Starting /dee2/code/volunteer_pipeline.sh SRR6509754 current disk space = 3050461229056 free memory = 1580954480 SRR6509754 SRAfilesize f7a4f4444b08e7349ff9e525ec326831 SRR6509754.sra SRR6509754.sra file validated SRR6509754 is single end SRR6509754 is conventional basespace SRR6509754 read1 length is 49 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6509754_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7485 38.0 37.0 38.0 35.0 38.0 2 36.5475 38.0 36.0 38.0 34.0 38.0 3 36.61975 38.0 37.0 38.0 34.0 38.0 4 36.57175 38.0 37.0 38.0 35.0 38.0 5 36.57175 38.0 37.0 38.0 34.0 38.0 6 36.588 38.0 37.0 38.0 35.0 38.0 7 36.5605 38.0 37.0 38.0 34.0 38.0 8 36.43375 38.0 36.0 38.0 33.0 38.0 9 36.48825 38.0 36.0 38.0 34.0 38.0 10 36.504 38.0 36.0 38.0 34.0 38.0 11 36.585 38.0 37.0 38.0 35.0 38.0 12 36.47825 38.0 36.0 38.0 34.0 38.0 13 36.4165 38.0 36.0 38.0 33.0 38.0 14 36.3395 38.0 36.0 38.0 33.0 38.0 15 36.386 38.0 36.0 38.0 33.0 38.0 16 36.34025 38.0 36.0 38.0 33.0 38.0 17 36.09 38.0 36.0 38.0 32.0 38.0 18 36.038 38.0 36.0 38.0 32.0 38.0 19 36.1325 38.0 36.0 38.0 33.0 38.0 20 36.176 38.0 36.0 38.0 33.0 38.0 21 36.14025 38.0 36.0 38.0 33.0 38.0 22 35.947 38.0 36.0 38.0 32.0 38.0 23 35.94625 38.0 36.0 38.0 32.0 38.0 24 35.831 37.0 36.0 38.0 32.0 38.0 25 35.806 37.0 36.0 38.0 32.0 38.0 26 35.58125 37.0 35.0 38.0 32.0 38.0 27 35.3515 37.0 35.0 38.0 31.0 38.0 28 35.2395 37.0 35.0 38.0 30.0 38.0 29 35.1305 37.0 35.0 38.0 30.0 38.0 30 34.853 37.0 35.0 38.0 30.0 38.0 31 34.8125 37.0 35.0 38.0 30.0 38.0 32 34.6085 37.0 35.0 38.0 29.0 38.0 33 34.481 37.0 34.0 38.0 29.0 38.0 34 34.31725 37.0 34.0 38.0 28.0 38.0 35 34.19725 37.0 34.0 38.0 28.0 38.0 36 34.056 36.0 34.0 38.0 28.0 38.0 37 33.87325 36.0 34.0 38.0 28.0 38.0 38 33.7315 36.0 33.0 38.0 28.0 38.0 39 33.296 36.0 33.0 38.0 25.0 38.0 40 33.16925 36.0 33.0 38.0 25.0 38.0 41 32.79325 36.0 32.0 38.0 25.0 38.0 42 32.62375 36.0 32.0 37.0 25.0 38.0 43 32.39475 36.0 32.0 37.0 24.0 38.0 44 32.3325 35.0 32.0 37.0 24.0 38.0 45 32.734 36.0 33.0 38.0 25.0 38.0 46 32.75925 36.0 33.0 38.0 25.0 38.0 47 32.5915 36.0 33.0 38.0 25.0 38.0 48 32.30925 36.0 32.0 38.0 23.0 38.0 49 32.41275 36.0 32.0 38.0 24.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 2.0 5 2.0 6 0.0 7 2.0 8 1.0 9 1.0 10 3.0 11 0.0 12 2.0 13 2.0 14 3.0 15 9.0 16 6.0 17 10.0 18 10.0 19 13.0 20 13.0 21 19.0 22 16.0 23 17.0 24 19.0 25 23.0 26 32.0 27 37.0 28 52.0 29 74.0 30 82.0 31 91.0 32 136.0 33 182.0 34 239.0 35 428.0 36 774.0 37 1689.0 38 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.777276147479306 18.585402558314524 5.919237521946326 51.718083772259845 2 16.625 21.725 49.45 12.2 3 15.15 21.349999999999998 34.075 29.425 4 21.0 31.15 26.924999999999997 20.925 5 20.525 34.925 28.7 15.85 6 15.325 35.199999999999996 31.525 17.95 7 16.05 17.5 45.525 20.925 8 16.075 22.525000000000002 34.449999999999996 26.950000000000003 9 19.05 21.925 34.65 24.375 10 20.45 37.175000000000004 24.85 17.525 11 24.825 28.65 22.275 24.25 12 21.325 25.025 29.225 24.425 13 19.375 28.225 30.675 21.725 14 20.875 27.425 29.075 22.625 15 20.925 28.575 27.975 22.525000000000002 16 20.825 28.675 28.525 21.975 17 21.975 28.625 27.275 22.125 18 21.325 28.249999999999996 29.65 20.775 19 22.25 28.1 27.175 22.475 20 22.35 27.85 27.425 22.375 21 21.224999999999998 27.875 28.4 22.5 22 21.5 28.225 28.449999999999996 21.825 23 22.15 28.075 27.950000000000003 21.825 24 21.8 28.599999999999998 27.675 21.925 25 21.8 28.575 27.825 21.8 26 21.325 28.749999999999996 28.425 21.5 27 21.15 27.55 27.825 23.474999999999998 28 21.3 28.375 28.675 21.65 29 21.9 28.225 28.675 21.2 30 22.55 26.900000000000002 28.849999999999998 21.7 31 21.325 27.975 27.875 22.825 32 21.6 28.15 29.575000000000003 20.674999999999997 33 21.675 28.725 27.85 21.75 34 22.650000000000002 28.65 26.5 22.2 35 21.7 29.575000000000003 27.625 21.099999999999998 36 22.625 26.0 29.225 22.15 37 21.875 28.325 27.425 22.375 38 22.025 29.075 28.775000000000002 20.125 39 22.7 26.525 27.750000000000004 23.025000000000002 40 20.974999999999998 28.175 28.15 22.7 41 21.55 28.725 28.000000000000004 21.725 42 21.825 28.299999999999997 27.150000000000002 22.725 43 22.45 28.4 27.55 21.6 44 21.125 28.575 28.799999999999997 21.5 45 23.05 27.150000000000002 28.675 21.125 46 23.5 27.825 26.974999999999998 21.7 47 22.625 28.499999999999996 28.125 20.75 48 22.2 27.250000000000004 27.775 22.775000000000002 49 21.875 27.575 27.500000000000004 23.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.5 14 2.0 15 3.5 16 5.0 17 4.5 18 4.0 19 3.5 20 3.0 21 7.0 22 11.0 23 14.5 24 18.0 25 18.0 26 24.5 27 31.0 28 44.0 29 57.0 30 83.0 31 109.0 32 119.0 33 129.0 34 160.5 35 192.0 36 231.0 37 270.0 38 313.5 39 357.0 40 385.0 41 413.0 42 430.5 43 448.0 44 435.0 45 422.0 46 413.5 47 405.0 48 394.5 49 384.0 50 320.5 51 257.0 52 221.0 53 185.0 54 157.5 55 130.0 56 99.5 57 69.0 58 60.5 59 52.0 60 35.5 61 19.0 62 15.5 63 12.0 64 10.0 65 8.0 66 5.5 67 3.0 68 3.5 69 4.0 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 49 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9113924050633 97.675 2 0.9620253164556962 1.9 3 0.0759493670886076 0.22499999999999998 4 0.05063291139240507 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297096 spots for SRR6509754.sra Written 297096 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra Read 297089 spots for SRR6509754.sra Written 297089 spots for SRR6509754.sra SRR ids: ['SRR6509754.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ctp34h5u SRR6509754.sra spots: 5941787 blocks: [[1, 297089], [297090, 594178], [594179, 891267], [891268, 1188356], [1188357, 1485445], [1485446, 1782534], [1782535, 2079623], [2079624, 2376712], [2376713, 2673801], [2673802, 2970890], [2970891, 3267979], [3267980, 3565068], [3565069, 3862157], [3862158, 4159246], [4159247, 4456335], [4456336, 4753424], [4753425, 5050513], [5050514, 5347602], [5347603, 5644691], [5644692, 5941787]] SRR6509754 file size 931109 SRR6509754 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6509754 SRR6509754_1.fastq Input file: SRR6509754_1.fastq trimmed: SRR6509754-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:52:54 2025 >> started Wed Feb 12 22:52:56 2025 >> done (2.472s) 5941787 reads processed; of these: 11080 ( 0.19%) short reads filtered out after trimming by size control 12757 ( 0.21%) empty reads filtered out after trimming by size control 5917950 (99.60%) reads available; of these: 436325 ( 7.37%) trimmed reads available after processing 5481625 (92.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1747 0.03% 19 2973 0.05% 20 5160 0.09% 21 2043 0.03% 22 2794 0.05% 23 4529 0.08% 24 8419 0.14% 25 13543 0.23% 26 4597 0.08% 27 5388 0.09% 28 8157 0.14% 29 12750 0.22% 30 19117 0.32% 31 6398 0.11% 32 8169 0.14% 33 11459 0.19% 34 17673 0.30% 35 27853 0.47% 36 9240 0.16% 37 11406 0.19% 38 15245 0.26% 39 23919 0.40% 40 37995 0.64% 41 12673 0.21% 42 15738 0.27% 43 20686 0.35% 44 27691 0.47% 45 43866 0.74% 46 12995 0.22% 47 17123 0.29% 48 24979 0.42% 49 5481625 92.63% 5917950 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=16 prefix-density=0.26 prefix-fanout=1.9 sequence=AGTCTTTTAGATCATCCATCTAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=11 fanout-score=68.19 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=11.6 sequence=CTTCTTCTTCTTGTTGAGCCCAATCCGAGGTCTGAGTTACAAAC Started job on | Feb 12 22:53:12 Started mapping on | Feb 12 22:53:12 Finished on | Feb 12 22:53:30 Mapping speed, Million of reads per hour | 1183.59 Number of input reads | 5917950 Average input read length | 48 UNIQUE READS: Uniquely mapped reads number | 5153281 Uniquely mapped reads % | 87.08% Average mapped length | 47.84 Number of splices: Total | 755996 Number of splices: Annotated (sjdb) | 741367 Number of splices: GT/AG | 740542 Number of splices: GC/AG | 11937 Number of splices: AT/AC | 531 Number of splices: Non-canonical | 2986 Mismatch rate per base, % | 1.92% Deletion rate per base | 0.04% Deletion average length | 1.97 Insertion rate per base | 0.02% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 497687 % of reads mapped to multiple loci | 8.41% Number of reads mapped to too many loci | 15396 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.23% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 266982 266982 266982 N_multimapping 497687 497687 497687 N_noFeature 241634 2418640 2952648 N_ambiguous 44531 11440 9515 UnstrandedReadsAssigned:4867116 PositiveStrandReadsAssigned:2723201 NegativeStrandReadsAssigned:2191118 Dataset is classified unstranded MeadianReadLen=49 20thPercentileLength=49 echo kmer=45 SRR6509754 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR6509754-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,917,950 reads, 3,776,896 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR6509754.ke.tsv 34699 SRR6509754.se.tsv 87100 total ==> SRR6509754.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 152 26.5552 Potri.005G024800.1.v4.1 1035 936 20 7.16365 Potri.004G059700.1.v4.1 961 862 5 1.94466 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 99.7328 11.7568 Potri.016G087400.1.v4.1 270 171 70.8717 138.95 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 12.7512 2.55373 Potri.012G127500.1.v4.1 977 878 44 16.8011 ==> SRR6509754.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 60 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 78 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR6509754 completed mapping pipeline successfully