Starting /dee2/code/volunteer_pipeline.sh SRR6232746 current disk space = 3049587638272 free memory = 1581341264 SRR6232746 SRAfilesize 8ec8e4d3c1c92aaf4f4a922ab60f4ae8 SRR6232746.sra SRR6232746.sra file validated SRR6232746 is paired end SRR6232746 is conventional basespace SRR6232746 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232746_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.51925 35.0 35.0 35.0 35.0 35.0 2 34.7095 35.0 35.0 35.0 35.0 35.0 3 34.73775 35.0 35.0 35.0 35.0 35.0 4 34.751 35.0 35.0 35.0 35.0 35.0 5 34.81075 35.0 35.0 35.0 35.0 35.0 6 39.631 40.0 40.0 40.0 39.0 40.0 7 39.626 40.0 40.0 40.0 39.0 40.0 8 39.63825 40.0 40.0 40.0 39.0 40.0 9 39.65625 40.0 40.0 40.0 40.0 40.0 10-14 39.6073 40.0 40.0 40.0 39.0 40.0 15-19 39.640299999999996 40.0 40.0 40.0 39.6 40.0 20-24 39.61559999999999 40.0 40.0 40.0 39.2 40.0 25-29 39.6053 40.0 40.0 40.0 39.2 40.0 30-34 39.59285 40.0 40.0 40.0 39.0 40.0 35-39 39.54625 40.0 40.0 40.0 39.0 40.0 40-44 39.54875 40.0 40.0 40.0 39.0 40.0 45-49 39.53725 40.0 40.0 40.0 39.0 40.0 50-54 39.48555 40.0 40.0 40.0 39.0 40.0 55-59 39.5163 40.0 40.0 40.0 39.0 40.0 60-64 39.4599 40.0 40.0 40.0 39.0 40.0 65-69 39.38125 40.0 40.0 40.0 39.0 40.0 70-74 39.4314 40.0 40.0 40.0 39.0 40.0 75-79 39.38440000000001 40.0 40.0 40.0 39.0 40.0 80-84 39.4027 40.0 40.0 40.0 39.0 40.0 85-89 39.34525 40.0 40.0 40.0 39.0 40.0 90-94 39.3166 40.0 40.0 40.0 39.0 40.0 95-99 39.259249999999994 40.0 40.0 40.0 39.0 40.0 100-104 38.8108 39.8 39.2 39.8 38.0 40.0 105-109 39.2969 40.0 40.0 40.0 39.0 40.0 110-114 39.2613 40.0 40.0 40.0 39.0 40.0 115-119 39.285700000000006 40.0 40.0 40.0 39.0 40.0 120-124 39.18594999999999 40.0 40.0 40.0 39.0 40.0 125-129 39.1687 40.0 40.0 40.0 39.0 40.0 130-134 39.06535000000001 40.0 40.0 40.0 38.4 40.0 135-139 39.0415 40.0 40.0 40.0 38.2 40.0 140-144 38.94494999999999 40.0 39.8 40.0 38.0 40.0 145-149 38.78005 40.0 39.0 40.0 37.8 40.0 150-151 36.98375 39.5 37.0 39.5 32.5 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 6.0 24 2.0 25 2.0 26 5.0 27 7.0 28 11.0 29 9.0 30 17.0 31 22.0 32 18.0 33 32.0 34 32.0 35 43.0 36 52.0 37 83.0 38 199.0 39 3455.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.653040625788545 10.673732021196065 9.21019429724956 55.463033055765834 2 18.725 15.375 42.475 23.425 3 18.6 20.0 26.450000000000003 34.949999999999996 4 23.325000000000003 28.325 21.349999999999998 27.0 5 22.95 34.150000000000006 24.725 18.175 6 17.275 35.099999999999994 26.450000000000003 21.175 7 13.275 25.025 43.3 18.4 8 16.525000000000002 23.95 34.4 25.124999999999996 9 17.075000000000003 22.875 34.4 25.650000000000002 10-14 19.275000000000002 29.509999999999998 27.060000000000002 24.154999999999998 15-19 19.56 28.375 27.76 24.305 20-24 19.665 28.825 27.625 23.885 25-29 19.509999999999998 28.315 27.815 24.36 30-34 19.975 28.689999999999998 27.474999999999998 23.86 35-39 20.349999999999998 28.055000000000003 27.500000000000004 24.095 40-44 20.41 29.075 27.01 23.505000000000003 45-49 20.395 28.4 27.495000000000005 23.71 50-54 20.43 28.43 27.505000000000003 23.635 55-59 20.294999999999998 28.720000000000002 27.224999999999998 23.76 60-64 20.36 28.050000000000004 27.54 24.05 65-69 20.29304395659349 28.074211131669752 27.684152622893432 23.948592288843326 70-74 20.60809121368205 28.664299644946745 27.524128619292892 23.203480522078312 75-79 19.800890489769372 28.29556255940767 27.610185602081145 24.293361348741808 80-84 20.580145036259065 28.182045511377847 27.581895473868467 23.655913978494624 85-89 19.880964289286787 28.653596078823647 27.643292987896366 23.822146643993197 90-94 20.829373217948078 27.817517883047373 27.157220749337203 24.19588814966735 95-99 20.76849952469105 27.507880122079353 27.497873617851603 24.225746735377996 100-104 20.878351340536213 28.11624649859944 27.44097639055622 23.564425770308123 105-109 20.681204361308392 28.258477543262977 27.678303491047313 23.382014604381315 110-114 21.001300390117038 28.20846253876163 27.31819545863759 23.472041612483746 115-119 21.583633453381353 27.681072428971586 27.66606642657063 23.06922769107643 120-124 20.959191838367673 27.500500100020002 27.440488097619525 24.0998199639928 125-129 21.47822173325999 27.2890933640046 27.634145121768267 23.598539780967144 130-134 21.68325248787318 27.759163874581187 27.33910086512977 23.218482772415864 135-139 21.30606530326516 27.801390069503473 27.02135106755338 23.871193559677984 140-144 21.785 27.88 26.724999999999998 23.61 145-149 22.025 27.915 26.31 23.75 150-151 21.712500000000002 26.987499999999997 26.637499999999996 24.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 2.0 26 3.5 27 5.5 28 8.5 29 12.5 30 18.5 31 20.5 32 21.5 33 33.0 34 53.0 35 59.5 36 75.0 37 109.0 38 135.5 39 159.5 40 190.0 41 226.5 42 259.5 43 263.5 44 267.0 45 276.5 46 271.0 47 253.0 48 248.0 49 211.5 50 164.0 51 143.5 52 108.0 53 86.5 54 72.0 55 57.5 56 44.0 57 35.5 58 28.0 59 21.0 60 17.5 61 12.5 62 6.5 63 3.5 64 2.0 65 2.5 66 2.0 67 1.0 68 1.0 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.015 70-74 0.015 75-79 0.055 80-84 0.025 85-89 0.03 90-94 0.045 95-99 0.065 100-104 0.04 105-109 0.03 110-114 0.03 115-119 0.04 120-124 0.02 125-129 0.015 130-134 0.015 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85670731707317 97.275 2 0.8384146341463415 1.6500000000000001 3 0.20325203252032523 0.6 4 0.05081300813008131 0.2 5 0.025406504065040653 0.125 6 0.025406504065040653 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGAATTTCTTCCAATTCCAAGCTCCTGTGAAAGCAACAGCAAGCGGCAC 6 0.15 No Hit CCGCAATGTCAACATAAGGCGTTTCAGCATCAGGTGTGAAGAGACCAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.4625 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 3.2874999999999996 0.0 0.0 0.0 0.0 124-125 3.8375000000000004 0.0 0.0 0.0 0.0 126-127 4.3 0.0 0.0 0.0 0.0 128-129 4.8 0.0 0.0 0.0 0.0 130-131 5.525 0.0 0.0 0.0 0.0 132-133 6.0125 0.0 0.0 0.0 0.0 134-135 6.512499999999999 0.0 0.0 0.0 0.0 136-137 7.2375 0.0 0.0 0.0 0.0 138-139 7.8500000000000005 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCATC 20 3.410428E-4 110.11709 1 >>END_MODULE SRR6232746 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232746_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.486 35.0 35.0 35.0 34.0 35.0 2 34.601 35.0 35.0 35.0 35.0 35.0 3 34.52175 35.0 35.0 35.0 35.0 35.0 4 34.56875 35.0 35.0 35.0 35.0 35.0 5 34.64225 35.0 35.0 35.0 35.0 35.0 6 39.42575 40.0 40.0 40.0 39.0 40.0 7 39.454 40.0 40.0 40.0 39.0 40.0 8 39.458 40.0 40.0 40.0 39.0 40.0 9 39.38675 40.0 40.0 40.0 39.0 40.0 10-14 39.4504 40.0 40.0 40.0 39.0 40.0 15-19 39.42385 40.0 40.0 40.0 39.0 40.0 20-24 39.45215 40.0 40.0 40.0 39.0 40.0 25-29 39.4074 40.0 40.0 40.0 39.0 40.0 30-34 39.394999999999996 40.0 40.0 40.0 39.0 40.0 35-39 39.363299999999995 40.0 40.0 40.0 39.0 40.0 40-44 39.313900000000004 40.0 40.0 40.0 39.0 40.0 45-49 39.2838 40.0 40.0 40.0 39.0 40.0 50-54 39.2666 40.0 40.0 40.0 39.0 40.0 55-59 39.2376 40.0 40.0 40.0 39.0 40.0 60-64 39.183749999999996 40.0 40.0 40.0 39.0 40.0 65-69 39.18055 40.0 40.0 40.0 39.0 40.0 70-74 39.163399999999996 40.0 40.0 40.0 39.0 40.0 75-79 39.141549999999995 40.0 40.0 40.0 39.0 40.0 80-84 39.127449999999996 40.0 40.0 40.0 39.0 40.0 85-89 39.0721 40.0 40.0 40.0 38.6 40.0 90-94 38.94375 40.0 40.0 40.0 38.2 40.0 95-99 38.968450000000004 40.0 40.0 40.0 38.2 40.0 100-104 38.5005 39.6 39.0 39.8 37.2 40.0 105-109 38.96294999999999 40.0 39.8 40.0 38.2 40.0 110-114 38.93105 40.0 40.0 40.0 38.0 40.0 115-119 38.81945 40.0 39.0 40.0 38.0 40.0 120-124 38.729000000000006 40.0 39.0 40.0 37.8 40.0 125-129 38.6275 40.0 39.0 40.0 37.0 40.0 130-134 38.498200000000004 40.0 39.0 40.0 36.6 40.0 135-139 38.15415 40.0 39.0 40.0 36.0 40.0 140-144 38.008950000000006 40.0 39.0 40.0 35.8 40.0 145-149 37.520999999999994 39.6 38.8 40.0 34.6 40.0 150-151 34.735749999999996 38.0 35.0 39.5 25.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 0.0 12 1.0 13 4.0 14 0.0 15 2.0 16 2.0 17 2.0 18 1.0 19 1.0 20 3.0 21 3.0 22 6.0 23 8.0 24 8.0 25 12.0 26 10.0 27 10.0 28 14.0 29 8.0 30 17.0 31 24.0 32 20.0 33 34.0 34 39.0 35 62.0 36 79.0 37 129.0 38 290.0 39 3209.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.975 18.099999999999998 14.249999999999998 42.675000000000004 2 21.725 26.200000000000003 38.675 13.4 3 18.85 27.125 31.225 22.8 4 22.275 33.050000000000004 23.9 20.775 5 24.9 36.9 22.725 15.475 6 18.675 38.224999999999994 24.3 18.8 7 18.8 18.725 41.9 20.575 8 18.9 22.8 31.5 26.8 9 20.25 23.025000000000002 31.85 24.875 10-14 22.825 28.810000000000002 25.86 22.505 15-19 23.105 27.99 27.18 21.725 20-24 22.695 28.23 27.889999999999997 21.185000000000002 25-29 22.595000000000002 28.395 27.700000000000003 21.310000000000002 30-34 22.720000000000002 28.24 27.515 21.525 35-39 23.47 28.405 26.895000000000003 21.23 40-44 22.855 27.985 27.605 21.555 45-49 23.05 27.85 27.92 21.18 50-54 23.415 27.72 27.939999999999998 20.925 55-59 24.15 26.93 27.97 20.95 60-64 23.169999999999998 28.15 27.189999999999998 21.490000000000002 65-69 23.974999999999998 27.894999999999996 27.355 20.775 70-74 23.76 27.43 27.884999999999998 20.925 75-79 23.995 27.37 27.195000000000004 21.44 80-84 23.935000000000002 27.525 27.779999999999998 20.76 85-89 23.64 27.950000000000003 27.33 21.08 90-94 23.48 28.389999999999997 26.955000000000002 21.175 95-99 23.919999999999998 28.325 26.875 20.880000000000003 100-104 23.645 28.125 27.715 20.515 105-109 23.215 28.24 27.38 21.165 110-114 23.79 28.144999999999996 27.35 20.715 115-119 24.41 27.87 27.295 20.424999999999997 120-124 24.224999999999998 27.935 27.015 20.825 125-129 24.29 27.544999999999998 27.48 20.685000000000002 130-134 24.46 28.04 27.42 20.080000000000002 135-139 25.055 28.325 26.56 20.06 140-144 24.57 28.15 27.0 20.28 145-149 26.075 27.544999999999998 26.415 19.965 150-151 25.25 27.737499999999997 27.5875 19.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 0.5 24 0.5 25 1.5 26 2.0 27 2.0 28 1.5 29 5.0 30 11.0 31 11.5 32 16.5 33 27.5 34 39.0 35 50.0 36 69.5 37 93.5 38 136.0 39 183.0 40 201.0 41 220.0 42 251.0 43 272.5 44 275.5 45 281.5 46 287.0 47 268.5 48 233.5 49 208.5 50 178.5 51 154.0 52 131.5 53 88.5 54 67.0 55 59.0 56 42.5 57 32.5 58 28.0 59 23.0 60 16.5 61 8.5 62 4.0 63 2.5 64 3.0 65 2.0 66 1.0 67 1.0 68 0.0 69 0.0 70 0.5 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.95991882293252 97.52499999999999 2 0.7864028411973617 1.55 3 0.15220700152207 0.44999999999999996 4 0.050735667174023336 0.2 5 0.025367833587011668 0.125 6 0.025367833587011668 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTAAACAACGTCTCTCTCGCCTCAGATCTCTAGAATGTCGAGCGTTAA 6 0.15 No Hit CTCTAAACAACGTCTCTCTCGCCTCGGATTTCTAGAATGTCGAGCGTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.0999999999999996 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.7750000000000004 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.8125 0.0 0.0 0.0 0.0 126-127 4.275 0.0 0.0 0.0 0.0 128-129 4.775 0.0 0.0 0.0 0.0 130-131 5.5 0.0 0.0 0.0 0.0 132-133 6.0 0.0 0.0 0.0 0.0 134-135 6.512499999999999 0.0 0.0 0.0 0.0 136-137 7.2375 0.0 0.0 0.0 0.0 138-139 7.8500000000000005 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCAGC 10 0.006830828 145.0 9 TGTGCAG 10 0.006830828 145.0 8 >>END_MODULE Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581018 spots for SRR6232746.sra Written 581018 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra Read 581014 spots for SRR6232746.sra Written 581014 spots for SRR6232746.sra SRR ids: ['SRR6232746.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3r_l2n8y SRR6232746.sra spots: 11620284 blocks: [[1, 581014], [581015, 1162028], [1162029, 1743042], [1743043, 2324056], [2324057, 2905070], [2905071, 3486084], [3486085, 4067098], [4067099, 4648112], [4648113, 5229126], [5229127, 5810140], [5810141, 6391154], [6391155, 6972168], [6972169, 7553182], [7553183, 8134196], [8134197, 8715210], [8715211, 9296224], [9296225, 9877238], [9877239, 10458252], [10458253, 11039266], [11039267, 11620284]] SRR6232746 file size 3916032 SRR6232746 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6232746 SRR6232746_1.fastq SRR6232746_2.fastq Input file: SRR6232746_1.fastq Paired file: SRR6232746_2.fastq trimmed: SRR6232746-trimmed-pair1.fastq, SRR6232746-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 08:42:37 2025 >> started Wed Feb 12 08:42:49 2025 >> done (12.105s) 11620284 read pairs processed; of these: 1333 ( 0.01%) short read pairs filtered out after trimming by size control 4763 ( 0.04%) empty read pairs filtered out after trimming by size control 11614188 (99.95%) read pairs available; of these: 2062586 (17.76%) trimmed read pairs available after processing 9551602 (82.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 5 0.00% 24 3 0.00% 25 4 0.00% 26 2 0.00% 27 6 0.00% 28 3 0.00% 29 4 0.00% 30 6 0.00% 31 2 0.00% 32 2 0.00% 33 6 0.00% 34 4 0.00% 35 6 0.00% 36 4 0.00% 37 6 0.00% 38 4 0.00% 39 6 0.00% 40 4 0.00% 41 11 0.00% 42 9 0.00% 43 14 0.00% 44 11 0.00% 45 12 0.00% 46 15 0.00% 47 18 0.00% 48 24 0.00% 49 15 0.00% 50 27 0.00% 51 29 0.00% 52 28 0.00% 53 31 0.00% 54 33 0.00% 55 51 0.00% 56 46 0.00% 57 51 0.00% 58 59 0.00% 59 78 0.00% 60 51 0.00% 61 112 0.00% 62 91 0.00% 63 110 0.00% 64 106 0.00% 65 115 0.00% 66 132 0.00% 67 156 0.00% 68 164 0.00% 69 170 0.00% 70 258 0.00% 71 232 0.00% 72 303 0.00% 73 333 0.00% 74 356 0.00% 75 415 0.00% 76 462 0.00% 77 506 0.00% 78 552 0.00% 79 671 0.01% 80 717 0.01% 81 809 0.01% 82 963 0.01% 83 1113 0.01% 84 1215 0.01% 85 1515 0.01% 86 1618 0.01% 87 1880 0.02% 88 2104 0.02% 89 2270 0.02% 90 2426 0.02% 91 2809 0.02% 92 3293 0.03% 93 3649 0.03% 94 4139 0.04% 95 4553 0.04% 96 4991 0.04% 97 5567 0.05% 98 5890 0.05% 99 6026 0.05% 100 6837 0.06% 101 7519 0.06% 102 8050 0.07% 103 8889 0.08% 104 9533 0.08% 105 10705 0.09% 106 11668 0.10% 107 12638 0.11% 108 13182 0.11% 109 14552 0.13% 110 14867 0.13% 111 15496 0.13% 112 16877 0.15% 113 17949 0.15% 114 18316 0.16% 115 19592 0.17% 116 21236 0.18% 117 22567 0.19% 118 23315 0.20% 119 24356 0.21% 120 24946 0.21% 121 25895 0.22% 122 26869 0.23% 123 27202 0.23% 124 28667 0.25% 125 30149 0.26% 126 31133 0.27% 127 33508 0.29% 128 34289 0.30% 129 35639 0.31% 130 35727 0.31% 131 36237 0.31% 132 36133 0.31% 133 37651 0.32% 134 38665 0.33% 135 40180 0.35% 136 41689 0.36% 137 42889 0.37% 138 44477 0.38% 139 46292 0.40% 140 47053 0.41% 141 47947 0.41% 142 49361 0.43% 143 50751 0.44% 144 52640 0.45% 145 54928 0.47% 146 58668 0.51% 147 63750 0.55% 148 72184 0.62% 149 90438 0.78% 150 414991 3.57% 151 9551602 82.24% 11614188 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=30 prefix-density=0.60 prefix-fanout=2.2 sequence=AACGAGCATTAAGTGTCCCAATGTGGAACCTTCTCCCCGCAATGTCAACATAAGGCGTTTCAGCATCAGGTGTGAAGAGACCAGAGTCTTGAAGGGCCTTTTCGTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=67.39 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=8.8 sequence=CCATCTCCTCCATCACACTGGCTCTGACAACCATCACCGCAATAATCAACCGTTGTCCCACACCAACC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=24 prefix-density=0.91 prefix-fanout=2.1 sequence=TGGTAGTGATGGTGGTTGGGCTGCTGGTTTTGGCTCAGCAGTCCTTCCAAATGAGTTTGAGAAACCCTGTTGCTGAGACAAACAATTGCAAAATTGATTTCACTCGTTTAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=86.97 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.9 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR6232746 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 08:43:33 Started mapping on | Feb 12 08:43:34 Finished on | Feb 12 08:45:42 Mapping speed, Million of reads per hour | 326.65 Number of input reads | 11614188 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10605308 Uniquely mapped reads % | 91.31% Average mapped length | 295.23 Number of splices: Total | 10101040 Number of splices: Annotated (sjdb) | 9932740 Number of splices: GT/AG | 9910872 Number of splices: GC/AG | 153983 Number of splices: AT/AC | 7354 Number of splices: Non-canonical | 28831 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 644676 % of reads mapped to multiple loci | 5.55% Number of reads mapped to too many loci | 61700 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.50% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 365820 365820 365820 N_multimapping 644676 644676 644676 N_noFeature 232461 10505471 277669 N_ambiguous 117162 461 62262 UnstrandedReadsAssigned:10255685 PositiveStrandReadsAssigned:99376 NegativeStrandReadsAssigned:10265377 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6232746 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6232746-trimmed-pair1.fastq SRR6232746-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,614,188 reads, 10,557,407 reads pseudoaligned [quant] estimated average fragment length: 237.649 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,018 rounds 52401 SRR6232746.ke.tsv 34699 SRR6232746.se.tsv 87100 total ==> SRR6232746.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.35 171 8.07552 Potri.005G024800.1.v4.1 1035 798.351 43 4.53105 Potri.004G059700.1.v4.1 961 724.393 16 1.8581 Potri.007G009000.2.v4.1 1416 1179.35 1 0.0713314 Potri.003G141000.2.v4.1 2943 2706.35 152 4.7248 Potri.016G087400.1.v4.1 270 85.5907 802 788.264 Potri.015G069301.1.v4.1 564 332.855 0 0 Potri.010G195200.1.v4.1 1773 1536.35 3 0.164269 Potri.012G127500.1.v4.1 977 740.383 878 99.7614 ==> SRR6232746.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 145 Potri.001G212900.v4.1 823 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR6232746 completed mapping pipeline successfully