimmed-pair1.fastq SRR6232745-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,126,299 reads, 11,582,317 reads pseudoaligned [quant] estimated average fragment length: 245.535 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR6232745.ke.tsv 34699 SRR6232745.se.tsv 87100 total ==> SRR6232745.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.46 289 13.5052 Potri.005G024800.1.v4.1 1035 790.465 35 3.66955 Potri.004G059700.1.v4.1 961 716.518 22 2.54462 Potri.007G009000.2.v4.1 1416 1171.46 0 0 Potri.003G141000.2.v4.1 2943 2698.46 283 8.69154 Potri.016G087400.1.v4.1 270 83.5157 848 841.501 Potri.015G069301.1.v4.1 564 326.36 0 0 Potri.010G195200.1.v4.1 1773 1528.46 6 0.325329 Potri.012G127500.1.v4.1 977 732.499 2054 232.392 ==> SRR6232745.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 454 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 174 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 0 SRR6232745 completed mapping pipeline successfully