Starting /dee2/code/volunteer_pipeline.sh SRR6509752 current disk space = 3050536673280 free memory = 1581308432 SRR6509752 SRAfilesize 52d67a2f6d0ebc87ce7f850bd55f71e3 SRR6509752.sra SRR6509752.sra file validated SRR6509752 is single end SRR6509752 is conventional basespace SRR6509752 read1 length is 49 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6509752_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.716 38.0 37.0 38.0 35.0 38.0 2 36.53425 38.0 36.0 38.0 34.0 38.0 3 36.59975 38.0 36.0 38.0 34.0 38.0 4 36.4665 38.0 36.0 38.0 34.0 38.0 5 36.5365 38.0 36.0 38.0 34.0 38.0 6 36.53975 38.0 36.0 38.0 35.0 38.0 7 36.57025 38.0 36.0 38.0 34.0 38.0 8 36.39325 38.0 36.0 38.0 33.0 38.0 9 36.481 38.0 36.0 38.0 34.0 38.0 10 36.40225 38.0 36.0 38.0 33.0 38.0 11 36.51075 38.0 36.0 38.0 34.0 38.0 12 36.43475 38.0 36.0 38.0 33.0 38.0 13 36.44175 38.0 36.0 38.0 33.0 38.0 14 36.29125 38.0 36.0 38.0 33.0 38.0 15 36.2765 38.0 36.0 38.0 33.0 38.0 16 36.226 38.0 36.0 38.0 33.0 38.0 17 35.977 38.0 36.0 38.0 32.0 38.0 18 35.94 38.0 36.0 38.0 32.0 38.0 19 36.09375 38.0 36.0 38.0 33.0 38.0 20 35.97325 38.0 36.0 38.0 32.0 38.0 21 35.97575 38.0 36.0 38.0 32.0 38.0 22 35.8 38.0 36.0 38.0 32.0 38.0 23 35.83325 38.0 36.0 38.0 32.0 38.0 24 35.641 37.0 35.0 38.0 32.0 38.0 25 35.6405 37.0 35.0 38.0 31.0 38.0 26 35.43825 37.0 35.0 38.0 31.0 38.0 27 35.0245 37.0 35.0 38.0 30.0 38.0 28 35.0745 37.0 35.0 38.0 30.0 38.0 29 34.98475 37.0 35.0 38.0 30.0 38.0 30 34.55475 37.0 35.0 38.0 29.0 38.0 31 34.53275 37.0 35.0 38.0 29.0 38.0 32 34.41675 37.0 34.0 38.0 29.0 38.0 33 34.15375 37.0 34.0 38.0 28.0 38.0 34 34.006 36.0 34.0 38.0 28.0 38.0 35 33.7255 36.0 33.0 38.0 28.0 38.0 36 33.42675 36.0 33.0 38.0 26.0 38.0 37 33.4295 36.0 33.0 38.0 27.0 38.0 38 33.108 36.0 33.0 38.0 25.0 38.0 39 32.83325 36.0 32.0 38.0 25.0 38.0 40 32.683 36.0 32.0 38.0 25.0 38.0 41 32.3055 36.0 32.0 37.0 22.0 38.0 42 32.07475 36.0 32.0 37.0 21.0 38.0 43 31.9495 36.0 32.0 37.0 21.0 38.0 44 31.64125 35.0 31.0 37.0 20.0 38.0 45 32.124 36.0 32.0 38.0 20.0 38.0 46 32.148 36.0 32.0 38.0 20.0 38.0 47 32.03525 36.0 32.0 38.0 20.0 38.0 48 31.76575 36.0 32.0 38.0 19.0 38.0 49 31.76075 36.0 32.0 38.0 17.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 2.0 9 2.0 10 1.0 11 5.0 12 6.0 13 6.0 14 8.0 15 11.0 16 7.0 17 12.0 18 13.0 19 15.0 20 18.0 21 19.0 22 30.0 23 23.0 24 16.0 25 34.0 26 33.0 27 48.0 28 60.0 29 73.0 30 66.0 31 109.0 32 139.0 33 173.0 34 261.0 35 418.0 36 731.0 37 1656.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.798647633358375 17.60581016779364 5.985474580515903 48.61006761833208 2 19.1 22.0 45.775 13.125 3 16.950000000000003 22.675 31.900000000000002 28.475 4 21.25 33.074999999999996 24.775 20.9 5 22.15 35.225 25.074999999999996 17.549999999999997 6 16.875 34.875 29.849999999999998 18.4 7 16.975 17.525 42.95 22.55 8 17.45 24.099999999999998 33.15 25.3 9 20.349999999999998 20.45 34.75 24.45 10 20.45 37.2 24.15 18.2 11 25.7 28.499999999999996 22.025 23.775 12 22.925 23.775 27.3 26.0 13 20.674999999999997 26.650000000000002 30.825000000000003 21.85 14 22.025 27.775 28.125 22.075 15 23.5 26.674999999999997 26.525 23.3 16 22.0 27.675 27.375 22.95 17 21.275 29.45 26.200000000000003 23.075000000000003 18 21.475 27.675 27.500000000000004 23.35 19 22.95 26.924999999999997 27.825 22.3 20 23.974999999999998 28.050000000000004 24.95 23.025000000000002 21 21.075 27.55 28.050000000000004 23.325000000000003 22 21.925 26.075 28.7 23.3 23 22.650000000000002 27.1 27.700000000000003 22.55 24 22.15 27.85 27.750000000000004 22.25 25 22.25 29.9 25.974999999999998 21.875 26 22.650000000000002 27.875 27.075 22.400000000000002 27 20.525 30.049999999999997 26.400000000000002 23.025000000000002 28 23.525 26.85 26.625 23.0 29 22.575 27.775 26.900000000000002 22.75 30 22.400000000000002 27.425 27.325 22.85 31 22.175 28.275 26.8 22.75 32 22.05 27.450000000000003 27.650000000000002 22.85 33 22.075 27.450000000000003 26.700000000000003 23.775 34 22.625 27.800000000000004 27.075 22.5 35 22.400000000000002 27.875 27.55 22.175 36 21.675 27.775 27.400000000000002 23.150000000000002 37 22.35 28.325 26.5 22.825 38 22.6 27.85 27.125 22.425 39 21.9 26.825 27.875 23.400000000000002 40 23.175 27.925 26.625 22.275 41 22.55 27.175 28.075 22.2 42 22.475 26.625 28.025 22.875 43 23.1 26.6 27.500000000000004 22.8 44 22.575 28.175 27.1 22.15 45 21.975 27.6 26.6 23.825 46 23.95 26.05 26.674999999999997 23.325000000000003 47 22.425 27.450000000000003 27.950000000000003 22.175 48 22.375 26.150000000000002 26.85 24.625 49 23.25 27.200000000000003 26.825 22.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 1.0 16 0.0 17 1.0 18 2.0 19 2.0 20 2.0 21 3.5 22 5.0 23 10.0 24 15.0 25 15.0 26 19.5 27 24.0 28 39.0 29 54.0 30 64.0 31 74.0 32 91.0 33 108.0 34 139.0 35 170.0 36 202.0 37 234.0 38 270.0 39 306.0 40 335.5 41 365.0 42 389.0 43 413.0 44 410.0 45 407.0 46 401.0 47 395.0 48 399.0 49 403.0 50 353.5 51 304.0 52 270.0 53 236.0 54 205.5 55 175.0 56 152.5 57 130.0 58 99.5 59 69.0 60 65.0 61 61.0 62 34.0 63 7.0 64 11.0 65 15.0 66 13.0 67 11.0 68 8.0 69 5.0 70 3.0 71 1.0 72 1.0 73 1.0 74 1.5 75 2.0 76 2.0 77 1.5 78 1.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 49 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06400202377941 97.89999999999999 2 0.8348090058183658 1.6500000000000001 3 0.025297242600556536 0.075 4 0.05059448520111307 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025297242600556536 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 5 (100% over 48bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.2 0.0 0.0 0.0 0.0 3 0.2 0.0 0.0 0.0 0.025 4 0.2 0.0 0.0 0.0 0.025 5 0.2 0.0 0.0 0.0 0.025 6 0.2 0.0 0.0 0.0 0.025 7 0.2 0.0 0.0 0.0 0.025 8 0.2 0.0 0.0 0.0 0.025 9 0.2 0.0 0.0 0.0 0.025 10 0.2 0.0 0.0 0.0 0.025 11 0.2 0.0 0.0 0.0 0.025 12 0.2 0.0 0.0 0.0 0.025 13 0.2 0.0 0.0 0.0 0.025 14 0.2 0.0 0.0 0.0 0.025 15 0.2 0.0 0.0 0.0 0.025 16 0.2 0.0 0.0 0.0 0.025 17 0.2 0.0 0.0 0.0 0.025 18 0.2 0.0 0.0 0.0 0.025 19 0.2 0.0 0.0 0.0 0.025 20 0.2 0.0 0.0 0.0 0.025 21 0.2 0.0 0.0 0.0 0.025 22 0.2 0.0 0.0 0.0 0.025 23 0.2 0.0 0.0 0.0 0.025 24 0.2 0.0 0.0 0.0 0.025 25 0.2 0.0 0.0 0.0 0.025 26 0.2 0.0 0.0 0.0 0.025 27 0.2 0.0 0.0 0.0 0.025 28 0.2 0.0 0.0 0.0 0.025 29 0.2 0.0 0.0 0.0 0.025 30 0.2 0.0 0.0 0.0 0.025 31 0.2 0.0 0.0 0.0 0.025 32 0.2 0.0 0.0 0.0 0.025 33 0.2 0.0 0.0 0.0 0.025 34 0.2 0.0 0.0 0.0 0.025 35 0.2 0.0 0.0 0.0 0.025 36 0.2 0.0 0.0 0.0 0.025 37 0.2 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313130 spots for SRR6509752.sra Written 313130 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra Read 313124 spots for SRR6509752.sra Written 313124 spots for SRR6509752.sra SRR ids: ['SRR6509752.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eel4g069 SRR6509752.sra spots: 6262486 blocks: [[1, 313124], [313125, 626248], [626249, 939372], [939373, 1252496], [1252497, 1565620], [1565621, 1878744], [1878745, 2191868], [2191869, 2504992], [2504993, 2818116], [2818117, 3131240], [3131241, 3444364], [3444365, 3757488], [3757489, 4070612], [4070613, 4383736], [4383737, 4696860], [4696861, 5009984], [5009985, 5323108], [5323109, 5636232], [5636233, 5949356], [5949357, 6262486]] SRR6509752 file size 981800 SRR6509752 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6509752 SRR6509752_1.fastq Input file: SRR6509752_1.fastq trimmed: SRR6509752-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:18:58 2025 >> started Wed Feb 12 22:19:01 2025 >> done (2.770s) 6262486 reads processed; of these: 11766 ( 0.19%) short reads filtered out after trimming by size control 14033 ( 0.22%) empty reads filtered out after trimming by size control 6236687 (99.59%) reads available; of these: 513278 ( 8.23%) trimmed reads available after processing 5723409 (91.77%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1834 0.03% 19 3340 0.05% 20 5642 0.09% 21 2265 0.04% 22 3206 0.05% 23 5209 0.08% 24 10094 0.16% 25 15480 0.25% 26 5436 0.09% 27 6443 0.10% 28 9231 0.15% 29 14791 0.24% 30 23466 0.38% 31 7430 0.12% 32 9754 0.16% 33 13615 0.22% 34 21345 0.34% 35 32977 0.53% 36 10692 0.17% 37 13993 0.22% 38 18131 0.29% 39 29287 0.47% 40 44916 0.72% 41 14523 0.23% 42 18137 0.29% 43 23931 0.38% 44 32181 0.52% 45 51286 0.82% 46 16080 0.26% 47 18916 0.30% 48 29647 0.48% 49 5723409 91.77% 6236687 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.08 fanout-score-rank=14 prefix-density=0.20 prefix-fanout=3.5 sequence=CCAATCTACAAGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=20.65 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=3.6 sequence=ATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGCTTTGAATGGCTCTGGCGCTGGATCCACAGTCCCAAATTCAGCTTTCTTTGGCAACAGCTTGAAGAAAGTGAGCTCATCAAGGTTCACAAACTCCAAAATTTCATCAGGGAGCTTCAAGGTTGTTGCAGAGTACGATGAGGAGAAGCAGACCGACAAGGACAGATGGGGAGGCCTTGTTACAGACATGTCT Started job on | Feb 12 22:19:16 Started mapping on | Feb 12 22:19:16 Finished on | Feb 12 22:19:33 Mapping speed, Million of reads per hour | 1320.71 Number of input reads | 6236687 Average input read length | 48 UNIQUE READS: Uniquely mapped reads number | 5418324 Uniquely mapped reads % | 86.88% Average mapped length | 47.79 Number of splices: Total | 706169 Number of splices: Annotated (sjdb) | 692953 Number of splices: GT/AG | 691796 Number of splices: GC/AG | 11181 Number of splices: AT/AC | 501 Number of splices: Non-canonical | 2691 Mismatch rate per base, % | 1.91% Deletion rate per base | 0.03% Deletion average length | 1.99 Insertion rate per base | 0.02% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 578262 % of reads mapped to multiple loci | 9.27% Number of reads mapped to too many loci | 23727 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.45% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 240101 240101 240101 N_multimapping 578262 578262 578262 N_noFeature 132697 2447314 3078310 N_ambiguous 51964 15011 11597 UnstrandedReadsAssigned:5233663 PositiveStrandReadsAssigned:2955999 NegativeStrandReadsAssigned:2328417 Dataset is classified unstranded MeadianReadLen=49 20thPercentileLength=49 echo kmer=45 SRR6509752 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR6509752-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,236,687 reads, 4,097,059 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR6509752.ke.tsv 34699 SRR6509752.se.tsv 87100 total ==> SRR6509752.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 65.1282 10.9789 Potri.005G024800.1.v4.1 1035 936 22.0174 7.60944 Potri.004G059700.1.v4.1 961 862 3 1.12584 Potri.007G009000.2.v4.1 1416 1317 1 0.245628 Potri.003G141000.2.v4.1 2943 2844 75.7998 8.62188 Potri.016G087400.1.v4.1 270 171 83.1797 157.357 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 69 25.4225 ==> SRR6509752.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 31 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR6509752 completed mapping pipeline successfully