Starting /dee2/code/volunteer_pipeline.sh SRR6509753 current disk space = 3050463055872 free memory = 1572397392 SRR6509753 SRAfilesize 71849453561303f002da01f607c80662 SRR6509753.sra SRR6509753.sra file validated SRR6509753 is single end SRR6509753 is conventional basespace SRR6509753 read1 length is 49 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6509753_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7445 38.0 37.0 38.0 35.0 38.0 2 36.49325 38.0 36.0 38.0 34.0 38.0 3 36.564 38.0 36.0 38.0 34.0 38.0 4 36.50925 38.0 36.0 38.0 33.0 38.0 5 36.5905 38.0 36.0 38.0 34.0 38.0 6 36.55125 38.0 36.0 38.0 34.0 38.0 7 36.531 38.0 36.0 38.0 34.0 38.0 8 36.4405 38.0 36.0 38.0 33.0 38.0 9 36.48775 38.0 36.0 38.0 33.0 38.0 10 36.46775 38.0 36.0 38.0 33.0 38.0 11 36.50825 38.0 36.0 38.0 34.0 38.0 12 36.4385 38.0 36.0 38.0 33.0 38.0 13 36.38525 38.0 36.0 38.0 33.0 38.0 14 36.30425 38.0 36.0 38.0 33.0 38.0 15 36.27675 38.0 36.0 38.0 33.0 38.0 16 36.2615 38.0 36.0 38.0 33.0 38.0 17 35.972 38.0 36.0 38.0 32.0 38.0 18 36.00975 38.0 36.0 38.0 32.0 38.0 19 36.1395 38.0 36.0 38.0 32.0 38.0 20 36.00975 38.0 36.0 38.0 32.0 38.0 21 36.07375 38.0 36.0 38.0 32.0 38.0 22 35.87975 38.0 35.0 38.0 32.0 38.0 23 35.78525 37.0 35.0 38.0 32.0 38.0 24 35.621 37.0 35.0 38.0 31.0 38.0 25 35.6905 37.0 35.0 38.0 32.0 38.0 26 35.536 37.0 35.0 38.0 32.0 38.0 27 35.2185 37.0 35.0 38.0 30.0 38.0 28 35.2335 37.0 35.0 38.0 30.0 38.0 29 35.12225 37.0 35.0 38.0 30.0 38.0 30 34.72425 37.0 35.0 38.0 29.0 38.0 31 34.6935 37.0 35.0 38.0 29.0 38.0 32 34.50675 37.0 34.0 38.0 29.0 38.0 33 34.343 37.0 34.0 38.0 29.0 38.0 34 34.05725 37.0 34.0 38.0 28.0 38.0 35 33.974 36.0 33.0 38.0 28.0 38.0 36 33.652 36.0 33.0 38.0 27.0 38.0 37 33.58875 36.0 33.0 38.0 28.0 38.0 38 33.389 36.0 33.0 38.0 27.0 38.0 39 32.9475 36.0 32.0 38.0 25.0 38.0 40 32.84925 36.0 32.0 38.0 25.0 38.0 41 32.51325 36.0 32.0 38.0 24.0 38.0 42 32.27325 36.0 32.0 37.0 22.0 38.0 43 32.084 36.0 31.0 37.0 21.0 38.0 44 31.8965 36.0 31.0 37.0 21.0 38.0 45 32.401 36.0 32.0 38.0 24.0 38.0 46 32.611 36.0 33.0 38.0 25.0 38.0 47 32.429 36.0 32.0 38.0 24.0 38.0 48 32.18425 36.0 32.0 38.0 21.0 38.0 49 32.13675 36.0 32.0 38.0 22.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 2.0 13 3.0 14 3.0 15 10.0 16 6.0 17 9.0 18 15.0 19 10.0 20 14.0 21 17.0 22 27.0 23 28.0 24 30.0 25 33.0 26 42.0 27 43.0 28 50.0 29 62.0 30 66.0 31 99.0 32 165.0 33 206.0 34 252.0 35 439.0 36 703.0 37 1655.0 38 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.20240480961924 17.835671342685373 6.187374749498998 49.77454909819639 2 18.475 22.0 46.425 13.100000000000001 3 15.950000000000001 22.325 33.25 28.475 4 22.175 32.725 26.674999999999997 18.425 5 20.825 34.849999999999994 27.3 17.025000000000002 6 16.125 35.175 30.7 18.0 7 16.650000000000002 18.099999999999998 44.125 21.125 8 16.1 23.9 33.875 26.125 9 19.625 22.6 33.35 24.425 10 19.925 37.3 24.725 18.05 11 25.5 29.15 21.6 23.75 12 20.8 25.5 28.849999999999998 24.85 13 19.275000000000002 27.625 31.075000000000003 22.025 14 21.3 26.674999999999997 29.799999999999997 22.225 15 21.575 26.75 28.449999999999996 23.225 16 20.625 28.575 28.125 22.675 17 20.175 29.2 27.725 22.900000000000002 18 22.650000000000002 25.525 27.525 24.3 19 21.7 27.175 28.199999999999996 22.925 20 21.6 28.4 27.700000000000003 22.3 21 22.05 27.925 27.525 22.5 22 22.25 28.225 27.375 22.15 23 20.9 27.6 29.375 22.125 24 22.325 28.375 26.5 22.8 25 21.375 27.700000000000003 28.799999999999997 22.125 26 22.05 27.224999999999998 28.975 21.75 27 21.4 26.924999999999997 27.825 23.849999999999998 28 21.625 27.250000000000004 28.175 22.95 29 22.525000000000002 26.650000000000002 28.175 22.650000000000002 30 21.0 28.499999999999996 28.325 22.175 31 22.475 26.924999999999997 28.175 22.425 32 22.35 27.875 27.650000000000002 22.125 33 21.4 28.025 27.1 23.474999999999998 34 22.35 27.474999999999998 28.15 22.025 35 22.5 26.825 29.9 20.775 36 21.525 27.0 28.549999999999997 22.925 37 22.35 27.875 27.175 22.6 38 22.3 27.150000000000002 29.325000000000003 21.224999999999998 39 21.75 28.499999999999996 27.200000000000003 22.55 40 22.625 28.225 27.700000000000003 21.45 41 22.125 26.3 27.650000000000002 23.925 42 22.675 27.575 27.900000000000002 21.85 43 22.85 27.525 27.0 22.625 44 23.075000000000003 27.275 27.725 21.925 45 22.475 28.65 26.825 22.05 46 21.55 29.15 26.6 22.7 47 21.55 28.4 27.750000000000004 22.3 48 21.45 27.6 27.525 23.425 49 21.65 28.299999999999997 26.474999999999998 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 3.5 20 7.0 21 6.5 22 6.0 23 12.5 24 19.0 25 19.0 26 25.0 27 31.0 28 44.0 29 57.0 30 67.0 31 77.0 32 104.5 33 132.0 34 149.0 35 166.0 36 227.0 37 288.0 38 314.5 39 341.0 40 372.5 41 404.0 42 428.5 43 453.0 44 441.0 45 429.0 46 395.5 47 362.0 48 364.5 49 367.0 50 321.0 51 275.0 52 231.5 53 188.0 54 172.0 55 156.0 56 131.5 57 107.0 58 89.0 59 71.0 60 48.0 61 25.0 62 20.5 63 16.0 64 13.0 65 10.0 66 7.5 67 5.0 68 4.0 69 3.0 70 3.0 71 3.0 72 1.5 73 0.0 74 0.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 49 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5534591194968553 1.0999999999999999 3 0.0 0.0 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313436 spots for SRR6509753.sra Written 313436 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra Read 313417 spots for SRR6509753.sra Written 313417 spots for SRR6509753.sra SRR ids: ['SRR6509753.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o17sqh7r SRR6509753.sra spots: 6268359 blocks: [[1, 313417], [313418, 626834], [626835, 940251], [940252, 1253668], [1253669, 1567085], [1567086, 1880502], [1880503, 2193919], [2193920, 2507336], [2507337, 2820753], [2820754, 3134170], [3134171, 3447587], [3447588, 3761004], [3761005, 4074421], [4074422, 4387838], [4387839, 4701255], [4701256, 5014672], [5014673, 5328089], [5328090, 5641506], [5641507, 5954923], [5954924, 6268359]] SRR6509753 file size 982461 SRR6509753 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6509753 SRR6509753_1.fastq Input file: SRR6509753_1.fastq trimmed: SRR6509753-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:43:00 2025 >> started Wed Feb 12 22:43:02 2025 >> done (2.871s) 6268359 reads processed; of these: 12334 ( 0.20%) short reads filtered out after trimming by size control 15211 ( 0.24%) empty reads filtered out after trimming by size control 6240814 (99.56%) reads available; of these: 491907 ( 7.88%) trimmed reads available after processing 5748907 (92.12%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1942 0.03% 19 3337 0.05% 20 5511 0.09% 21 2163 0.03% 22 3238 0.05% 23 5055 0.08% 24 9607 0.15% 25 15363 0.25% 26 4996 0.08% 27 6118 0.10% 28 8842 0.14% 29 13844 0.22% 30 22289 0.36% 31 7081 0.11% 32 9132 0.15% 33 12817 0.21% 34 19721 0.32% 35 30454 0.49% 36 10064 0.16% 37 13137 0.21% 38 17298 0.28% 39 27984 0.45% 40 42586 0.68% 41 14082 0.23% 42 17887 0.29% 43 23392 0.37% 44 31389 0.50% 45 50051 0.80% 46 15452 0.25% 47 18440 0.30% 48 28635 0.46% 49 5748907 92.12% 6240814 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=5.27 fanout-score-rank=16 prefix-density=0.08 prefix-fanout=4.4 sequence=CCAATCTACAAGCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=8 fanout-score=40.78 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=10.6 sequence=TGGTGGTGGAGG Started job on | Feb 12 22:43:17 Started mapping on | Feb 12 22:43:17 Finished on | Feb 12 22:43:36 Mapping speed, Million of reads per hour | 1182.47 Number of input reads | 6240814 Average input read length | 48 UNIQUE READS: Uniquely mapped reads number | 5366991 Uniquely mapped reads % | 86.00% Average mapped length | 47.79 Number of splices: Total | 750731 Number of splices: Annotated (sjdb) | 734458 Number of splices: GT/AG | 736268 Number of splices: GC/AG | 10695 Number of splices: AT/AC | 678 Number of splices: Non-canonical | 3090 Mismatch rate per base, % | 1.96% Deletion rate per base | 0.03% Deletion average length | 1.93 Insertion rate per base | 0.02% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 601124 % of reads mapped to multiple loci | 9.63% Number of reads mapped to too many loci | 16890 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.08% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 272699 272699 272699 N_multimapping 601124 601124 601124 N_noFeature 199234 2489822 3053747 N_ambiguous 43357 11938 8811 UnstrandedReadsAssigned:5124400 PositiveStrandReadsAssigned:2865231 NegativeStrandReadsAssigned:2304433 Dataset is classified unstranded MeadianReadLen=49 20thPercentileLength=49 echo kmer=45 SRR6509753 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR6509753-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,240,814 reads, 4,001,177 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR6509753.ke.tsv 34699 SRR6509753.se.tsv 87100 total ==> SRR6509753.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 194 32.8448 Potri.005G024800.1.v4.1 1035 936 32 11.1075 Potri.004G059700.1.v4.1 961 862 5 1.88453 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 127.661 14.5838 Potri.016G087400.1.v4.1 270 171 143.503 272.649 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 6 1.16449 Potri.012G127500.1.v4.1 977 878 68 25.1626 ==> SRR6509753.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 74 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR6509753 completed mapping pipeline successfully