Starting /dee2/code/volunteer_pipeline.sh SRR6232767 current disk space = 3049652912128 free memory = 1581117324 SRR6232767 SRAfilesize 281b03e9e05209178cbaa3242384e2f9 SRR6232767.sra SRR6232767.sra file validated SRR6232767 is paired end SRR6232767 is conventional basespace SRR6232767 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232767_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.62825 35.0 35.0 35.0 35.0 35.0 2 34.76525 35.0 35.0 35.0 35.0 35.0 3 34.77325 35.0 35.0 35.0 35.0 35.0 4 34.8175 35.0 35.0 35.0 35.0 35.0 5 34.811 35.0 35.0 35.0 35.0 35.0 6 39.616 40.0 40.0 40.0 39.0 40.0 7 39.665 40.0 40.0 40.0 39.0 40.0 8 39.64125 40.0 40.0 40.0 39.0 40.0 9 39.67825 40.0 40.0 40.0 39.0 40.0 10-14 39.654700000000005 40.0 40.0 40.0 39.2 40.0 15-19 39.687400000000004 40.0 40.0 40.0 39.2 40.0 20-24 39.6728 40.0 40.0 40.0 39.2 40.0 25-29 39.636 40.0 40.0 40.0 39.0 40.0 30-34 39.652100000000004 40.0 40.0 40.0 39.0 40.0 35-39 39.598349999999996 40.0 40.0 40.0 39.0 40.0 40-44 39.6057 40.0 40.0 40.0 39.0 40.0 45-49 39.598349999999996 40.0 40.0 40.0 39.0 40.0 50-54 39.556349999999995 40.0 40.0 40.0 39.0 40.0 55-59 39.58085 40.0 40.0 40.0 39.0 40.0 60-64 39.498599999999996 40.0 40.0 40.0 39.0 40.0 65-69 39.4676 40.0 40.0 40.0 39.0 40.0 70-74 39.488600000000005 40.0 40.0 40.0 39.0 40.0 75-79 39.443200000000004 40.0 40.0 40.0 39.0 40.0 80-84 39.45555 40.0 40.0 40.0 39.0 40.0 85-89 39.37795 40.0 40.0 40.0 39.0 40.0 90-94 39.3663 40.0 40.0 40.0 39.0 40.0 95-99 39.36125 40.0 40.0 40.0 39.0 40.0 100-104 38.88825 39.8 39.2 39.8 38.2 40.0 105-109 39.336149999999996 40.0 40.0 40.0 39.0 40.0 110-114 39.306650000000005 40.0 40.0 40.0 39.0 40.0 115-119 39.2886 40.0 40.0 40.0 39.0 40.0 120-124 39.253949999999996 40.0 40.0 40.0 39.0 40.0 125-129 39.166199999999996 40.0 40.0 40.0 39.0 40.0 130-134 39.100049999999996 40.0 40.0 40.0 38.6 40.0 135-139 39.00385 40.0 40.0 40.0 38.0 40.0 140-144 38.92775 40.0 39.6 40.0 38.0 40.0 145-149 38.74185 40.0 39.0 40.0 37.8 40.0 150-151 36.838875 39.0 36.5 39.5 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 3.0 20 1.0 21 0.0 22 2.0 23 1.0 24 1.0 25 2.0 26 2.0 27 3.0 28 10.0 29 5.0 30 10.0 31 17.0 32 17.0 33 28.0 34 37.0 35 54.0 36 70.0 37 101.0 38 215.0 39 3421.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.504400301734975 10.9630374654262 9.278350515463918 57.2542117173749 2 17.825 17.75 42.075 22.35 3 20.275000000000002 20.175 25.525 34.025 4 22.375 29.975 20.575 27.075 5 21.224999999999998 36.075 25.674999999999997 17.025000000000002 6 17.8 34.575 27.55 20.075000000000003 7 13.350000000000001 23.599999999999998 43.675000000000004 19.375 8 15.85 23.325000000000003 35.225 25.6 9 16.150000000000002 23.1 36.7 24.05 10-14 19.075 30.115 26.56 24.25 15-19 19.585 28.4 27.595 24.42 20-24 19.950000000000003 28.115000000000002 27.555000000000003 24.38 25-29 19.794999999999998 28.349999999999998 27.96 23.895 30-34 19.895 28.544999999999998 27.46 24.099999999999998 35-39 20.235 28.4 27.950000000000003 23.415 40-44 20.115 28.76 27.455000000000002 23.669999999999998 45-49 19.595000000000002 28.525 27.985 23.895 50-54 19.775000000000002 28.199999999999996 27.825 24.2 55-59 20.27 28.335 27.93 23.465 60-64 19.900000000000002 28.27 27.73 24.099999999999998 65-69 19.60392078415683 28.100620124024804 28.065613122624526 24.22984596919384 70-74 20.389077815563112 28.540708141628322 27.595519103820763 23.4746949389878 75-79 19.50255229706736 28.240416374737265 27.67490741667501 24.582123911520366 80-84 20.427149502325815 28.52498374431051 27.259540839293756 23.788325914069926 85-89 19.998999299509656 28.65005503852697 27.60932652857 23.741619133393375 90-94 20.40734624430766 28.25902016714207 27.5434119001151 23.79022168843517 95-99 20.77473599919924 27.88148741304239 27.41104048846404 23.93273609929433 100-104 20.84959471630141 28.45491844291004 27.154007805463827 23.541479035324727 105-109 20.0620372223334 28.652191314788872 27.451470882529517 23.83430058034821 110-114 20.63134724098254 28.300565310921005 27.440092050627847 23.627995397468606 115-119 20.61546159619715 28.516387290467847 27.335501626219667 23.532649487115336 120-124 20.191105107809296 28.365601080594327 27.615188353594476 23.8281054580019 125-129 21.278511404561826 28.011204481792717 26.95578231292517 23.754501800720288 130-134 21.329598319243658 28.007603421539695 27.582412085438445 23.0803861737782 135-139 21.363204480672103 27.40911136670501 27.184077611641744 24.04360654098115 140-144 21.05 28.4 26.72 23.830000000000002 145-149 20.51 28.305000000000003 27.169999999999998 24.015 150-151 20.775 28.537499999999998 27.35 23.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 2.5 25 3.0 26 6.0 27 6.0 28 5.5 29 13.5 30 19.5 31 29.0 32 40.5 33 51.5 34 62.0 35 69.0 36 88.0 37 110.0 38 127.5 39 144.0 40 190.0 41 244.0 42 242.0 43 249.0 44 265.0 45 258.5 46 270.5 47 262.0 48 230.0 49 203.5 50 155.5 51 123.5 52 108.5 53 81.5 54 73.0 55 64.0 56 46.0 57 37.0 58 29.0 59 18.5 60 19.5 61 19.0 62 10.5 63 5.5 64 3.5 65 1.5 66 1.0 67 1.0 68 1.0 69 1.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.02 70-74 0.02 75-79 0.09 80-84 0.034999999999999996 85-89 0.06999999999999999 90-94 0.08499999999999999 95-99 0.095 100-104 0.06999999999999999 105-109 0.06 110-114 0.055 115-119 0.075 120-124 0.055 125-129 0.04 130-134 0.045 135-139 0.015 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.243761028485 98.425 2 0.6806150743634989 1.35 3 0.07562389715149988 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.1375 0.0 0.0 0.0 0.0 116-117 2.4 0.0 0.0 0.0 0.0 118-119 2.7125000000000004 0.0 0.0 0.0 0.0 120-121 3.2125000000000004 0.0 0.0 0.0 0.0 122-123 3.6125 0.0 0.0 0.0 0.0 124-125 4.0875 0.0 0.0 0.0 0.0 126-127 4.3875 0.0 0.0 0.0 0.0 128-129 4.800000000000001 0.0 0.0 0.0 0.0 130-131 5.2875 0.0 0.0 0.0 0.0 132-133 5.737500000000001 0.0 0.0 0.0 0.0 134-135 6.1375 0.0 0.0 0.0 0.0 136-137 6.7125 0.0 0.0 0.0 0.0 138-139 7.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGAAAA 10 0.006960991 144.0875 8 GTAGAAA 10 0.006960991 144.0875 7 CAGCAGT 10 0.006960991 144.0875 3 CAACCAT 10 0.006960991 144.0875 9 TCAGTCA 10 0.006960991 144.0875 8 CTCATAT 10 0.006960991 144.0875 8 >>END_MODULE SRR6232767 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232767_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.5735 35.0 35.0 35.0 34.0 35.0 2 34.60275 35.0 35.0 35.0 35.0 35.0 3 34.53975 35.0 35.0 35.0 34.0 35.0 4 34.56 35.0 35.0 35.0 34.0 35.0 5 34.63575 35.0 35.0 35.0 35.0 35.0 6 39.50975 40.0 40.0 40.0 39.0 40.0 7 39.53475 40.0 40.0 40.0 39.0 40.0 8 39.5185 40.0 40.0 40.0 39.0 40.0 9 39.491 40.0 40.0 40.0 39.0 40.0 10-14 39.498349999999995 40.0 40.0 40.0 39.0 40.0 15-19 39.495999999999995 40.0 40.0 40.0 39.0 40.0 20-24 39.4996 40.0 40.0 40.0 39.0 40.0 25-29 39.491400000000006 40.0 40.0 40.0 39.0 40.0 30-34 39.49175 40.0 40.0 40.0 39.0 40.0 35-39 39.46215 40.0 40.0 40.0 39.0 40.0 40-44 39.35695 40.0 40.0 40.0 39.0 40.0 45-49 39.3811 40.0 40.0 40.0 39.0 40.0 50-54 39.390550000000005 40.0 40.0 40.0 39.0 40.0 55-59 39.364 40.0 40.0 40.0 39.0 40.0 60-64 39.297399999999996 40.0 40.0 40.0 39.0 40.0 65-69 39.27865 40.0 40.0 40.0 39.0 40.0 70-74 39.26855 40.0 40.0 40.0 39.0 40.0 75-79 39.2579 40.0 40.0 40.0 39.0 40.0 80-84 39.22395 40.0 40.0 40.0 39.0 40.0 85-89 39.19785 40.0 40.0 40.0 39.0 40.0 90-94 39.0617 40.0 40.0 40.0 38.4 40.0 95-99 39.071600000000004 40.0 40.0 40.0 38.6 40.0 100-104 38.6567 39.6 39.2 39.8 37.2 40.0 105-109 39.0098 40.0 40.0 40.0 38.8 40.0 110-114 39.00865 40.0 40.0 40.0 38.4 40.0 115-119 38.930499999999995 40.0 39.6 40.0 38.0 40.0 120-124 38.90145 40.0 39.0 40.0 38.0 40.0 125-129 38.7748 40.0 39.0 40.0 37.8 40.0 130-134 38.637350000000005 40.0 39.0 40.0 37.0 40.0 135-139 38.35825 40.0 39.0 40.0 36.0 40.0 140-144 38.20265 40.0 39.0 40.0 36.0 40.0 145-149 37.676550000000006 39.8 39.0 40.0 34.8 40.0 150-151 34.9615 38.0 35.0 39.5 25.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 3.0 22 5.0 23 4.0 24 5.0 25 7.0 26 9.0 27 15.0 28 13.0 29 9.0 30 21.0 31 17.0 32 23.0 33 31.0 34 37.0 35 66.0 36 76.0 37 138.0 38 295.0 39 3219.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.25 16.975 14.975 45.800000000000004 2 21.0 25.1 39.95 13.950000000000001 3 18.099999999999998 28.425 31.2 22.275 4 20.674999999999997 33.800000000000004 25.1 20.424999999999997 5 24.2 36.65 23.45 15.7 6 18.3 38.95 23.474999999999998 19.275000000000002 7 17.75 18.375 43.3 20.575 8 19.950000000000003 23.1 32.5 24.45 9 22.275 22.7 31.45 23.575 10-14 22.945 29.005 26.555 21.495 15-19 22.725 28.33 27.42 21.525 20-24 22.405 28.634999999999998 27.595 21.365000000000002 25-29 22.395 28.03 27.779999999999998 21.795 30-34 22.865 27.905 27.765 21.465 35-39 22.875 28.194999999999997 27.689999999999998 21.240000000000002 40-44 22.54 28.355000000000004 27.775 21.33 45-49 22.895 28.465 27.884999999999998 20.755000000000003 50-54 22.830000000000002 28.03 27.76 21.38 55-59 23.275000000000002 27.62 28.265 20.84 60-64 23.205000000000002 27.87 27.55 21.375 65-69 23.189999999999998 27.415 28.634999999999998 20.76 70-74 23.41 27.715 27.639999999999997 21.235 75-79 23.44 27.275 28.325 20.96 80-84 23.74 27.700000000000003 27.665 20.895 85-89 23.835 28.025 27.27 20.87 90-94 22.994999999999997 27.584999999999997 28.155 21.265 95-99 23.62 27.655 27.689999999999998 21.035 100-104 23.494999999999997 28.21 27.845 20.45 105-109 23.645 27.525 27.944999999999997 20.885 110-114 23.815 28.165000000000003 27.525 20.495 115-119 24.42 27.694999999999997 27.71 20.175 120-124 24.45 27.36 27.87 20.32 125-129 24.85 27.544999999999998 27.365000000000002 20.24 130-134 25.0 27.505000000000003 27.235 20.26 135-139 25.14 28.835 26.584999999999997 19.439999999999998 140-144 25.224999999999998 28.725 26.625 19.425 145-149 25.55 28.199999999999996 26.43 19.82 150-151 26.450000000000003 28.625 26.5625 18.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 4.0 26 6.0 27 6.5 28 8.0 29 9.5 30 14.0 31 20.0 32 22.5 33 22.5 34 45.5 35 66.5 36 79.5 37 114.0 38 151.5 39 173.0 40 203.5 41 228.0 42 237.5 43 282.0 44 300.0 45 278.0 46 269.5 47 242.5 48 217.0 49 202.0 50 161.5 51 128.0 52 112.0 53 89.5 54 70.0 55 57.5 56 38.0 57 31.5 58 31.0 59 18.5 60 12.0 61 10.5 62 7.0 63 5.0 64 3.5 65 6.5 66 7.0 67 2.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34409687184662 98.45 2 0.45408678102926336 0.8999999999999999 3 0.15136226034308778 0.44999999999999996 4 0.050454086781029264 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.1375 0.0 0.0 0.0 0.0 116-117 2.4 0.0 0.0 0.0 0.0 118-119 2.7125000000000004 0.0 0.0 0.0 0.0 120-121 3.2125000000000004 0.0 0.0 0.0 0.0 122-123 3.6125 0.0 0.0 0.0 0.0 124-125 4.0625 0.0 0.0 0.0 0.0 126-127 4.3625 0.0 0.0 0.0 0.0 128-129 4.775 0.0 0.0 0.0 0.0 130-131 5.262499999999999 0.0 0.0 0.0 0.0 132-133 5.7 0.0 0.0 0.0 0.0 134-135 6.0875 0.0 0.0 0.0 0.0 136-137 6.6625 0.0 0.0 0.0 0.0 138-139 7.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAAGC 10 0.006830828 145.0 7 CTGTTTC 10 0.006830828 145.0 4 >>END_MODULE Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574114 spots for SRR6232767.sra Written 574114 spots for SRR6232767.sra Read 574116 spots for SRR6232767.sra Written 574116 spots for SRR6232767.sra SRR ids: ['SRR6232767.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8_cf6sbq SRR6232767.sra spots: 11482282 blocks: [[1, 574114], [574115, 1148228], [1148229, 1722342], [1722343, 2296456], [2296457, 2870570], [2870571, 3444684], [3444685, 4018798], [4018799, 4592912], [4592913, 5167026], [5167027, 5741140], [5741141, 6315254], [6315255, 6889368], [6889369, 7463482], [7463483, 8037596], [8037597, 8611710], [8611711, 9185824], [9185825, 9759938], [9759939, 10334052], [10334053, 10908166], [10908167, 11482282]] SRR6232767 file size 3869268 SRR6232767 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6232767 SRR6232767_1.fastq SRR6232767_2.fastq Input file: SRR6232767_1.fastq Paired file: SRR6232767_2.fastq trimmed: SRR6232767-trimmed-pair1.fastq, SRR6232767-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:10:59 2025 >> started Wed Feb 12 09:11:11 2025 >> done (12.103s) 11482282 read pairs processed; of these: 1545 ( 0.01%) short read pairs filtered out after trimming by size control 6001 ( 0.05%) empty read pairs filtered out after trimming by size control 11474736 (99.93%) read pairs available; of these: 2030118 (17.69%) trimmed read pairs available after processing 9444618 (82.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 0 0.00% 25 2 0.00% 26 4 0.00% 27 5 0.00% 28 2 0.00% 29 2 0.00% 30 6 0.00% 31 5 0.00% 32 3 0.00% 33 2 0.00% 34 9 0.00% 35 7 0.00% 36 10 0.00% 37 6 0.00% 38 10 0.00% 39 6 0.00% 40 5 0.00% 41 6 0.00% 42 11 0.00% 43 19 0.00% 44 17 0.00% 45 22 0.00% 46 22 0.00% 47 16 0.00% 48 26 0.00% 49 33 0.00% 50 43 0.00% 51 39 0.00% 52 42 0.00% 53 40 0.00% 54 41 0.00% 55 45 0.00% 56 53 0.00% 57 75 0.00% 58 89 0.00% 59 85 0.00% 60 109 0.00% 61 104 0.00% 62 124 0.00% 63 175 0.00% 64 181 0.00% 65 169 0.00% 66 214 0.00% 67 218 0.00% 68 273 0.00% 69 295 0.00% 70 349 0.00% 71 366 0.00% 72 452 0.00% 73 499 0.00% 74 553 0.00% 75 620 0.01% 76 759 0.01% 77 848 0.01% 78 875 0.01% 79 1038 0.01% 80 1183 0.01% 81 1259 0.01% 82 1473 0.01% 83 1742 0.02% 84 2018 0.02% 85 2231 0.02% 86 2424 0.02% 87 2691 0.02% 88 3114 0.03% 89 3330 0.03% 90 3607 0.03% 91 4166 0.04% 92 4615 0.04% 93 5051 0.04% 94 5675 0.05% 95 6018 0.05% 96 6634 0.06% 97 7171 0.06% 98 7787 0.07% 99 8058 0.07% 100 8660 0.08% 101 9348 0.08% 102 10305 0.09% 103 10890 0.09% 104 11813 0.10% 105 12667 0.11% 106 13413 0.12% 107 14210 0.12% 108 15232 0.13% 109 15888 0.14% 110 16497 0.14% 111 17165 0.15% 112 18557 0.16% 113 18874 0.16% 114 19760 0.17% 115 21142 0.18% 116 22143 0.19% 117 23128 0.20% 118 23895 0.21% 119 24429 0.21% 120 25265 0.22% 121 26164 0.23% 122 26126 0.23% 123 26897 0.23% 124 28218 0.25% 125 29417 0.26% 126 30044 0.26% 127 31290 0.27% 128 32392 0.28% 129 33505 0.29% 130 33735 0.29% 131 34426 0.30% 132 34703 0.30% 133 35976 0.31% 134 36860 0.32% 135 37523 0.33% 136 38979 0.34% 137 40543 0.35% 138 41549 0.36% 139 43308 0.38% 140 43694 0.38% 141 44913 0.39% 142 46298 0.40% 143 47200 0.41% 144 49057 0.43% 145 51849 0.45% 146 55080 0.48% 147 59688 0.52% 148 67213 0.59% 149 84456 0.74% 150 396446 3.45% 151 9444618 82.31% 11474736 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=7.64 fanout-score-rank=13 prefix-density=0.29 prefix-fanout=4.4 sequence=AAAGCAACAGCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=436.49 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=35.1 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=32 prefix-density=0.24 prefix-fanout=2.6 sequence=TTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAACGATCGTGAAACTGGAAGATCTCGCGGCTTTGGATTTGTTACCTTCAACAACGAGAAGGCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=168.29 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.0 sequence=AGAAAAGGAGTGAGATATTCAAGAGAAATACGTTTAGAAATCAAGAGAGAGAG SRR6232767 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:11:56 Started mapping on | Feb 12 09:11:56 Finished on | Feb 12 09:13:36 Mapping speed, Million of reads per hour | 413.09 Number of input reads | 11474736 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10637526 Uniquely mapped reads % | 92.70% Average mapped length | 294.83 Number of splices: Total | 9964237 Number of splices: Annotated (sjdb) | 9765114 Number of splices: GT/AG | 9768531 Number of splices: GC/AG | 162492 Number of splices: AT/AC | 7916 Number of splices: Non-canonical | 25298 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.03% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390596 % of reads mapped to multiple loci | 3.40% Number of reads mapped to too many loci | 83707 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.03% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 448799 448799 448799 N_multimapping 390596 390596 390596 N_noFeature 328729 10534510 378196 N_ambiguous 125194 675 71198 UnstrandedReadsAssigned:10183603 PositiveStrandReadsAssigned:102341 NegativeStrandReadsAssigned:10188132 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6232767 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6232767-trimmed-pair1.fastq SRR6232767-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,474,736 reads, 10,292,040 reads pseudoaligned [quant] estimated average fragment length: 238.88 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR6232767.ke.tsv 34699 SRR6232767.se.tsv 87100 total ==> SRR6232767.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.12 297 15.3443 Potri.005G024800.1.v4.1 1035 797.12 30 3.46129 Potri.004G059700.1.v4.1 961 723.178 19 2.41629 Potri.007G009000.2.v4.1 1416 1178.12 0 0 Potri.003G141000.2.v4.1 2943 2705.12 174.212 5.92287 Potri.016G087400.1.v4.1 270 85.7857 839 899.471 Potri.015G069301.1.v4.1 564 332.238 0 0 Potri.010G195200.1.v4.1 1773 1535.12 9 0.539188 Potri.012G127500.1.v4.1 977 739.145 1686 209.782 ==> SRR6232767.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 181 Potri.001G212900.v4.1 653 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 87 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR6232767 completed mapping pipeline successfully