Starting /dee2/code/volunteer_pipeline.sh SRR6232771 current disk space = 3049724182528 free memory = 1582037748 SRR6232771 SRAfilesize 3b4f84fa5a53617b95f9d47f4b24618c SRR6232771.sra SRR6232771.sra file validated SRR6232771 is paired end SRR6232771 is conventional basespace SRR6232771 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232771_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.59825 35.0 35.0 35.0 35.0 35.0 2 34.75975 35.0 35.0 35.0 35.0 35.0 3 34.7685 35.0 35.0 35.0 35.0 35.0 4 34.80675 35.0 35.0 35.0 35.0 35.0 5 34.81775 35.0 35.0 35.0 35.0 35.0 6 39.66725 40.0 40.0 40.0 39.0 40.0 7 39.64475 40.0 40.0 40.0 39.0 40.0 8 39.6295 40.0 40.0 40.0 40.0 40.0 9 39.63325 40.0 40.0 40.0 40.0 40.0 10-14 39.62205 40.0 40.0 40.0 39.0 40.0 15-19 39.6758 40.0 40.0 40.0 39.4 40.0 20-24 39.6647 40.0 40.0 40.0 39.4 40.0 25-29 39.64305 40.0 40.0 40.0 39.2 40.0 30-34 39.64785 40.0 40.0 40.0 39.4 40.0 35-39 39.57275 40.0 40.0 40.0 39.4 40.0 40-44 39.61650000000001 40.0 40.0 40.0 39.0 40.0 45-49 39.56745 40.0 40.0 40.0 39.0 40.0 50-54 39.5209 40.0 40.0 40.0 39.0 40.0 55-59 39.543400000000005 40.0 40.0 40.0 39.0 40.0 60-64 39.47305 40.0 40.0 40.0 39.0 40.0 65-69 39.4015 40.0 40.0 40.0 39.0 40.0 70-74 39.44385 40.0 40.0 40.0 39.0 40.0 75-79 39.40325 40.0 40.0 40.0 39.0 40.0 80-84 39.3912 40.0 40.0 40.0 39.0 40.0 85-89 39.35485 40.0 40.0 40.0 39.0 40.0 90-94 39.334999999999994 40.0 40.0 40.0 39.0 40.0 95-99 39.33225 40.0 40.0 40.0 39.0 40.0 100-104 38.853500000000004 39.8 39.2 39.8 38.0 40.0 105-109 39.2709 40.0 40.0 40.0 39.0 40.0 110-114 39.242599999999996 40.0 40.0 40.0 39.0 40.0 115-119 39.177299999999995 40.0 40.0 40.0 39.0 40.0 120-124 39.17295 40.0 40.0 40.0 39.0 40.0 125-129 39.1444 40.0 40.0 40.0 39.0 40.0 130-134 39.0641 40.0 40.0 40.0 38.6 40.0 135-139 38.987249999999996 40.0 40.0 40.0 38.0 40.0 140-144 38.92065 40.0 39.8 40.0 38.0 40.0 145-149 38.69305000000001 40.0 39.0 40.0 37.4 40.0 150-151 36.81625 39.5 36.5 39.5 32.5 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 0.0 19 1.0 20 0.0 21 1.0 22 2.0 23 2.0 24 1.0 25 1.0 26 3.0 27 8.0 28 8.0 29 10.0 30 8.0 31 15.0 32 26.0 33 26.0 34 46.0 35 43.0 36 58.0 37 82.0 38 201.0 39 3453.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.35264483627204 11.612090680100756 8.664987405541561 59.37027707808564 2 17.349999999999998 17.224999999999998 44.85 20.575 3 18.8 20.825 27.425 32.95 4 22.175 30.525000000000002 21.525 25.775 5 20.724999999999998 36.3 24.55 18.425 6 15.8 36.449999999999996 26.424999999999997 21.325 7 13.55 22.400000000000002 43.6 20.45 8 16.375 23.400000000000002 34.1 26.125 9 16.900000000000002 21.725 36.5 24.875 10-14 19.53 29.525000000000002 27.095000000000002 23.849999999999998 15-19 20.175 28.139999999999997 27.229999999999997 24.455 20-24 19.525000000000002 29.115000000000002 27.42 23.94 25-29 19.91 28.189999999999998 28.660000000000004 23.24 30-34 19.32 28.32 28.17 24.19 35-39 20.044999999999998 28.060000000000002 28.335 23.56 40-44 20.32 28.82 27.275 23.585 45-49 20.085 28.275 27.925 23.715 50-54 20.200000000000003 28.34 28.23 23.23 55-59 20.185 28.275 28.225 23.315 60-64 19.81 28.185 27.634999999999998 24.37 65-69 20.33406681336267 28.305661132226444 27.745549109821965 23.614722944588916 70-74 19.90398079615923 27.915583116623328 28.650730146029208 23.529705941188237 75-79 19.958971279895927 28.43490443310317 27.729410587411184 23.876713699589715 80-84 20.445111277819457 28.482120530132534 27.701925481370342 23.37084271067767 85-89 19.950985295588676 28.433530059017702 27.673301990597178 23.94218265479644 90-94 20.115057528764382 27.863931965982992 28.18409204602301 23.836918459229615 95-99 19.98498874155617 27.970978233675257 28.231173380035024 23.81285964473355 100-104 20.52526263131566 28.33416708354177 27.32366183091546 23.816908454227114 105-109 20.64119235770731 28.583575072521754 27.173151945583673 23.602080624187256 110-114 20.292102235782526 28.064822687940776 28.15985594958235 23.483219126694344 115-119 20.72932819768896 28.252713721174526 27.437346806062727 23.580611275073785 120-124 20.834166833366673 27.365473094618924 28.010602120424082 23.789757951590317 125-129 20.878131719757963 28.194229134370158 27.214082112316845 23.713557033555034 130-134 20.713106966044904 28.40926138920838 27.714157123568533 23.163474521178177 135-139 21.44214421442144 28.002800280028 26.817681768176815 23.737373737373737 140-144 21.615000000000002 27.534999999999997 27.66 23.189999999999998 145-149 21.865000000000002 28.37 26.97 22.795 150-151 21.512500000000003 27.537499999999998 27.1 23.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 1.5 22 1.5 23 0.5 24 1.0 25 3.0 26 4.5 27 3.0 28 6.0 29 13.0 30 16.0 31 25.0 32 38.0 33 43.5 34 46.5 35 66.5 36 100.5 37 125.5 38 154.5 39 167.0 40 181.5 41 225.5 42 249.0 43 260.5 44 282.0 45 297.5 46 272.0 47 244.0 48 223.5 49 187.5 50 156.5 51 135.0 52 109.0 53 80.0 54 69.5 55 56.5 56 35.5 57 27.0 58 21.0 59 15.5 60 14.5 61 12.5 62 10.5 63 3.5 64 2.0 65 1.5 66 0.0 67 0.5 68 2.0 69 2.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.02 70-74 0.02 75-79 0.06999999999999999 80-84 0.025 85-89 0.03 90-94 0.05 95-99 0.075 100-104 0.05 105-109 0.03 110-114 0.034999999999999996 115-119 0.045 120-124 0.02 125-129 0.015 130-134 0.015 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2125 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.9750000000000001 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.2375 0.0 0.0 0.0 0.0 122-123 2.4000000000000004 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 2.975 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.4749999999999996 0.0 0.0 0.0 0.0 132-133 3.8875 0.0 0.0 0.0 0.0 134-135 4.4 0.0 0.0 0.0 0.0 136-137 4.6 0.0 0.0 0.0 0.0 138-139 5.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCTCG 10 0.0068343505 144.975 7 >>END_MODULE SRR6232771 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6232771_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.50925 35.0 35.0 35.0 34.0 35.0 2 34.565 35.0 35.0 35.0 35.0 35.0 3 34.6125 35.0 35.0 35.0 35.0 35.0 4 34.543 35.0 35.0 35.0 35.0 35.0 5 34.61125 35.0 35.0 35.0 35.0 35.0 6 39.511 40.0 40.0 40.0 39.0 40.0 7 39.40575 40.0 40.0 40.0 39.0 40.0 8 39.46475 40.0 40.0 40.0 39.0 40.0 9 39.48325 40.0 40.0 40.0 39.0 40.0 10-14 39.501599999999996 40.0 40.0 40.0 39.0 40.0 15-19 39.4798 40.0 40.0 40.0 39.0 40.0 20-24 39.47495 40.0 40.0 40.0 39.0 40.0 25-29 39.44835 40.0 40.0 40.0 39.0 40.0 30-34 39.4259 40.0 40.0 40.0 39.0 40.0 35-39 39.36215 40.0 40.0 40.0 39.0 40.0 40-44 39.34115 40.0 40.0 40.0 39.0 40.0 45-49 39.36835 40.0 40.0 40.0 39.0 40.0 50-54 39.34955 40.0 40.0 40.0 39.0 40.0 55-59 39.277049999999996 40.0 40.0 40.0 39.0 40.0 60-64 39.24275 40.0 40.0 40.0 39.0 40.0 65-69 39.25745 40.0 40.0 40.0 39.0 40.0 70-74 39.218399999999995 40.0 40.0 40.0 39.0 40.0 75-79 39.1896 40.0 40.0 40.0 39.0 40.0 80-84 39.154250000000005 40.0 40.0 40.0 39.0 40.0 85-89 39.092850000000006 40.0 40.0 40.0 38.8 40.0 90-94 38.94195 40.0 40.0 40.0 38.0 40.0 95-99 38.98995 40.0 40.0 40.0 38.0 40.0 100-104 38.5632 39.6 39.0 39.8 37.2 40.0 105-109 38.97709999999999 40.0 39.8 40.0 38.0 40.0 110-114 38.93984999999999 40.0 39.6 40.0 38.2 40.0 115-119 38.856300000000005 40.0 39.2 40.0 38.0 40.0 120-124 38.8463 40.0 39.0 40.0 37.8 40.0 125-129 38.7121 40.0 39.0 40.0 37.0 40.0 130-134 38.547900000000006 40.0 39.0 40.0 36.6 40.0 135-139 38.37349999999999 40.0 39.0 40.0 36.0 40.0 140-144 38.181349999999995 40.0 39.0 40.0 36.0 40.0 145-149 37.7167 39.8 39.0 40.0 35.0 40.0 150-151 34.864875 38.0 35.0 39.5 25.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 5.0 20 4.0 21 6.0 22 4.0 23 8.0 24 5.0 25 5.0 26 8.0 27 11.0 28 8.0 29 18.0 30 18.0 31 24.0 32 27.0 33 25.0 34 36.0 35 58.0 36 75.0 37 150.0 38 304.0 39 3197.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.9 16.675 13.325000000000001 48.1 2 19.775000000000002 25.4 41.05 13.775 3 17.275 27.625 31.2 23.9 4 20.7 34.525 22.7 22.075 5 23.275000000000002 36.775000000000006 23.375 16.575 6 17.125 39.0 24.45 19.425 7 18.4 18.675 42.075 20.849999999999998 8 18.8 21.7 32.75 26.75 9 20.05 23.275000000000002 31.374999999999996 25.3 10-14 22.3 28.18 27.02 22.5 15-19 22.245 27.839999999999996 28.055000000000003 21.86 20-24 22.515 28.225 27.694999999999997 21.565 25-29 22.525000000000002 28.51 27.6 21.365000000000002 30-34 22.09 28.244999999999997 27.915 21.75 35-39 22.515 27.87 28.015 21.6 40-44 22.085 27.755000000000003 28.48 21.68 45-49 22.37 27.884999999999998 28.13 21.615000000000002 50-54 22.735 27.565 28.57 21.13 55-59 22.48 28.360000000000003 27.700000000000003 21.46 60-64 22.82 28.075 27.575 21.529999999999998 65-69 23.235 27.35 28.215 21.2 70-74 22.54 27.6 28.470000000000002 21.39 75-79 22.865 27.77 28.139999999999997 21.224999999999998 80-84 23.51 27.794999999999998 27.485 21.21 85-89 23.015 28.470000000000002 27.875 20.64 90-94 23.405 28.28 27.529999999999998 20.785 95-99 23.474999999999998 28.055000000000003 27.644999999999996 20.825 100-104 23.325000000000003 28.03 27.845 20.8 105-109 23.39 28.08 27.845 20.685000000000002 110-114 23.810000000000002 27.950000000000003 27.855 20.385 115-119 23.39 28.235 27.529999999999998 20.845 120-124 24.01 27.834999999999997 27.455000000000002 20.7 125-129 24.33 28.04 27.01 20.62 130-134 23.365 28.415000000000003 27.755000000000003 20.465 135-139 24.38 28.194999999999997 27.115000000000002 20.31 140-144 24.515 28.595 26.865 20.025000000000002 145-149 24.84 28.23 27.125 19.805 150-151 25.324999999999996 27.8875 27.1125 19.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.5 24 2.0 25 1.5 26 4.0 27 7.5 28 8.5 29 9.5 30 11.5 31 16.0 32 25.0 33 30.5 34 45.5 35 65.0 36 88.5 37 118.5 38 137.0 39 162.0 40 187.0 41 239.0 42 288.0 43 274.5 44 269.0 45 282.0 46 268.0 47 252.5 48 244.0 49 202.5 50 159.5 51 129.0 52 102.5 53 95.0 54 77.5 55 50.5 56 34.0 57 30.0 58 24.5 59 17.5 60 12.5 61 9.0 62 7.0 63 4.0 64 2.5 65 0.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44598337950139 98.725 2 0.45328632586250317 0.8999999999999999 3 0.07554772097708386 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.02518257365902795 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCTCAGTTAGCTAATTAATTTCCGAGTTTCTTAGCAACCAGTCTACAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2125 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 2.0374999999999996 0.0 0.0 0.0 0.0 120-121 2.2375 0.0 0.0 0.0 0.0 122-123 2.4000000000000004 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 2.975 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.5 0.0 0.0 0.0 0.0 132-133 3.9125 0.0 0.0 0.0 0.0 134-135 4.425 0.0 0.0 0.0 0.0 136-137 4.625 0.0 0.0 0.0 0.0 138-139 5.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTTTC 10 0.006830828 145.0 4 AGATCGG 40 0.0076550315 18.125 140-144 >>END_MODULE Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688740 spots for SRR6232771.sra Written 688740 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra Read 688722 spots for SRR6232771.sra Written 688722 spots for SRR6232771.sra SRR ids: ['SRR6232771.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4n_t7_g3 SRR6232771.sra spots: 13774458 blocks: [[1, 688722], [688723, 1377444], [1377445, 2066166], [2066167, 2754888], [2754889, 3443610], [3443611, 4132332], [4132333, 4821054], [4821055, 5509776], [5509777, 6198498], [6198499, 6887220], [6887221, 7575942], [7575943, 8264664], [8264665, 8953386], [8953387, 9642108], [9642109, 10330830], [10330831, 11019552], [11019553, 11708274], [11708275, 12396996], [12396997, 13085718], [13085719, 13774458]] SRR6232771 file size 4646011 SRR6232771 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6232771 SRR6232771_1.fastq SRR6232771_2.fastq Input file: SRR6232771_1.fastq Paired file: SRR6232771_2.fastq trimmed: SRR6232771-trimmed-pair1.fastq, SRR6232771-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:50:04 2025 >> started Wed Feb 12 09:50:19 2025 >> done (14.806s) 13774458 read pairs processed; of these: 1643 ( 0.01%) short read pairs filtered out after trimming by size control 5717 ( 0.04%) empty read pairs filtered out after trimming by size control 13767098 (99.95%) read pairs available; of these: 2119541 (15.40%) trimmed read pairs available after processing 11647557 (84.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 8 0.00% 20 4 0.00% 21 6 0.00% 22 5 0.00% 23 2 0.00% 24 3 0.00% 25 2 0.00% 26 4 0.00% 27 2 0.00% 28 3 0.00% 29 9 0.00% 30 8 0.00% 31 3 0.00% 32 1 0.00% 33 6 0.00% 34 7 0.00% 35 6 0.00% 36 7 0.00% 37 6 0.00% 38 7 0.00% 39 13 0.00% 40 16 0.00% 41 16 0.00% 42 23 0.00% 43 19 0.00% 44 9 0.00% 45 24 0.00% 46 21 0.00% 47 16 0.00% 48 22 0.00% 49 31 0.00% 50 30 0.00% 51 42 0.00% 52 44 0.00% 53 43 0.00% 54 46 0.00% 55 56 0.00% 56 62 0.00% 57 66 0.00% 58 75 0.00% 59 82 0.00% 60 96 0.00% 61 89 0.00% 62 98 0.00% 63 121 0.00% 64 152 0.00% 65 133 0.00% 66 153 0.00% 67 165 0.00% 68 188 0.00% 69 217 0.00% 70 237 0.00% 71 260 0.00% 72 284 0.00% 73 316 0.00% 74 334 0.00% 75 379 0.00% 76 472 0.00% 77 511 0.00% 78 549 0.00% 79 637 0.00% 80 683 0.00% 81 815 0.01% 82 894 0.01% 83 999 0.01% 84 1179 0.01% 85 1420 0.01% 86 1532 0.01% 87 1702 0.01% 88 1889 0.01% 89 2067 0.02% 90 2388 0.02% 91 2755 0.02% 92 3002 0.02% 93 3332 0.02% 94 3957 0.03% 95 4111 0.03% 96 4458 0.03% 97 4869 0.04% 98 5214 0.04% 99 5718 0.04% 100 6176 0.04% 101 6627 0.05% 102 7302 0.05% 103 7836 0.06% 104 8529 0.06% 105 9175 0.07% 106 10096 0.07% 107 11043 0.08% 108 11831 0.09% 109 12924 0.09% 110 13550 0.10% 111 14165 0.10% 112 15514 0.11% 113 15953 0.12% 114 16690 0.12% 115 18041 0.13% 116 19373 0.14% 117 20435 0.15% 118 21360 0.16% 119 22222 0.16% 120 23147 0.17% 121 24366 0.18% 122 24806 0.18% 123 25725 0.19% 124 26924 0.20% 125 28458 0.21% 126 28978 0.21% 127 31055 0.23% 128 32253 0.23% 129 33657 0.24% 130 34482 0.25% 131 35220 0.26% 132 36254 0.26% 133 37420 0.27% 134 38443 0.28% 135 39903 0.29% 136 41424 0.30% 137 42936 0.31% 138 44588 0.32% 139 46524 0.34% 140 47777 0.35% 141 49263 0.36% 142 51423 0.37% 143 52768 0.38% 144 54767 0.40% 145 58219 0.42% 146 62480 0.45% 147 68157 0.50% 148 78451 0.57% 149 100417 0.73% 150 491180 3.57% 151 11647557 84.60% 13767098 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=4.15 fanout-score-rank=24 prefix-density=0.17 prefix-fanout=3.1 sequence=CTGGTCTTCGCATACTTACCTTCGGCAAAGGTCAACTTCTTGATAGTCCCAGGGCCTCCATTTCCTTTGATTGTTTCAATACTCTTCACAGCCTGCGGCACGAGCTTGGGAATGAGGGTGTCAGCCTCAAGTACCATGGCCGTGAACAACCTTTTAGCCGCGGCGGGGCTGGAGAACTCCTCAGTGAATGTGAGAACTTCCATGATTTTTTCTAAAGCAAACAATGAAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=11 fanout-score=430.24 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=37.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=19.88 fanout-score-rank=9 prefix-density=0.29 prefix-fanout=8.1 sequence=GAGGTTGAGTACAGGTGCTTTGTTGGTGGCCTCGCATGGGCCACTACTGACCAATCCCTTCAAGAAGCGTTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAACGATCGTGAAACTGGAAGATCTCGCGGCTTTGGATTTGTTACCTTCAACAACGAGAAGGCAAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=6 fanout-score=343.04 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=33.4 sequence=AAGAAGAAGAAA SRR6232771 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:51:04 Started mapping on | Feb 12 09:51:04 Finished on | Feb 12 09:53:10 Mapping speed, Million of reads per hour | 393.35 Number of input reads | 13767098 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12755877 Uniquely mapped reads % | 92.65% Average mapped length | 296.47 Number of splices: Total | 12328255 Number of splices: Annotated (sjdb) | 12084340 Number of splices: GT/AG | 12062789 Number of splices: GC/AG | 218864 Number of splices: AT/AC | 10815 Number of splices: Non-canonical | 35787 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 470383 % of reads mapped to multiple loci | 3.42% Number of reads mapped to too many loci | 69069 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 543118 543118 543118 N_multimapping 470383 470383 470383 N_noFeature 408443 12614665 492929 N_ambiguous 132170 928 74744 UnstrandedReadsAssigned:12215264 PositiveStrandReadsAssigned:140284 NegativeStrandReadsAssigned:12188204 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6232771 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6232771-trimmed-pair1.fastq SRR6232771-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,767,098 reads, 12,287,714 reads pseudoaligned [quant] estimated average fragment length: 251.89 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52401 SRR6232771.ke.tsv 34699 SRR6232771.se.tsv 87100 total ==> SRR6232771.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.11 340 15.9473 Potri.005G024800.1.v4.1 1035 784.11 24 2.53692 Potri.004G059700.1.v4.1 961 710.189 81 9.45329 Potri.007G009000.2.v4.1 1416 1165.11 1 0.0711385 Potri.003G141000.2.v4.1 2943 2692.11 305.136 9.39446 Potri.016G087400.1.v4.1 270 82.0927 1190 1201.47 Potri.015G069301.1.v4.1 564 321.446 0 0 Potri.010G195200.1.v4.1 1773 1522.11 6 0.326721 Potri.012G127500.1.v4.1 977 726.163 1535 175.205 ==> SRR6232771.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 208 Potri.001G212900.v4.1 90 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR6232771 completed mapping pipeline successfully