Starting /dee2/code/volunteer_pipeline.sh SRR6509756 current disk space = 3050463256576 free memory = 1575466988 SRR6509756 SRAfilesize dcd9ff60f9373bef3cba7d65ceaf4859 SRR6509756.sra SRR6509756.sra file validated SRR6509756 is single end SRR6509756 is conventional basespace SRR6509756 read1 length is 49 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6509756_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.224 33.0 31.0 34.0 30.0 34.0 2 32.39075 34.0 31.0 34.0 30.0 34.0 3 31.645 34.0 31.0 34.0 28.0 34.0 4 35.67775 37.0 35.0 37.0 33.0 37.0 5 35.744 37.0 35.0 37.0 33.0 37.0 6 35.91425 37.0 35.0 37.0 35.0 37.0 7 35.86725 37.0 35.0 37.0 35.0 37.0 8 35.84225 37.0 35.0 37.0 35.0 37.0 9 37.67475 39.0 37.0 39.0 35.0 39.0 10 37.665 39.0 37.0 39.0 35.0 39.0 11 37.64375 39.0 37.0 39.0 35.0 39.0 12 37.57425 39.0 37.0 39.0 35.0 39.0 13 37.546 39.0 37.0 39.0 35.0 39.0 14 38.86275 40.0 38.0 41.0 35.0 41.0 15 38.828 40.0 38.0 41.0 35.0 41.0 16 38.868 40.0 38.0 41.0 34.0 41.0 17 38.8845 40.0 38.0 41.0 35.0 41.0 18 38.8135 40.0 38.0 41.0 34.0 41.0 19 38.729 40.0 38.0 41.0 34.0 41.0 20 38.49625 40.0 38.0 41.0 34.0 41.0 21 38.659 40.0 38.0 41.0 34.0 41.0 22 38.515 40.0 38.0 41.0 34.0 41.0 23 38.6115 40.0 38.0 41.0 34.0 41.0 24 38.42475 40.0 38.0 41.0 34.0 41.0 25 38.24725 40.0 38.0 41.0 33.0 41.0 26 38.05825 40.0 38.0 41.0 33.0 41.0 27 37.89425 40.0 37.0 41.0 33.0 41.0 28 37.86275 40.0 37.0 41.0 33.0 41.0 29 37.70475 40.0 37.0 41.0 32.0 41.0 30 37.46025 40.0 37.0 41.0 32.0 41.0 31 37.5155 40.0 37.0 41.0 32.0 41.0 32 37.54225 40.0 37.0 41.0 32.0 41.0 33 37.47375 40.0 37.0 41.0 32.0 41.0 34 37.29575 40.0 37.0 41.0 31.0 41.0 35 37.033 39.0 36.0 41.0 31.0 41.0 36 37.2655 40.0 37.0 41.0 31.0 41.0 37 37.44975 40.0 37.0 41.0 32.0 41.0 38 37.45425 40.0 37.0 41.0 31.0 41.0 39 37.18675 40.0 37.0 41.0 31.0 41.0 40 37.18925 40.0 37.0 41.0 31.0 41.0 41 37.21175 40.0 37.0 41.0 31.0 41.0 42 37.152 40.0 37.0 41.0 31.0 41.0 43 37.07175 40.0 37.0 41.0 31.0 41.0 44 36.98375 40.0 37.0 41.0 31.0 41.0 45 36.7115 40.0 37.0 41.0 30.0 41.0 46 36.6195 40.0 36.0 41.0 30.0 41.0 47 36.53325 40.0 36.0 41.0 30.0 41.0 48 36.38625 39.0 36.0 41.0 30.0 41.0 49 36.16575 39.0 36.0 41.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 3.0 17 2.0 18 2.0 19 5.0 20 5.0 21 10.0 22 12.0 23 10.0 24 13.0 25 13.0 26 27.0 27 23.0 28 35.0 29 39.0 30 54.0 31 76.0 32 95.0 33 141.0 34 151.0 35 227.0 36 278.0 37 419.0 38 747.0 39 1609.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.05 19.325 12.049999999999999 42.575 2 23.974999999999998 21.349999999999998 41.25 13.425 3 19.400000000000002 20.375 31.924999999999997 28.299999999999997 4 22.528160200250312 27.759699624530665 27.40926157697122 22.302878598247812 5 23.275000000000002 28.775000000000002 30.099999999999998 17.849999999999998 6 20.5 31.125000000000004 29.799999999999997 18.575 7 17.549999999999997 18.025 44.275 20.150000000000002 8 18.35 21.875 35.725 24.05 9 20.349999999999998 22.725 33.650000000000006 23.275000000000002 10 20.150000000000002 36.725 26.3 16.825000000000003 11 25.15 30.8 23.225 20.825 12 21.725 25.474999999999998 29.75 23.05 13 19.5 29.049999999999997 29.625 21.825 14 20.375 28.475 29.849999999999998 21.3 15 20.225 26.875 29.95 22.95 16 21.575 28.1 28.95 21.375 17 21.4 29.575000000000003 27.025 22.0 18 21.325 28.249999999999996 27.325 23.1 19 20.8 28.549999999999997 28.65 22.0 20 22.5 28.725 28.225 20.549999999999997 21 22.1 26.5 28.000000000000004 23.400000000000002 22 22.45 28.575 27.775 21.2 23 22.6 28.549999999999997 27.025 21.825 24 21.4 27.750000000000004 28.15 22.7 25 22.6 28.775000000000002 27.650000000000002 20.974999999999998 26 23.1 28.375 27.35 21.175 27 21.525 27.650000000000002 27.500000000000004 23.325000000000003 28 21.125 28.95 28.799999999999997 21.125 29 22.025 28.15 27.500000000000004 22.325 30 21.425 27.975 27.075 23.525 31 21.625 29.775000000000002 27.075 21.525 32 22.113698973203107 28.424743300776356 28.600050087653393 20.861507638367144 33 22.26113056528264 27.03851925962982 27.613806903451728 23.08654327163582 34 21.437515652391685 27.998998246932132 27.372902579514154 23.190583521162033 35 22.26121835046378 27.400350965154175 28.904487340185508 21.43394334419654 36 21.129234629861983 28.582183186951067 28.281053952321205 22.00752823086575 37 21.344369199899674 28.643090042638576 27.263606721846003 22.74893403561575 38 21.96098049024512 28.189094547273637 29.03951975987994 20.810405202601302 39 21.69882235028815 28.288649461287896 28.48910047607116 21.523427712352795 40 22.26113056528264 27.088544272136065 27.938969484742373 22.71135567783892 41 23.325000000000003 28.000000000000004 27.150000000000002 21.525 42 20.625 28.15 28.249999999999996 22.975 43 22.605651412853213 27.68192048012003 28.157039259814955 21.555388847211805 44 22.6 28.7 27.700000000000003 21.0 45 21.152882205513784 28.54636591478697 27.56892230576441 22.731829573934835 46 22.069138276553108 27.229458917835668 28.45691382765531 22.24448897795591 47 22.31404958677686 27.89882294014525 27.773603806661658 22.01352366641623 48 22.414224893563738 27.29777109942399 27.147508139243676 23.140495867768596 49 21.925 28.199999999999996 27.900000000000002 21.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 6.0 1 5.5 2 5.0 3 4.5 4 4.0 5 2.0 6 0.0 7 1.5 8 3.0 9 2.0 10 1.0 11 1.5 12 2.0 13 2.0 14 2.0 15 2.5 16 3.0 17 2.0 18 1.0 19 3.0 20 5.0 21 10.0 22 15.0 23 17.5 24 20.0 25 20.0 26 27.5 27 35.0 28 48.5 29 62.0 30 78.0 31 94.0 32 105.5 33 117.0 34 145.0 35 173.0 36 215.5 37 258.0 38 300.5 39 343.0 40 365.0 41 387.0 42 415.5 43 444.0 44 434.0 45 424.0 46 407.0 47 390.0 48 358.5 49 327.0 50 301.5 51 276.0 52 251.0 53 226.0 54 186.5 55 147.0 56 116.5 57 86.0 58 72.5 59 59.0 60 45.0 61 31.0 62 26.0 63 21.0 64 17.5 65 14.0 66 11.0 67 8.0 68 7.0 69 6.0 70 5.0 71 4.0 72 2.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.125 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.17500000000000002 33 0.05 34 0.17500000000000002 35 0.27499999999999997 36 0.375 37 0.325 38 0.05 39 0.22499999999999998 40 0.05 41 0.0 42 0.0 43 0.025 44 0.0 45 0.25 46 0.2 47 0.17500000000000002 48 0.17500000000000002 49 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 49 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69841668760995 99.175 2 0.20105554159336514 0.4 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.025131942699170642 0.125 6 0.025131942699170642 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 6 0.15 No Hit AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATAGGAAGATCTCGT 5 0.125 TruSeq Adapter, Index 3 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.2 0.0 0.0 0.0 0.0 2 0.2 0.0 0.0 0.0 0.0 3 0.2 0.0 0.0 0.0 0.0 4 0.2 0.0 0.0 0.0 0.0 5 0.2 0.0 0.0 0.0 0.0 6 0.2 0.0 0.0 0.0 0.0 7 0.2 0.0 0.0 0.0 0.0 8 0.2 0.0 0.0 0.0 0.0 9 0.2 0.0 0.0 0.0 0.0 10 0.2 0.0 0.0 0.0 0.0 11 0.2 0.0 0.0 0.0 0.0 12 0.2 0.0 0.0 0.0 0.0 13 0.2 0.0 0.0 0.0 0.0 14 0.2 0.0 0.0 0.0 0.0 15 0.2 0.0 0.0 0.0 0.0 16 0.2 0.0 0.0 0.0 0.0 17 0.2 0.0 0.0 0.0 0.0 18 0.2 0.0 0.0 0.0 0.0 19 0.2 0.0 0.0 0.0 0.0 20 0.2 0.0 0.0 0.0 0.0 21 0.2 0.0 0.0 0.0 0.0 22 0.2 0.0 0.0 0.0 0.0 23 0.2 0.0 0.0 0.0 0.0 24 0.2 0.0 0.0 0.0 0.0 25 0.2 0.0 0.0 0.0 0.0 26 0.2 0.0 0.0 0.0 0.0 27 0.2 0.0 0.0 0.0 0.0 28 0.2 0.0 0.0 0.0 0.0 29 0.2 0.0 0.0 0.0 0.0 30 0.2 0.0 0.0 0.0 0.0 31 0.2 0.0 0.0 0.0 0.0 32 0.2 0.0 0.0 0.0 0.0 33 0.2 0.0 0.0 0.0 0.0 34 0.2 0.0 0.0 0.0 0.0 35 0.2 0.0 0.0 0.0 0.0 36 0.2 0.0 0.0 0.0 0.0 37 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299943 spots for SRR6509756.sra Written 299943 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra Read 299939 spots for SRR6509756.sra Written 299939 spots for SRR6509756.sra SRR ids: ['SRR6509756.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_he1b6ed9 SRR6509756.sra spots: 5998784 blocks: [[1, 299939], [299940, 599878], [599879, 899817], [899818, 1199756], [1199757, 1499695], [1499696, 1799634], [1799635, 2099573], [2099574, 2399512], [2399513, 2699451], [2699452, 2999390], [2999391, 3299329], [3299330, 3599268], [3599269, 3899207], [3899208, 4199146], [4199147, 4499085], [4499086, 4799024], [4799025, 5098963], [5098964, 5398902], [5398903, 5698841], [5698842, 5998784]] SRR6509756 file size 953967 SRR6509756 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6509756 SRR6509756_1.fastq Input file: SRR6509756_1.fastq trimmed: SRR6509756-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:55:33 2025 >> started Wed Feb 12 22:55:36 2025 >> done (2.832s) 5998784 reads processed; of these: 1046 ( 0.02%) short reads filtered out after trimming by size control 10128 ( 0.17%) empty reads filtered out after trimming by size control 5987610 (99.81%) reads available; of these: 249699 ( 4.17%) trimmed reads available after processing 5737911 (95.83%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 287 0.00% 19 407 0.01% 20 534 0.01% 21 773 0.01% 22 1176 0.02% 23 1454 0.02% 24 1981 0.03% 25 2628 0.04% 26 2518 0.04% 27 2575 0.04% 28 2715 0.05% 29 2985 0.05% 30 3204 0.05% 31 3508 0.06% 32 3437 0.06% 33 3989 0.07% 34 4092 0.07% 35 4230 0.07% 36 4318 0.07% 37 4880 0.08% 38 5331 0.09% 39 6394 0.11% 40 6835 0.11% 41 8081 0.13% 42 9862 0.16% 43 11824 0.20% 44 14476 0.24% 45 19019 0.32% 46 25282 0.42% 47 31552 0.53% 48 59352 0.99% 49 5737911 95.83% 5987610 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=15 prefix-density=0.09 prefix-fanout=2.9 sequence=CCAATCTACAAGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=13 fanout-score=117.22 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=16.8 sequence=TTCTTCTTCTTGT Started job on | Feb 12 22:55:50 Started mapping on | Feb 12 22:55:50 Finished on | Feb 12 22:56:10 Mapping speed, Million of reads per hour | 1077.77 Number of input reads | 5987610 Average input read length | 48 UNIQUE READS: Uniquely mapped reads number | 5147765 Uniquely mapped reads % | 85.97% Average mapped length | 48.01 Number of splices: Total | 678287 Number of splices: Annotated (sjdb) | 661749 Number of splices: GT/AG | 665427 Number of splices: GC/AG | 8887 Number of splices: AT/AC | 584 Number of splices: Non-canonical | 3389 Mismatch rate per base, % | 2.19% Deletion rate per base | 0.03% Deletion average length | 1.88 Insertion rate per base | 0.02% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485063 % of reads mapped to multiple loci | 8.10% Number of reads mapped to too many loci | 31322 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.24% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 354782 354782 354782 N_multimapping 485063 485063 485063 N_noFeature 269784 2586167 2808217 N_ambiguous 45548 11795 10649 UnstrandedReadsAssigned:4832433 PositiveStrandReadsAssigned:2549803 NegativeStrandReadsAssigned:2328899 Dataset is classified unstranded MeadianReadLen=49 20thPercentileLength=49 echo kmer=45 SRR6509756 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR6509756-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,987,610 reads, 3,761,687 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR6509756.ke.tsv 34699 SRR6509756.se.tsv 87100 total ==> SRR6509756.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 109.587 20.0281 Potri.005G024800.1.v4.1 1035 936 29 10.8662 Potri.004G059700.1.v4.1 961 862 6 2.44119 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 148.567 18.321 Potri.016G087400.1.v4.1 270 171 153.104 314.012 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 162 64.7109 ==> SRR6509756.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 48 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR6509756 completed mapping pipeline successfully