Starting /dee2/code/volunteer_pipeline.sh SRR6509757 current disk space = 3050508713984 free memory = 1579207416 SRR6509757 SRAfilesize 777fd2412c160d9b322c4dbcf910ee28 SRR6509757.sra SRR6509757.sra file validated SRR6509757 is single end SRR6509757 is conventional basespace SRR6509757 read1 length is 49 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6509757_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.281 33.0 31.0 34.0 30.0 34.0 2 32.3685 34.0 31.0 34.0 30.0 34.0 3 31.71925 34.0 31.0 34.0 28.0 34.0 4 35.78475 37.0 35.0 37.0 33.0 37.0 5 35.78 37.0 35.0 37.0 33.0 37.0 6 35.895 37.0 35.0 37.0 35.0 37.0 7 35.89825 37.0 35.0 37.0 35.0 37.0 8 35.89125 37.0 35.0 37.0 35.0 37.0 9 37.70175 39.0 37.0 39.0 35.0 39.0 10 37.681 39.0 37.0 39.0 35.0 39.0 11 37.70475 39.0 37.0 39.0 35.0 39.0 12 37.5665 39.0 37.0 39.0 35.0 39.0 13 37.546 39.0 37.0 39.0 35.0 39.0 14 38.9705 40.0 38.0 41.0 35.0 41.0 15 38.8985 40.0 38.0 41.0 35.0 41.0 16 38.90525 40.0 38.0 41.0 35.0 41.0 17 38.92025 40.0 38.0 41.0 35.0 41.0 18 38.8755 40.0 38.0 41.0 35.0 41.0 19 38.88275 40.0 38.0 41.0 35.0 41.0 20 38.6625 40.0 38.0 41.0 34.0 41.0 21 38.60175 40.0 38.0 41.0 34.0 41.0 22 38.5675 40.0 38.0 41.0 34.0 41.0 23 38.46975 40.0 38.0 41.0 34.0 41.0 24 38.424 40.0 38.0 41.0 34.0 41.0 25 38.29925 40.0 38.0 41.0 33.0 41.0 26 38.141 40.0 38.0 41.0 33.0 41.0 27 37.93625 40.0 37.0 41.0 33.0 41.0 28 37.9385 40.0 38.0 41.0 33.0 41.0 29 37.86075 40.0 37.0 41.0 32.0 41.0 30 37.4845 40.0 37.0 41.0 31.0 41.0 31 37.54825 40.0 37.0 41.0 32.0 41.0 32 37.54625 40.0 37.0 41.0 32.0 41.0 33 37.276 40.0 37.0 41.0 31.0 41.0 34 37.26775 40.0 37.0 41.0 31.0 41.0 35 37.10775 39.0 36.0 41.0 31.0 41.0 36 37.49875 40.0 37.0 41.0 31.0 41.0 37 37.523 40.0 37.0 41.0 32.0 41.0 38 37.55775 40.0 37.0 41.0 31.0 41.0 39 37.191 40.0 37.0 41.0 31.0 41.0 40 37.41775 40.0 37.0 41.0 31.0 41.0 41 37.49025 40.0 37.0 41.0 32.0 41.0 42 37.42325 40.0 37.0 41.0 32.0 41.0 43 37.29225 40.0 37.0 41.0 31.0 41.0 44 37.114 40.0 37.0 41.0 31.0 41.0 45 36.9055 40.0 37.0 41.0 30.0 41.0 46 36.94025 40.0 37.0 41.0 31.0 41.0 47 36.79575 40.0 36.0 41.0 30.0 41.0 48 36.572 40.0 36.0 41.0 30.0 41.0 49 36.44125 40.0 36.0 41.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 2.0 17 4.0 18 5.0 19 4.0 20 5.0 21 3.0 22 10.0 23 9.0 24 9.0 25 20.0 26 15.0 27 21.0 28 40.0 29 42.0 30 48.0 31 89.0 32 104.0 33 125.0 34 149.0 35 199.0 36 283.0 37 423.0 38 706.0 39 1683.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.725 17.95 10.925 46.400000000000006 2 21.95 19.625 44.025 14.399999999999999 3 17.675 19.2 33.975 29.15 4 21.660830415207606 26.463231615807903 28.139069534767387 23.736868434217108 5 22.75 29.15 30.625000000000004 17.474999999999998 6 18.7 31.974999999999998 30.0 19.325 7 17.9 19.05 43.4 19.650000000000002 8 17.25 23.200000000000003 35.55 24.0 9 19.625 21.65 34.8 23.925 10 19.25 35.5 27.525 17.724999999999998 11 24.075 29.7 23.925 22.3 12 21.224999999999998 24.975 30.375000000000004 23.425 13 18.2 29.175 31.65 20.974999999999998 14 20.0 29.25 29.425 21.325 15 21.575 27.025 28.4 23.0 16 19.25 29.45 29.775000000000002 21.525 17 19.5 30.45 29.125 20.925 18 22.025 28.625 27.875 21.475 19 20.9 28.225 28.625 22.25 20 21.875 30.025000000000002 26.775 21.325 21 22.325 27.375 27.950000000000003 22.35 22 20.825 28.249999999999996 28.325 22.6 23 22.175 29.15 27.35 21.325 24 21.5 28.749999999999996 27.675 22.075 25 21.175 28.925 27.224999999999998 22.675 26 21.525 29.599999999999998 27.425 21.45 27 20.724999999999998 28.449999999999996 29.225 21.6 28 21.325 29.175 27.025 22.475 29 21.65 29.175 27.175 22.0 30 22.125 29.4 27.55 20.925 31 21.61080540270135 28.51425712856428 27.71385692846423 22.161080540270135 32 22.945891783567134 28.031062124248496 27.630260521042082 21.392785571142284 33 20.96693386773547 27.930861723446892 28.031062124248496 23.071142284569138 34 20.36573146292585 27.980961923847698 28.35671342685371 23.296593186372746 35 21.94325885011298 29.148882751694703 27.96886768767261 20.938990710519708 36 22.16637346066851 27.46921337019352 27.94672028147776 22.417692887660216 37 21.27606129113288 28.887214267771917 28.53554383320774 21.301180607887467 38 20.66633266533066 28.75751503006012 28.95791583166333 21.618236472945892 39 21.193880110358666 28.291948833709558 27.965889139704036 22.54828191622774 40 20.390781563126254 29.308617234468937 28.306613226452903 21.993987975951903 41 21.725 28.775000000000002 28.375 21.125 42 21.224999999999998 28.075 27.900000000000002 22.8 43 21.391043282461847 28.796597448086064 27.72079059294471 22.091568676507382 44 21.675 28.9 27.875 21.55 45 22.063253012048193 26.731927710843372 28.96586345381526 22.23895582329317 46 21.804511278195488 28.220551378446114 27.06766917293233 22.907268170426065 47 21.75438596491228 28.29573934837093 28.496240601503757 21.453634085213032 48 21.528822055137844 28.095238095238095 28.07017543859649 22.305764411027567 49 21.375 28.249999999999996 28.15 22.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 7.0 1 5.5 2 4.0 3 2.0 4 0.0 5 0.0 6 0.0 7 1.5 8 3.0 9 2.0 10 1.0 11 0.5 12 0.0 13 1.0 14 2.0 15 2.5 16 3.0 17 3.5 18 4.0 19 5.5 20 7.0 21 10.0 22 13.0 23 15.5 24 18.0 25 18.0 26 26.5 27 35.0 28 50.5 29 66.0 30 73.5 31 81.0 32 117.0 33 153.0 34 184.5 35 216.0 36 238.0 37 260.0 38 313.0 39 366.0 40 381.0 41 396.0 42 415.5 43 435.0 44 433.5 45 432.0 46 426.0 47 420.0 48 376.0 49 332.0 50 288.0 51 244.0 52 215.5 53 187.0 54 154.5 55 122.0 56 104.0 57 86.0 58 60.0 59 34.0 60 31.5 61 29.0 62 24.0 63 19.0 64 14.0 65 9.0 66 9.0 67 9.0 68 6.0 69 3.0 70 2.0 71 1.0 72 1.5 73 2.0 74 1.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.05 32 0.2 33 0.2 34 0.2 35 0.42500000000000004 36 0.525 37 0.475 38 0.2 39 0.325 40 0.2 41 0.0 42 0.0 43 0.075 44 0.0 45 0.4 46 0.25 47 0.25 48 0.25 49 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 49 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74905897114178 99.375 2 0.20075282308657463 0.4 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.02509410288582183 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10 0.125 0.0 0.0 0.0 0.0 11 0.125 0.0 0.0 0.0 0.0 12 0.125 0.0 0.0 0.0 0.0 13 0.125 0.0 0.0 0.0 0.0 14 0.125 0.0 0.0 0.0 0.0 15 0.125 0.0 0.0 0.0 0.0 16 0.125 0.0 0.0 0.0 0.0 17 0.125 0.0 0.0 0.0 0.0 18 0.125 0.0 0.0 0.0 0.0 19 0.125 0.0 0.0 0.0 0.0 20 0.125 0.0 0.0 0.0 0.0 21 0.125 0.0 0.0 0.0 0.0 22 0.125 0.0 0.0 0.0 0.0 23 0.125 0.0 0.0 0.0 0.0 24 0.125 0.0 0.0 0.0 0.0 25 0.125 0.0 0.0 0.0 0.0 26 0.125 0.0 0.0 0.0 0.0 27 0.125 0.0 0.0 0.0 0.0 28 0.125 0.0 0.0 0.0 0.0 29 0.125 0.0 0.0 0.0 0.0 30 0.125 0.0 0.0 0.0 0.0 31 0.125 0.0 0.0 0.0 0.0 32 0.125 0.0 0.0 0.0 0.0 33 0.125 0.0 0.0 0.0 0.0 34 0.125 0.0 0.0 0.0 0.0 35 0.125 0.0 0.0 0.0 0.0 36 0.125 0.0 0.0 0.0 0.0 37 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317539 spots for SRR6509757.sra Written 317539 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra Read 317523 spots for SRR6509757.sra Written 317523 spots for SRR6509757.sra SRR ids: ['SRR6509757.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rgdsffvg SRR6509757.sra spots: 6350476 blocks: [[1, 317523], [317524, 635046], [635047, 952569], [952570, 1270092], [1270093, 1587615], [1587616, 1905138], [1905139, 2222661], [2222662, 2540184], [2540185, 2857707], [2857708, 3175230], [3175231, 3492753], [3492754, 3810276], [3810277, 4127799], [4127800, 4445322], [4445323, 4762845], [4762846, 5080368], [5080369, 5397891], [5397892, 5715414], [5715415, 6032937], [6032938, 6350476]] SRR6509757 file size 1009980 SRR6509757 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6509757 SRR6509757_1.fastq Input file: SRR6509757_1.fastq trimmed: SRR6509757-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 23:12:46 2025 >> started Wed Feb 12 23:18:28 2025 >> done (342.198s) 6350476 reads processed; of these: 1086 ( 0.02%) short reads filtered out after trimming by size control 8573 ( 0.13%) empty reads filtered out after trimming by size control 6340817 (99.85%) reads available; of these: 259288 ( 4.09%) trimmed reads available after processing 6081529 (95.91%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 376 0.01% 19 402 0.01% 20 595 0.01% 21 855 0.01% 22 1249 0.02% 23 1618 0.03% 24 2230 0.04% 25 2796 0.04% 26 2800 0.04% 27 2803 0.04% 28 3008 0.05% 29 3206 0.05% 30 3488 0.06% 31 3700 0.06% 32 3705 0.06% 33 4099 0.06% 34 4207 0.07% 35 4526 0.07% 36 4538 0.07% 37 5095 0.08% 38 5643 0.09% 39 6492 0.10% 40 7293 0.12% 41 8610 0.14% 42 10124 0.16% 43 12105 0.19% 44 14911 0.24% 45 19246 0.30% 46 25712 0.41% 47 32848 0.52% 48 61008 0.96% 49 6081529 95.91% 6340817 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=17 prefix-density=0.06 prefix-fanout=2.0 sequence=TTTAGTTCATCCAT criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=117.09 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=12.8 sequence=TCTTCTTCTTTGCTTTGTTGTCCTTC Started job on | Feb 12 23:26:11 Started mapping on | Feb 12 23:26:22 Finished on | Feb 13 00:18:49 Mapping speed, Million of reads per hour | 7.25 Number of input reads | 6340817 Average input read length | 48 UNIQUE READS: Uniquely mapped reads number | 5485254 Uniquely mapped reads % | 86.51% Average mapped length | 48.01 Number of splices: Total | 735270 Number of splices: Annotated (sjdb) | 716276 Number of splices: GT/AG | 720777 Number of splices: GC/AG | 10390 Number of splices: AT/AC | 590 Number of splices: Non-canonical | 3513 Mismatch rate per base, % | 2.21% Deletion rate per base | 0.03% Deletion average length | 1.86 Insertion rate per base | 0.02% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485399 % of reads mapped to multiple loci | 7.66% Number of reads mapped to too many loci | 28921 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.25% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 370164 370164 370164 N_multimapping 485399 485399 485399 N_noFeature 275378 2745005 2992732 N_ambiguous 37400 7528 7078 UnstrandedReadsAssigned:5172476 PositiveStrandReadsAssigned:2732721 NegativeStrandReadsAssigned:2485444 Dataset is classified unstranded MeadianReadLen=49 20thPercentileLength=49 echo kmer=45 SRR6509757 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR6509757-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,340,817 reads, 3,975,177 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR6509757.ke.tsv 34699 SRR6509757.se.tsv 87100 total ==> SRR6509757.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 198 37.1491 Potri.005G024800.1.v4.1 1035 936 713 274.266 Potri.004G059700.1.v4.1 961 862 2 0.835374 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 229.124 29.0067 Potri.016G087400.1.v4.1 270 171 117.596 247.602 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 10.9496 2.35505 Potri.012G127500.1.v4.1 977 878 237 97.1879 ==> SRR6509757.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 59 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 0 SRR6509757 completed mapping pipeline successfully