Starting /dee2/code/volunteer_pipeline.sh SRR6232769 current disk space = 3049661505536 free memory = 1432889172 SRR6232769 SRAfilesize 7e15b6e2142d0f195e8181320af2e32f SRR6232769.sra SRR6232769.sra file validated SRR6232769 is paired end SRR6232769 is conventional basespace SRR6232769 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232769_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.58475 35.0 35.0 35.0 35.0 35.0 2 34.739 35.0 35.0 35.0 35.0 35.0 3 34.75775 35.0 35.0 35.0 35.0 35.0 4 34.77375 35.0 35.0 35.0 35.0 35.0 5 34.8065 35.0 35.0 35.0 35.0 35.0 6 39.605 40.0 40.0 40.0 39.0 40.0 7 39.63675 40.0 40.0 40.0 39.0 40.0 8 39.6405 40.0 40.0 40.0 40.0 40.0 9 39.6715 40.0 40.0 40.0 39.0 40.0 10-14 39.6321 40.0 40.0 40.0 39.2 40.0 15-19 39.661699999999996 40.0 40.0 40.0 39.6 40.0 20-24 39.644000000000005 40.0 40.0 40.0 39.8 40.0 25-29 39.634249999999994 40.0 40.0 40.0 39.2 40.0 30-34 39.6455 40.0 40.0 40.0 39.0 40.0 35-39 39.5636 40.0 40.0 40.0 39.0 40.0 40-44 39.5911 40.0 40.0 40.0 39.0 40.0 45-49 39.578450000000004 40.0 40.0 40.0 39.0 40.0 50-54 39.5398 40.0 40.0 40.0 39.0 40.0 55-59 39.55305 40.0 40.0 40.0 39.0 40.0 60-64 39.475 40.0 40.0 40.0 39.0 40.0 65-69 39.40835 40.0 40.0 40.0 39.0 40.0 70-74 39.4303 40.0 40.0 40.0 39.0 40.0 75-79 39.4091 40.0 40.0 40.0 39.0 40.0 80-84 39.42355 40.0 40.0 40.0 39.0 40.0 85-89 39.34145 40.0 40.0 40.0 39.0 40.0 90-94 39.379599999999996 40.0 40.0 40.0 39.0 40.0 95-99 39.34325 40.0 40.0 40.0 39.0 40.0 100-104 38.87645 39.6 39.2 39.8 38.0 40.0 105-109 39.34994999999999 40.0 40.0 40.0 39.0 40.0 110-114 39.285450000000004 40.0 40.0 40.0 39.0 40.0 115-119 39.253 40.0 40.0 40.0 39.0 40.0 120-124 39.1983 40.0 40.0 40.0 39.0 40.0 125-129 39.142100000000006 40.0 40.0 40.0 39.0 40.0 130-134 39.05855 40.0 40.0 40.0 38.8 40.0 135-139 39.030550000000005 40.0 40.0 40.0 38.4 40.0 140-144 38.951 40.0 39.8 40.0 38.0 40.0 145-149 38.75855 40.0 39.0 40.0 37.6 40.0 150-151 36.90925 39.5 36.5 39.5 32.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 2.0 23 0.0 24 3.0 25 4.0 26 1.0 27 8.0 28 11.0 29 9.0 30 18.0 31 20.0 32 21.0 33 25.0 34 23.0 35 35.0 36 61.0 37 97.0 38 212.0 39 3447.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.27927474187862 11.080332409972298 9.896751447997985 57.74364140015109 2 17.175 18.6 45.35 18.875 3 19.0 21.875 24.675 34.449999999999996 4 21.3 32.324999999999996 21.375 25.0 5 21.65 36.025 25.0 17.325 6 16.3 37.65 26.700000000000003 19.35 7 12.65 22.8 44.75 19.8 8 16.875 21.6 33.15 28.375 9 16.025 22.75 35.225 26.0 10-14 19.515 29.65 26.784999999999997 24.05 15-19 19.115 28.24 27.779999999999998 24.865000000000002 20-24 19.245 29.23 27.57 23.955000000000002 25-29 19.35 28.985 27.845 23.82 30-34 19.41 28.12 28.365000000000002 24.104999999999997 35-39 19.665 28.794999999999998 27.744999999999997 23.794999999999998 40-44 19.735 29.515 27.35 23.400000000000002 45-49 19.744999999999997 29.29 27.58 23.385 50-54 20.255000000000003 27.715 28.244999999999997 23.785 55-59 19.49 28.4 27.99 24.12 60-64 19.825 28.544999999999998 27.105 24.525 65-69 19.63892778555711 28.74574914982996 27.975595119023804 23.63972794558912 70-74 20.2080312046807 28.614292143821572 27.374106115917385 23.803570535580338 75-79 19.641785071042626 28.53211927156294 28.00680408244947 23.819291574944966 80-84 19.901965687990796 28.339918971640078 27.999799929975495 23.75831541039364 85-89 19.580874262278684 28.683605081524455 28.09842952885866 23.637091127338202 90-94 20.6342854284428 28.117652943824723 27.63743684658096 23.610624781151518 95-99 20.34924447112979 28.605023516461525 27.724407084959473 23.321324927449215 100-104 20.324145865639537 28.467810514731628 27.19723875744085 24.010804862187985 105-109 19.850955286585975 28.233470041012303 27.778333500050017 24.137241172351708 110-114 20.26810724289716 28.031212484994 28.106242496998803 23.594437775110045 115-119 20.324145865639537 28.032614676604474 28.132659696863588 23.5105797608924 120-124 20.729145829165834 28.435687137427486 26.77035407081416 24.06481296259252 125-129 20.390097524381094 27.976994248562143 28.3520880220055 23.280820205051263 130-134 20.668100215032254 29.089363404510678 26.989048357253587 23.25348802320348 135-139 20.00200020002 28.44784478447845 27.562756275627564 23.98739873987399 140-144 20.41102055102755 27.946397319865994 27.976398819940997 23.666183309165458 145-149 20.9 28.205000000000002 27.825 23.07 150-151 20.8625 28.487499999999997 27.125 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 1.0 24 2.0 25 4.5 26 6.5 27 5.5 28 8.0 29 14.0 30 19.5 31 27.5 32 35.0 33 38.5 34 54.0 35 82.0 36 99.0 37 114.5 38 134.5 39 162.5 40 195.0 41 231.5 42 271.0 43 288.0 44 278.0 45 260.5 46 250.0 47 256.5 48 240.5 49 193.5 50 151.0 51 122.5 52 107.5 53 88.0 54 63.5 55 41.0 56 34.0 57 30.0 58 22.0 59 17.5 60 13.5 61 11.0 62 6.0 63 2.5 64 2.5 65 2.5 66 2.0 67 1.5 68 1.0 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.02 70-74 0.015 75-79 0.06 80-84 0.034999999999999996 85-89 0.03 90-94 0.045 95-99 0.06999999999999999 100-104 0.045 105-109 0.03 110-114 0.04 115-119 0.045 120-124 0.02 125-129 0.025 130-134 0.015 135-139 0.01 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.037500000000000006 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.05 0.025 0.0 0.0 0.0 82-83 0.05 0.025 0.0 0.0 0.0 84-85 0.0625 0.025 0.0 0.0 0.0 86-87 0.125 0.025 0.0 0.0 0.0 88-89 0.175 0.025 0.0 0.0 0.0 90-91 0.175 0.025 0.0 0.0 0.0 92-93 0.21250000000000002 0.025 0.0 0.0 0.0 94-95 0.2625 0.025 0.0 0.0 0.0 96-97 0.3125 0.025 0.0 0.0 0.0 98-99 0.3375 0.025 0.0 0.0 0.0 100-101 0.4125 0.025 0.0 0.0 0.0 102-103 0.5 0.025 0.0 0.0 0.0 104-105 0.5625 0.025 0.0 0.0 0.0 106-107 0.675 0.025 0.0 0.0 0.0 108-109 0.7875000000000001 0.025 0.0 0.0 0.0 110-111 0.8875 0.025 0.0 0.0 0.0 112-113 0.9875 0.025 0.0 0.0 0.0 114-115 1.125 0.025 0.0 0.0 0.0 116-117 1.4625 0.025 0.0 0.0 0.0 118-119 1.6625 0.025 0.0 0.0 0.0 120-121 1.7875 0.025 0.0 0.0 0.0 122-123 1.875 0.025 0.0 0.0 0.0 124-125 2.05 0.025 0.0 0.0 0.0 126-127 2.2875 0.025 0.0 0.0 0.0 128-129 2.5 0.025 0.0 0.0 0.0 130-131 2.7249999999999996 0.025 0.0 0.0 0.0 132-133 2.9125 0.025 0.0 0.0 0.0 134-135 3.2875 0.025 0.0 0.0 0.0 136-137 3.625 0.025 0.0 0.0 0.0 138-139 3.975 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACATTG 10 0.006830828 145.0 9 ATACATT 10 0.006830828 145.0 8 >>END_MODULE SRR6232769 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232769_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.53025 35.0 35.0 35.0 35.0 35.0 2 34.55925 35.0 35.0 35.0 35.0 35.0 3 34.6205 35.0 35.0 35.0 35.0 35.0 4 34.65725 35.0 35.0 35.0 35.0 35.0 5 34.62325 35.0 35.0 35.0 35.0 35.0 6 39.4525 40.0 40.0 40.0 39.0 40.0 7 39.38025 40.0 40.0 40.0 39.0 40.0 8 39.37125 40.0 40.0 40.0 39.0 40.0 9 39.358 40.0 40.0 40.0 39.0 40.0 10-14 39.364999999999995 40.0 40.0 40.0 39.0 40.0 15-19 39.3967 40.0 40.0 40.0 39.0 40.0 20-24 39.40755 40.0 40.0 40.0 39.0 40.0 25-29 39.4072 40.0 40.0 40.0 39.0 40.0 30-34 39.38765 40.0 40.0 40.0 39.0 40.0 35-39 39.344049999999996 40.0 40.0 40.0 39.0 40.0 40-44 39.2737 40.0 40.0 40.0 39.0 40.0 45-49 39.2727 40.0 40.0 40.0 39.0 40.0 50-54 39.28724999999999 40.0 40.0 40.0 39.0 40.0 55-59 39.291399999999996 40.0 40.0 40.0 39.0 40.0 60-64 39.23715 40.0 40.0 40.0 39.0 40.0 65-69 39.20195 40.0 40.0 40.0 39.0 40.0 70-74 39.21725 40.0 40.0 40.0 39.0 40.0 75-79 39.204750000000004 40.0 40.0 40.0 39.0 40.0 80-84 39.1548 40.0 40.0 40.0 39.0 40.0 85-89 39.06895 40.0 40.0 40.0 38.6 40.0 90-94 38.988350000000004 40.0 39.8 40.0 38.0 40.0 95-99 38.985 40.0 39.8 40.0 38.0 40.0 100-104 38.560649999999995 39.6 38.8 39.8 37.2 40.0 105-109 38.945949999999996 40.0 39.8 40.0 38.0 40.0 110-114 38.936 40.0 39.6 40.0 38.0 40.0 115-119 38.84735 40.0 39.0 40.0 38.0 40.0 120-124 38.80929999999999 40.0 39.0 40.0 37.8 40.0 125-129 38.703700000000005 40.0 39.0 40.0 37.4 40.0 130-134 38.53595 40.0 39.0 40.0 36.8 40.0 135-139 38.30994999999999 40.0 39.0 40.0 36.0 40.0 140-144 38.22834999999999 40.0 39.0 40.0 36.0 40.0 145-149 37.8044 39.8 39.0 40.0 35.0 40.0 150-151 35.284625000000005 38.5 35.0 39.5 25.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 2.0 20 3.0 21 3.0 22 3.0 23 6.0 24 11.0 25 10.0 26 18.0 27 8.0 28 10.0 29 17.0 30 17.0 31 22.0 32 27.0 33 29.0 34 41.0 35 55.0 36 64.0 37 115.0 38 326.0 39 3208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.525 16.075 14.099999999999998 46.300000000000004 2 19.75 25.924999999999997 40.325 14.000000000000002 3 17.95 28.525 30.075000000000003 23.45 4 21.875 35.699999999999996 21.2 21.224999999999998 5 23.75 36.199999999999996 23.25 16.8 6 17.675 38.2 25.15 18.975 7 18.725 17.65 42.699999999999996 20.925 8 19.2 22.45 32.1 26.25 9 21.475 22.575 32.025 23.925 10-14 21.995 28.585 26.939999999999998 22.48 15-19 22.24 28.26 28.015 21.485000000000003 20-24 22.365 28.735 27.37 21.529999999999998 25-29 22.14 27.85 29.075 20.935000000000002 30-34 22.869999999999997 28.444999999999997 27.805000000000003 20.880000000000003 35-39 22.66 28.51 27.79 21.04 40-44 22.165000000000003 28.884999999999998 27.91 21.04 45-49 22.7 28.285 28.084999999999997 20.93 50-54 23.05 27.544999999999998 28.310000000000002 21.095 55-59 22.74 27.91 28.525 20.825 60-64 22.785 27.49 28.51 21.215 65-69 23.215 28.095 27.894999999999996 20.794999999999998 70-74 22.8 27.905 28.475 20.82 75-79 23.07 27.875 27.985 21.07 80-84 23.26 27.91 27.68 21.15 85-89 23.145 27.715 28.025 21.115000000000002 90-94 22.7 28.265 27.865000000000002 21.17 95-99 23.064999999999998 27.845 28.37 20.72 100-104 23.235 27.950000000000003 28.189999999999998 20.625 105-109 23.599999999999998 27.855 28.005000000000003 20.54 110-114 23.185 28.17 27.925 20.72 115-119 23.365 27.825 27.96 20.849999999999998 120-124 24.19 27.96 27.825 20.025000000000002 125-129 23.465 27.694999999999997 28.57 20.27 130-134 23.695 27.92 27.950000000000003 20.435 135-139 23.905 27.425 28.49 20.18 140-144 23.990000000000002 28.015 27.950000000000003 20.044999999999998 145-149 24.645 27.68 28.48 19.195 150-151 24.325 28.000000000000004 27.525 20.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.0 23 0.5 24 0.5 25 4.0 26 6.5 27 6.5 28 8.0 29 10.5 30 14.0 31 18.5 32 26.5 33 39.5 34 53.5 35 61.5 36 81.0 37 109.5 38 152.5 39 196.0 40 210.5 41 237.0 42 277.0 43 279.0 44 263.5 45 267.5 46 261.5 47 239.5 48 222.5 49 193.5 50 164.0 51 139.5 52 102.5 53 82.5 54 68.5 55 49.0 56 34.5 57 28.0 58 25.0 59 14.5 60 10.5 61 10.0 62 7.5 63 6.5 64 4.0 65 2.0 66 2.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.5028916268544128 1.0 3 0.0 0.0 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 0.9875 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.5 0.0 0.0 0.0 0.0 130-131 2.7249999999999996 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.2750000000000004 0.0 0.0 0.0 0.0 136-137 3.6 0.0 0.0 0.0 0.0 138-139 3.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCACA 10 0.006830828 145.0 145 AATGGAG 10 0.006830828 145.0 5 >>END_MODULE Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659523 spots for SRR6232769.sra Written 659523 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra Read 659517 spots for SRR6232769.sra Written 659517 spots for SRR6232769.sra SRR ids: ['SRR6232769.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6qx8p07f SRR6232769.sra spots: 13190346 blocks: [[1, 659517], [659518, 1319034], [1319035, 1978551], [1978552, 2638068], [2638069, 3297585], [3297586, 3957102], [3957103, 4616619], [4616620, 5276136], [5276137, 5935653], [5935654, 6595170], [6595171, 7254687], [7254688, 7914204], [7914205, 8573721], [8573722, 9233238], [9233239, 9892755], [9892756, 10552272], [10552273, 11211789], [11211790, 11871306], [11871307, 12530823], [12530824, 13190346]] SRR6232769 file size 4448075 SRR6232769 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6232769 SRR6232769_1.fastq SRR6232769_2.fastq Input file: SRR6232769_1.fastq Paired file: SRR6232769_2.fastq trimmed: SRR6232769-trimmed-pair1.fastq, SRR6232769-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:12:29 2025 >> started Wed Feb 12 09:12:42 2025 >> done (13.456s) 13190346 read pairs processed; of these: 1606 ( 0.01%) short read pairs filtered out after trimming by size control 5472 ( 0.04%) empty read pairs filtered out after trimming by size control 13183268 (99.95%) read pairs available; of these: 1715284 (13.01%) trimmed read pairs available after processing 11467984 (86.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 2 0.00% 21 5 0.00% 22 4 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 4 0.00% 27 2 0.00% 28 1 0.00% 29 2 0.00% 30 6 0.00% 31 4 0.00% 32 6 0.00% 33 1 0.00% 34 7 0.00% 35 9 0.00% 36 6 0.00% 37 14 0.00% 38 6 0.00% 39 3 0.00% 40 7 0.00% 41 14 0.00% 42 8 0.00% 43 20 0.00% 44 10 0.00% 45 16 0.00% 46 28 0.00% 47 19 0.00% 48 17 0.00% 49 16 0.00% 50 35 0.00% 51 34 0.00% 52 24 0.00% 53 43 0.00% 54 45 0.00% 55 49 0.00% 56 64 0.00% 57 62 0.00% 58 62 0.00% 59 51 0.00% 60 74 0.00% 61 98 0.00% 62 100 0.00% 63 90 0.00% 64 115 0.00% 65 114 0.00% 66 138 0.00% 67 152 0.00% 68 170 0.00% 69 164 0.00% 70 179 0.00% 71 207 0.00% 72 269 0.00% 73 260 0.00% 74 307 0.00% 75 337 0.00% 76 334 0.00% 77 423 0.00% 78 514 0.00% 79 512 0.00% 80 583 0.00% 81 658 0.00% 82 722 0.01% 83 769 0.01% 84 1015 0.01% 85 1195 0.01% 86 1352 0.01% 87 1482 0.01% 88 1606 0.01% 89 1791 0.01% 90 1902 0.01% 91 2144 0.02% 92 2344 0.02% 93 2680 0.02% 94 3143 0.02% 95 3072 0.02% 96 3466 0.03% 97 3786 0.03% 98 4172 0.03% 99 4408 0.03% 100 4659 0.04% 101 5281 0.04% 102 5566 0.04% 103 5986 0.05% 104 6446 0.05% 105 7036 0.05% 106 7603 0.06% 107 8261 0.06% 108 8604 0.07% 109 9418 0.07% 110 10002 0.08% 111 10461 0.08% 112 11367 0.09% 113 11731 0.09% 114 12342 0.09% 115 12963 0.10% 116 13737 0.10% 117 14673 0.11% 118 15167 0.12% 119 15991 0.12% 120 16515 0.13% 121 17304 0.13% 122 17842 0.14% 123 18819 0.14% 124 19581 0.15% 125 20340 0.15% 126 20912 0.16% 127 22311 0.17% 128 23192 0.18% 129 23901 0.18% 130 24959 0.19% 131 25312 0.19% 132 26399 0.20% 133 27468 0.21% 134 28500 0.22% 135 29568 0.22% 136 30307 0.23% 137 32182 0.24% 138 33032 0.25% 139 34929 0.26% 140 36677 0.28% 141 37589 0.29% 142 39784 0.30% 143 41314 0.31% 144 43670 0.33% 145 47114 0.36% 146 50451 0.38% 147 56630 0.43% 148 66821 0.51% 149 88094 0.67% 150 468909 3.56% 151 11467984 86.99% 13183268 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=4.59 fanout-score-rank=24 prefix-density=0.16 prefix-fanout=3.3 sequence=AAGGTAGTTATTGTTTCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=421.29 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=34.3 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=37 prefix-density=0.25 prefix-fanout=2.5 sequence=TTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAACGATCGTGAAACTGGAAGATCTCGCGGCTTTGGATTTGTTACCTTCAACAACGAGAAGGCAAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=376.22 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=31.9 sequence=AAGAAGAAGAAA SRR6232769 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:13:28 Started mapping on | Feb 12 09:13:28 Finished on | Feb 12 09:15:15 Mapping speed, Million of reads per hour | 443.55 Number of input reads | 13183268 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12340433 Uniquely mapped reads % | 93.61% Average mapped length | 297.49 Number of splices: Total | 11999034 Number of splices: Annotated (sjdb) | 11774715 Number of splices: GT/AG | 11770770 Number of splices: GC/AG | 185160 Number of splices: AT/AC | 9530 Number of splices: Non-canonical | 33574 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.03% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 395424 % of reads mapped to multiple loci | 3.00% Number of reads mapped to too many loci | 53404 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.88% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 449669 449669 449669 N_multimapping 395424 395424 395424 N_noFeature 384501 12207811 460919 N_ambiguous 122346 807 65704 UnstrandedReadsAssigned:11833586 PositiveStrandReadsAssigned:131815 NegativeStrandReadsAssigned:11813810 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6232769 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6232769-trimmed-pair1.fastq SRR6232769-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,183,268 reads, 11,840,613 reads pseudoaligned [quant] estimated average fragment length: 261.065 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR6232769.ke.tsv 34699 SRR6232769.se.tsv 87100 total ==> SRR6232769.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.93 310 15.2509 Potri.005G024800.1.v4.1 1035 774.935 29 3.23645 Potri.004G059700.1.v4.1 961 701.08 33 4.07082 Potri.007G009000.2.v4.1 1416 1155.93 1 0.0748174 Potri.003G141000.2.v4.1 2943 2682.93 267.126 8.61077 Potri.016G087400.1.v4.1 270 76.4316 795 899.56 Potri.015G069301.1.v4.1 564 313.193 0 0 Potri.010G195200.1.v4.1 1773 1512.93 4 0.228652 Potri.012G127500.1.v4.1 977 717.006 1264 152.462 ==> SRR6232769.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 34 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 104 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR6232769 completed mapping pipeline successfully