Starting /dee2/code/volunteer_pipeline.sh SRR6232768 current disk space = 3049661423616 free memory = 1483507216 SRR6232768 SRAfilesize fd94a8a8aa60073e8c6c89efba958f55 SRR6232768.sra SRR6232768.sra file validated SRR6232768 is paired end SRR6232768 is conventional basespace SRR6232768 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232768_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.59675 35.0 35.0 35.0 35.0 35.0 2 34.7355 35.0 35.0 35.0 35.0 35.0 3 34.73375 35.0 35.0 35.0 35.0 35.0 4 34.75 35.0 35.0 35.0 35.0 35.0 5 34.806 35.0 35.0 35.0 35.0 35.0 6 39.61675 40.0 40.0 40.0 39.0 40.0 7 39.63525 40.0 40.0 40.0 39.0 40.0 8 39.643 40.0 40.0 40.0 39.0 40.0 9 39.6535 40.0 40.0 40.0 40.0 40.0 10-14 39.6364 40.0 40.0 40.0 39.0 40.0 15-19 39.66365 40.0 40.0 40.0 39.0 40.0 20-24 39.635650000000005 40.0 40.0 40.0 39.0 40.0 25-29 39.63835 40.0 40.0 40.0 39.0 40.0 30-34 39.62155 40.0 40.0 40.0 39.0 40.0 35-39 39.577549999999995 40.0 40.0 40.0 39.0 40.0 40-44 39.60315000000001 40.0 40.0 40.0 39.0 40.0 45-49 39.53965 40.0 40.0 40.0 39.0 40.0 50-54 39.48285 40.0 40.0 40.0 39.0 40.0 55-59 39.527 40.0 40.0 40.0 39.0 40.0 60-64 39.46145 40.0 40.0 40.0 39.0 40.0 65-69 39.4108 40.0 40.0 40.0 39.0 40.0 70-74 39.4732 40.0 40.0 40.0 39.0 40.0 75-79 39.444950000000006 40.0 40.0 40.0 39.0 40.0 80-84 39.435 40.0 40.0 40.0 39.0 40.0 85-89 39.380300000000005 40.0 40.0 40.0 39.0 40.0 90-94 39.3887 40.0 40.0 40.0 39.0 40.0 95-99 39.34735 40.0 40.0 40.0 39.0 40.0 100-104 38.93185 39.6 39.2 39.8 38.2 40.0 105-109 39.35035 40.0 40.0 40.0 39.0 40.0 110-114 39.27075 40.0 40.0 40.0 39.0 40.0 115-119 39.26755 40.0 40.0 40.0 39.0 40.0 120-124 39.22 40.0 40.0 40.0 39.0 40.0 125-129 39.195299999999996 40.0 40.0 40.0 39.0 40.0 130-134 39.1196 40.0 40.0 40.0 38.4 40.0 135-139 39.008399999999995 40.0 39.6 40.0 38.0 40.0 140-144 38.95935 40.0 39.6 40.0 38.0 40.0 145-149 38.78465 40.0 39.0 40.0 38.0 40.0 150-151 36.925 39.5 36.5 39.5 32.5 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 2.0 26 2.0 27 7.0 28 10.0 29 9.0 30 21.0 31 16.0 32 19.0 33 30.0 34 32.0 35 49.0 36 43.0 37 122.0 38 220.0 39 3415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.9874213836478 10.968553459119496 8.930817610062892 58.11320754716981 2 17.424999999999997 17.5 44.775 20.3 3 16.650000000000002 21.425 26.85 35.075 4 21.625 30.775000000000002 20.974999999999998 26.625 5 21.375 34.55 25.074999999999996 19.0 6 14.95 35.425000000000004 27.700000000000003 21.925 7 12.575 23.474999999999998 44.775 19.175 8 18.325 22.625 33.675 25.374999999999996 9 15.825 22.8 36.25 25.124999999999996 10-14 19.82 29.035 26.86 24.285 15-19 19.82 28.54 27.505000000000003 24.135 20-24 18.98 28.275 28.470000000000002 24.275 25-29 19.39 28.565 28.084999999999997 23.96 30-34 19.445 28.29 27.875 24.39 35-39 19.735 28.084999999999997 28.16 24.02 40-44 19.655 28.24 28.595 23.51 45-49 19.57 28.115000000000002 28.51 23.805 50-54 19.455 28.249999999999996 28.46 23.835 55-59 19.68 28.815 27.884999999999998 23.62 60-64 20.165 28.64 27.265 23.93 65-69 20.19 27.575 27.925 24.310000000000002 70-74 20.235 28.22 27.810000000000002 23.735 75-79 20.41102055102755 27.881394069703486 27.861393069653484 23.84619230961548 80-84 20.051002550127507 27.991399569978498 27.91639581979099 24.041202060103007 85-89 20.0 27.834999999999997 28.384999999999998 23.78 90-94 20.211010550527526 27.91639581979099 27.621381069053452 24.251212560628034 95-99 20.571028551427574 28.471423571178562 27.27136356817841 23.68618430921546 100-104 20.615 28.23 27.994999999999997 23.16 105-109 20.215 28.194999999999997 27.675 23.915 110-114 20.86 28.1 27.74 23.3 115-119 21.2 28.235 26.939999999999998 23.625 120-124 20.435 28.33 27.644999999999996 23.59 125-129 21.26 28.349999999999998 27.150000000000002 23.24 130-134 20.79 28.675 26.840000000000003 23.695 135-139 21.235 28.315 26.86 23.59 140-144 21.0 28.24 27.439999999999998 23.32 145-149 21.09 28.68 26.63 23.599999999999998 150-151 20.8625 28.262500000000003 26.437500000000004 24.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 1.0 24 0.5 25 2.0 26 4.0 27 7.5 28 10.5 29 12.0 30 16.5 31 25.5 32 31.0 33 32.5 34 52.0 35 79.0 36 96.0 37 106.0 38 137.0 39 181.5 40 199.5 41 214.0 42 241.0 43 269.0 44 287.0 45 277.5 46 252.5 47 251.5 48 236.5 49 194.5 50 166.0 51 135.5 52 101.5 53 94.5 54 80.0 55 47.5 56 37.5 57 29.0 58 21.0 59 20.0 60 16.5 61 11.5 62 4.5 63 2.5 64 2.0 65 0.0 66 1.0 67 1.0 68 1.0 69 1.0 70 1.0 71 1.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.005 85-89 0.0 90-94 0.005 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77426636568849 99.45 2 0.200652119388011 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025081514923501375 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAAATGTAGATTCAAAGGCATGAGTGTATCCTCGGTTTAGCTCCGCAG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.275 0.0 0.0 0.0 0.0 126-127 3.7375 0.0 0.0 0.0 0.0 128-129 4.300000000000001 0.0 0.0 0.0 0.0 130-131 4.675 0.0 0.0 0.0 0.0 132-133 5.1625 0.0 0.0 0.0 0.0 134-135 5.825 0.0 0.0 0.0 0.0 136-137 6.5375 0.0 0.0 0.0 0.0 138-139 7.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6232768 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232768_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.561 35.0 35.0 35.0 35.0 35.0 2 34.50775 35.0 35.0 35.0 34.0 35.0 3 34.4285 35.0 35.0 35.0 33.0 35.0 4 34.5165 35.0 35.0 35.0 35.0 35.0 5 34.5725 35.0 35.0 35.0 35.0 35.0 6 39.3695 40.0 40.0 40.0 39.0 40.0 7 39.38225 40.0 40.0 40.0 39.0 40.0 8 39.41075 40.0 40.0 40.0 39.0 40.0 9 39.4265 40.0 40.0 40.0 39.0 40.0 10-14 39.4414 40.0 40.0 40.0 39.0 40.0 15-19 39.46485 40.0 40.0 40.0 39.0 40.0 20-24 39.46045 40.0 40.0 40.0 39.0 40.0 25-29 39.4502 40.0 40.0 40.0 39.0 40.0 30-34 39.447 40.0 40.0 40.0 39.0 40.0 35-39 39.3747 40.0 40.0 40.0 39.0 40.0 40-44 39.32415 40.0 40.0 40.0 39.0 40.0 45-49 39.35934999999999 40.0 40.0 40.0 39.0 40.0 50-54 39.368100000000005 40.0 40.0 40.0 39.0 40.0 55-59 39.313199999999995 40.0 40.0 40.0 39.0 40.0 60-64 39.298899999999996 40.0 40.0 40.0 39.0 40.0 65-69 39.245 40.0 40.0 40.0 39.0 40.0 70-74 39.24965 40.0 40.0 40.0 39.0 40.0 75-79 39.2518 40.0 40.0 40.0 39.0 40.0 80-84 39.1801 40.0 40.0 40.0 39.0 40.0 85-89 39.1113 40.0 40.0 40.0 39.0 40.0 90-94 39.01625 40.0 40.0 40.0 38.2 40.0 95-99 39.0445 40.0 40.0 40.0 38.4 40.0 100-104 38.63135 39.6 39.0 39.8 37.2 40.0 105-109 39.035199999999996 40.0 40.0 40.0 38.6 40.0 110-114 38.9584 40.0 40.0 40.0 38.0 40.0 115-119 38.9495 40.0 39.8 40.0 38.0 40.0 120-124 38.85395 40.0 39.0 40.0 38.0 40.0 125-129 38.79815 40.0 39.0 40.0 38.0 40.0 130-134 38.62765 40.0 39.0 40.0 37.0 40.0 135-139 38.42665 40.0 39.0 40.0 36.0 40.0 140-144 38.26585 40.0 39.0 40.0 36.0 40.0 145-149 37.83284999999999 39.8 39.0 40.0 35.0 40.0 150-151 35.03475 38.5 35.0 39.5 25.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 1.0 18 2.0 19 2.0 20 1.0 21 4.0 22 8.0 23 6.0 24 7.0 25 7.0 26 8.0 27 12.0 28 17.0 29 12.0 30 14.0 31 18.0 32 17.0 33 35.0 34 45.0 35 52.0 36 73.0 37 132.0 38 290.0 39 3234.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.8 17.549999999999997 14.000000000000002 46.650000000000006 2 20.424999999999997 24.7 40.325 14.549999999999999 3 16.675 28.525 31.15 23.65 4 20.9 33.975 24.175 20.95 5 24.625 36.25 22.35 16.775000000000002 6 16.775000000000002 39.0 25.15 19.075 7 17.849999999999998 18.45 41.9 21.8 8 18.55 22.15 33.300000000000004 26.0 9 20.150000000000002 23.549999999999997 31.125000000000004 25.174999999999997 10-14 22.09 28.48 26.69 22.74 15-19 22.21 28.395 27.565 21.83 20-24 22.195 28.705000000000002 27.634999999999998 21.465 25-29 21.86 28.465 28.04 21.634999999999998 30-34 22.509999999999998 28.17 27.73 21.59 35-39 22.720000000000002 28.294999999999998 27.355 21.63 40-44 22.895 27.284999999999997 28.110000000000003 21.709999999999997 45-49 22.585 28.1 27.589999999999996 21.725 50-54 22.655 28.625 27.544999999999998 21.175 55-59 22.89 28.055000000000003 27.779999999999998 21.275 60-64 22.835 27.805000000000003 28.42 20.94 65-69 23.32 28.1 27.810000000000002 20.77 70-74 23.31 28.63 27.224999999999998 20.835 75-79 22.93 28.18 27.67 21.22 80-84 23.285 28.18 27.79 20.745 85-89 23.535 28.49 27.515 20.46 90-94 23.18 27.944999999999997 27.834999999999997 21.04 95-99 23.47 27.994999999999997 27.925 20.61 100-104 23.835 27.810000000000002 27.750000000000004 20.605 105-109 23.535 27.82 27.689999999999998 20.955 110-114 23.34 27.63 28.235 20.794999999999998 115-119 23.674999999999997 28.18 27.875 20.27 120-124 24.11 27.63 27.355 20.905 125-129 23.93 28.799999999999997 27.315 19.955000000000002 130-134 24.740000000000002 28.17 26.93 20.16 135-139 24.665 28.09 27.389999999999997 19.855 140-144 24.83 27.68 27.465 20.025000000000002 145-149 24.959999999999997 28.625 26.825 19.59 150-151 24.925 28.849999999999998 27.3625 18.862499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.0 24 2.0 25 3.0 26 4.5 27 5.5 28 9.0 29 12.5 30 14.0 31 19.5 32 26.5 33 37.5 34 50.0 35 63.0 36 84.5 37 102.5 38 130.5 39 170.0 40 198.0 41 243.0 42 285.0 43 279.0 44 268.5 45 275.5 46 266.5 47 238.5 48 227.5 49 197.5 50 159.0 51 138.0 52 114.0 53 90.0 54 70.5 55 58.0 56 40.0 57 29.5 58 20.5 59 15.0 60 14.0 61 10.0 62 5.5 63 4.5 64 3.5 65 2.0 66 2.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.45271629778672035 0.8999999999999999 3 0.07545271629778671 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.7125000000000004 0.0 0.0 0.0 0.0 128-129 4.275 0.0 0.0 0.0 0.0 130-131 4.65 0.0 0.0 0.0 0.0 132-133 5.137499999999999 0.0 0.0 0.0 0.0 134-135 5.7875 0.0 0.0 0.0 0.0 136-137 6.5 0.0 0.0 0.0 0.0 138-139 7.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGAA 10 0.006830828 145.0 1 >>END_MODULE Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695562 spots for SRR6232768.sra Written 695562 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra Read 695544 spots for SRR6232768.sra Written 695544 spots for SRR6232768.sra SRR ids: ['SRR6232768.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zxa_ptos SRR6232768.sra spots: 13910898 blocks: [[1, 695544], [695545, 1391088], [1391089, 2086632], [2086633, 2782176], [2782177, 3477720], [3477721, 4173264], [4173265, 4868808], [4868809, 5564352], [5564353, 6259896], [6259897, 6955440], [6955441, 7650984], [7650985, 8346528], [8346529, 9042072], [9042073, 9737616], [9737617, 10433160], [10433161, 11128704], [11128705, 11824248], [11824249, 12519792], [12519793, 13215336], [13215337, 13910898]] SRR6232768 file size 4692246 SRR6232768 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6232768 SRR6232768_1.fastq SRR6232768_2.fastq Input file: SRR6232768_1.fastq Paired file: SRR6232768_2.fastq trimmed: SRR6232768-trimmed-pair1.fastq, SRR6232768-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 08:37:03 2025 >> started Wed Feb 12 08:37:17 2025 >> done (14.967s) 13910898 read pairs processed; of these: 1584 ( 0.01%) short read pairs filtered out after trimming by size control 6628 ( 0.05%) empty read pairs filtered out after trimming by size control 13902686 (99.94%) read pairs available; of these: 2276204 (16.37%) trimmed read pairs available after processing 11626482 (83.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 3 0.00% 21 5 0.00% 22 5 0.00% 23 1 0.00% 24 3 0.00% 25 2 0.00% 26 4 0.00% 27 4 0.00% 28 2 0.00% 29 4 0.00% 30 5 0.00% 31 6 0.00% 32 5 0.00% 33 11 0.00% 34 7 0.00% 35 7 0.00% 36 8 0.00% 37 13 0.00% 38 14 0.00% 39 18 0.00% 40 9 0.00% 41 14 0.00% 42 16 0.00% 43 15 0.00% 44 13 0.00% 45 21 0.00% 46 20 0.00% 47 27 0.00% 48 40 0.00% 49 31 0.00% 50 44 0.00% 51 40 0.00% 52 34 0.00% 53 37 0.00% 54 53 0.00% 55 56 0.00% 56 64 0.00% 57 68 0.00% 58 71 0.00% 59 87 0.00% 60 86 0.00% 61 128 0.00% 62 111 0.00% 63 151 0.00% 64 139 0.00% 65 172 0.00% 66 170 0.00% 67 190 0.00% 68 214 0.00% 69 267 0.00% 70 410 0.00% 71 468 0.00% 72 376 0.00% 73 415 0.00% 74 461 0.00% 75 499 0.00% 76 537 0.00% 77 565 0.00% 78 692 0.00% 79 739 0.01% 80 830 0.01% 81 930 0.01% 82 1103 0.01% 83 1295 0.01% 84 1316 0.01% 85 1634 0.01% 86 1896 0.01% 87 2015 0.01% 88 2335 0.02% 89 2464 0.02% 90 2854 0.02% 91 3174 0.02% 92 3390 0.02% 93 3865 0.03% 94 4480 0.03% 95 4774 0.03% 96 5110 0.04% 97 5660 0.04% 98 6181 0.04% 99 6555 0.05% 100 7035 0.05% 101 7742 0.06% 102 8360 0.06% 103 9175 0.07% 104 9957 0.07% 105 11079 0.08% 106 11967 0.09% 107 12816 0.09% 108 13761 0.10% 109 14813 0.11% 110 15374 0.11% 111 16082 0.12% 112 17357 0.12% 113 18774 0.14% 114 19278 0.14% 115 20479 0.15% 116 22229 0.16% 117 23058 0.17% 118 24272 0.17% 119 25170 0.18% 120 25993 0.19% 121 27256 0.20% 122 28417 0.20% 123 29179 0.21% 124 30224 0.22% 125 32183 0.23% 126 33288 0.24% 127 34605 0.25% 128 35723 0.26% 129 37132 0.27% 130 38401 0.28% 131 39017 0.28% 132 39500 0.28% 133 41183 0.30% 134 42284 0.30% 135 43456 0.31% 136 45137 0.32% 137 46933 0.34% 138 48693 0.35% 139 50283 0.36% 140 51387 0.37% 141 52514 0.38% 142 54442 0.39% 143 55912 0.40% 144 58231 0.42% 145 61479 0.44% 146 65439 0.47% 147 71655 0.52% 148 81016 0.58% 149 103591 0.75% 150 493325 3.55% 151 11626482 83.63% 13902686 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=4.75 fanout-score-rank=25 prefix-density=0.19 prefix-fanout=3.3 sequence=AAGGTAGTTATTGTTTCCATTGTCAAACAAGGAGTCTCCAAAGACGAAGTAGCAAGGAACTTGAGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=449.37 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=34.5 sequence=TTCTTCTTCTTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=33 prefix-density=0.26 prefix-fanout=2.5 sequence=TTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAACGATCGTGAAACTGGAAGATCTCGCGGCTTTGGATTTGTTACCTTCAACAACGAGAAGGCAAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=7 fanout-score=350.57 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=30.7 sequence=AAGAAGAAGAAA SRR6232768 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 08:37:59 Started mapping on | Feb 12 08:37:59 Finished on | Feb 12 08:39:48 Mapping speed, Million of reads per hour | 459.17 Number of input reads | 13902686 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13038067 Uniquely mapped reads % | 93.78% Average mapped length | 295.93 Number of splices: Total | 12913025 Number of splices: Annotated (sjdb) | 12676215 Number of splices: GT/AG | 12685316 Number of splices: GC/AG | 185008 Number of splices: AT/AC | 9168 Number of splices: Non-canonical | 33533 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.03% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 443295 % of reads mapped to multiple loci | 3.19% Number of reads mapped to too many loci | 64947 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 423365 423365 423365 N_multimapping 443295 443295 443295 N_noFeature 377596 12907111 447272 N_ambiguous 129462 729 67663 UnstrandedReadsAssigned:12531009 PositiveStrandReadsAssigned:130227 NegativeStrandReadsAssigned:12523132 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6232768 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6232768-trimmed-pair1.fastq SRR6232768-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,902,686 reads, 12,582,450 reads pseudoaligned [quant] estimated average fragment length: 246.98 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR6232768.ke.tsv 34699 SRR6232768.se.tsv 87100 total ==> SRR6232768.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.02 255 11.4478 Potri.005G024800.1.v4.1 1035 789.02 38 3.83131 Potri.004G059700.1.v4.1 961 715.047 38 4.22766 Potri.007G009000.2.v4.1 1416 1170.02 0 0 Potri.003G141000.2.v4.1 2943 2697.02 219.184 6.46512 Potri.016G087400.1.v4.1 270 84.0491 1082 1024.11 Potri.015G069301.1.v4.1 564 325.521 0 0 Potri.010G195200.1.v4.1 1773 1527.02 3 0.156289 Potri.012G127500.1.v4.1 977 731.036 1310 142.555 ==> SRR6232768.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 18 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 160 Potri.001G212900.v4.1 53 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 52 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR6232768 completed mapping pipeline successfully