Starting /dee2/code/volunteer_pipeline.sh SRR6509755 current disk space = 3050465042432 free memory = 1581734788 SRR6509755 SRAfilesize 6acec9ee7de04695cb054e6da3fc4fec SRR6509755.sra SRR6509755.sra file validated SRR6509755 is single end SRR6509755 is conventional basespace SRR6509755 read1 length is 49 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6509755_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7055 38.0 37.0 38.0 35.0 38.0 2 36.5365 38.0 36.0 38.0 34.0 38.0 3 36.641 38.0 37.0 38.0 35.0 38.0 4 36.5535 38.0 36.0 38.0 34.0 38.0 5 36.59475 38.0 36.0 38.0 34.0 38.0 6 36.55575 38.0 36.0 38.0 34.0 38.0 7 36.5155 38.0 36.0 38.0 34.0 38.0 8 36.3775 38.0 36.0 38.0 33.0 38.0 9 36.534 38.0 36.0 38.0 34.0 38.0 10 36.44325 38.0 36.0 38.0 33.0 38.0 11 36.49825 38.0 36.0 38.0 34.0 38.0 12 36.48425 38.0 36.0 38.0 34.0 38.0 13 36.402 38.0 36.0 38.0 33.0 38.0 14 36.30025 38.0 36.0 38.0 33.0 38.0 15 36.32075 38.0 36.0 38.0 33.0 38.0 16 36.28425 38.0 36.0 38.0 33.0 38.0 17 36.09875 38.0 36.0 38.0 32.0 38.0 18 35.99675 38.0 36.0 38.0 32.0 38.0 19 36.039 38.0 36.0 38.0 32.0 38.0 20 36.0055 38.0 36.0 38.0 32.0 38.0 21 35.99475 38.0 36.0 38.0 32.0 38.0 22 35.8335 38.0 36.0 38.0 32.0 38.0 23 35.814 38.0 36.0 38.0 32.0 38.0 24 35.61275 37.0 35.0 38.0 32.0 38.0 25 35.67775 37.0 35.0 38.0 32.0 38.0 26 35.46425 37.0 35.0 38.0 31.0 38.0 27 35.1935 37.0 35.0 38.0 30.0 38.0 28 35.19875 37.0 35.0 38.0 30.0 38.0 29 35.16075 37.0 35.0 38.0 30.0 38.0 30 34.67025 37.0 35.0 38.0 29.0 38.0 31 34.4515 37.0 35.0 38.0 28.0 38.0 32 34.386 37.0 34.0 38.0 29.0 38.0 33 34.1675 37.0 34.0 38.0 28.0 38.0 34 33.95775 36.0 33.0 38.0 28.0 38.0 35 33.81075 36.0 33.0 38.0 28.0 38.0 36 33.5915 36.0 33.0 38.0 27.0 38.0 37 33.517 36.0 33.0 38.0 27.0 38.0 38 33.3115 36.0 33.0 38.0 26.0 38.0 39 32.94525 36.0 33.0 38.0 25.0 38.0 40 32.92725 36.0 33.0 38.0 25.0 38.0 41 32.528 36.0 32.0 38.0 24.0 38.0 42 32.35475 36.0 32.0 37.0 24.0 38.0 43 32.2285 36.0 32.0 37.0 24.0 38.0 44 31.84175 35.0 31.0 37.0 20.0 38.0 45 32.35175 36.0 32.0 38.0 25.0 38.0 46 32.401 36.0 33.0 38.0 23.0 38.0 47 32.25525 36.0 32.0 38.0 21.0 38.0 48 31.94025 36.0 32.0 38.0 20.0 38.0 49 32.03725 36.0 32.0 38.0 21.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 2.0 10 2.0 11 4.0 12 4.0 13 6.0 14 8.0 15 10.0 16 8.0 17 9.0 18 10.0 19 10.0 20 16.0 21 20.0 22 20.0 23 14.0 24 29.0 25 35.0 26 45.0 27 46.0 28 47.0 29 60.0 30 89.0 31 102.0 32 121.0 33 203.0 34 260.0 35 448.0 36 727.0 37 1636.0 38 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.661650363681964 18.209179834462002 7.298720842738901 47.830448959117135 2 19.3 22.0 45.45 13.25 3 16.55 22.25 32.0 29.2 4 22.35 31.8 25.825 20.025000000000002 5 21.349999999999998 34.975 28.050000000000004 15.625 6 16.05 36.875 29.599999999999998 17.474999999999998 7 16.575 18.15 45.175 20.1 8 18.125 22.45 33.5 25.924999999999997 9 19.8 21.75 34.575 23.875 10 19.225 37.85 25.424999999999997 17.5 11 26.700000000000003 26.950000000000003 20.349999999999998 26.0 12 21.65 24.625 29.7 24.025 13 19.35 27.6 30.85 22.2 14 20.325 28.050000000000004 30.099999999999998 21.525 15 21.349999999999998 26.924999999999997 29.25 22.475 16 20.325 27.825 28.025 23.825 17 22.7 27.450000000000003 27.474999999999998 22.375 18 21.675 28.15 27.375 22.8 19 21.3 29.95 27.625 21.125 20 22.525000000000002 28.025 28.525 20.925 21 22.625 27.425 27.575 22.375 22 22.475 27.675 27.400000000000002 22.45 23 23.375 27.650000000000002 26.875 22.1 24 21.875 27.250000000000004 27.975 22.900000000000002 25 23.674999999999997 26.950000000000003 26.900000000000002 22.475 26 22.75 28.549999999999997 27.675 21.025 27 20.674999999999997 28.025 28.299999999999997 23.0 28 21.6 27.800000000000004 28.025 22.575 29 22.1 27.125 28.375 22.400000000000002 30 21.7 26.3 28.1 23.9 31 21.075 27.700000000000003 28.4 22.825 32 22.900000000000002 26.950000000000003 27.1 23.05 33 22.175 28.025 27.325 22.475 34 22.25 26.900000000000002 28.025 22.825 35 22.325 28.000000000000004 29.525000000000002 20.150000000000002 36 22.45 26.450000000000003 28.325 22.775000000000002 37 22.650000000000002 29.175 26.650000000000002 21.525 38 22.35 29.175 27.075 21.4 39 22.075 28.025 28.375 21.525 40 21.55 28.275 28.000000000000004 22.175 41 21.875 28.475 27.450000000000003 22.2 42 22.375 28.225 26.875 22.525000000000002 43 23.7 27.85 26.55 21.9 44 23.200000000000003 26.85 27.700000000000003 22.25 45 22.8 27.250000000000004 28.249999999999996 21.7 46 21.975 27.6 27.224999999999998 23.200000000000003 47 21.65 26.6 28.349999999999998 23.400000000000002 48 20.225 28.249999999999996 29.275000000000002 22.25 49 21.7 27.800000000000004 27.450000000000003 23.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 2.0 14 3.0 15 2.0 16 1.0 17 1.0 18 1.0 19 2.0 20 3.0 21 7.0 22 11.0 23 15.5 24 20.0 25 20.0 26 26.0 27 32.0 28 35.5 29 39.0 30 61.5 31 84.0 32 120.0 33 156.0 34 179.5 35 203.0 36 235.0 37 267.0 38 287.0 39 307.0 40 340.5 41 374.0 42 410.5 43 447.0 44 437.5 45 428.0 46 406.0 47 384.0 48 362.0 49 340.0 50 305.0 51 270.0 52 247.5 53 225.0 54 190.0 55 155.0 56 138.0 57 121.0 58 88.5 59 56.0 60 43.0 61 30.0 62 23.0 63 16.0 64 14.0 65 12.0 66 9.0 67 6.0 68 5.5 69 5.0 70 3.5 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 49 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03528814419904 97.52499999999999 2 0.6854531607006854 1.35 3 0.20309723280020311 0.6 4 0.02538715410002539 0.1 5 0.0 0.0 6 0.02538715410002539 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02538715410002539 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCACACATGGTAGTTGATGTGCTTGCTTAATGACCGC 11 0.27499999999999997 No Hit CTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10 0.075 0.0 0.0 0.0 0.0 11 0.075 0.0 0.0 0.0 0.0 12 0.075 0.0 0.0 0.0 0.0 13 0.075 0.0 0.0 0.0 0.0 14 0.075 0.0 0.0 0.0 0.0 15 0.075 0.0 0.0 0.0 0.0 16 0.075 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297096 spots for SRR6509755.sra Written 297096 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra Read 297089 spots for SRR6509755.sra Written 297089 spots for SRR6509755.sra SRR ids: ['SRR6509755.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aube8_nh SRR6509755.sra spots: 5941787 blocks: [[1, 297089], [297090, 594178], [594179, 891267], [891268, 1188356], [1188357, 1485445], [1485446, 1782534], [1782535, 2079623], [2079624, 2376712], [2376713, 2673801], [2673802, 2970890], [2970891, 3267979], [3267980, 3565068], [3565069, 3862157], [3862158, 4159246], [4159247, 4456335], [4456336, 4753424], [4753425, 5050513], [5050514, 5347602], [5347603, 5644691], [5644692, 5941787]] SRR6509755 file size 931341 SRR6509755 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6509755 SRR6509755_1.fastq Input file: SRR6509755_1.fastq trimmed: SRR6509755-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:52:48 2025 >> started Wed Feb 12 22:52:50 2025 >> done (2.740s) 5941787 reads processed; of these: 11484 ( 0.19%) short reads filtered out after trimming by size control 15061 ( 0.25%) empty reads filtered out after trimming by size control 5915242 (99.55%) reads available; of these: 459993 ( 7.78%) trimmed reads available after processing 5455249 (92.22%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1842 0.03% 19 3116 0.05% 20 5312 0.09% 21 2095 0.04% 22 3020 0.05% 23 4946 0.08% 24 8937 0.15% 25 14043 0.24% 26 4780 0.08% 27 5847 0.10% 28 8436 0.14% 29 13104 0.22% 30 20572 0.35% 31 6955 0.12% 32 8739 0.15% 33 12120 0.20% 34 18832 0.32% 35 29003 0.49% 36 9744 0.16% 37 12567 0.21% 38 16310 0.28% 39 25785 0.44% 40 40410 0.68% 41 13160 0.22% 42 16542 0.28% 43 21742 0.37% 44 28490 0.48% 45 46264 0.78% 46 13726 0.23% 47 17585 0.30% 48 25969 0.44% 49 5455249 92.22% 5915242 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=16 prefix-density=0.32 prefix-fanout=1.9 sequence=AGTCTTTTAGATCATCCATCTAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACTCTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=10.70 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.6 sequence=CTGGAAAGGGGTTCAGAGGGGGGTCTATTCCTATCCCCAAACAGGCAAGAGTGAGCCCTAATGAAATTTAAGG Started job on | Feb 12 22:53:07 Started mapping on | Feb 12 22:53:07 Finished on | Feb 12 22:53:25 Mapping speed, Million of reads per hour | 1183.05 Number of input reads | 5915242 Average input read length | 48 UNIQUE READS: Uniquely mapped reads number | 5087177 Uniquely mapped reads % | 86.00% Average mapped length | 47.80 Number of splices: Total | 681675 Number of splices: Annotated (sjdb) | 668504 Number of splices: GT/AG | 666790 Number of splices: GC/AG | 11511 Number of splices: AT/AC | 533 Number of splices: Non-canonical | 2841 Mismatch rate per base, % | 2.00% Deletion rate per base | 0.04% Deletion average length | 1.98 Insertion rate per base | 0.02% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 559740 % of reads mapped to multiple loci | 9.46% Number of reads mapped to too many loci | 15491 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.26% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 268325 268325 268325 N_multimapping 559740 559740 559740 N_noFeature 218963 2361567 2923072 N_ambiguous 42182 11608 9123 UnstrandedReadsAssigned:4826032 PositiveStrandReadsAssigned:2714002 NegativeStrandReadsAssigned:2154982 Dataset is classified unstranded MeadianReadLen=49 20thPercentileLength=49 echo kmer=45 SRR6509755 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR6509755-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,915,242 reads, 3,719,546 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR6509755.ke.tsv 34699 SRR6509755.se.tsv 87100 total ==> SRR6509755.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 253.171 43.257 Potri.005G024800.1.v4.1 1035 936 48 16.8144 Potri.004G059700.1.v4.1 961 862 9 3.42336 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 109.343 12.606 Potri.016G087400.1.v4.1 270 171 48.0239 92.0828 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 14.6933 2.87794 Potri.012G127500.1.v4.1 977 878 41 15.3111 ==> SRR6509755.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 53 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 55 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 27 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR6509755 completed mapping pipeline successfully