Starting /dee2/code/volunteer_pipeline.sh SRR6509758 current disk space = 3050462605312 free memory = 1577028232 SRR6509758 SRAfilesize 749220c02070ef759ec6c294c8204013 SRR6509758.sra SRR6509758.sra file validated SRR6509758 is single end SRR6509758 is conventional basespace SRR6509758 read1 length is 49 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6509758_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.20675 33.0 31.0 34.0 30.0 34.0 2 32.3125 34.0 31.0 34.0 30.0 34.0 3 31.60675 34.0 31.0 34.0 28.0 34.0 4 35.62525 37.0 35.0 37.0 33.0 37.0 5 35.6085 37.0 35.0 37.0 33.0 37.0 6 35.806 37.0 35.0 37.0 35.0 37.0 7 35.81125 37.0 35.0 37.0 35.0 37.0 8 35.854 37.0 35.0 37.0 35.0 37.0 9 37.58025 39.0 37.0 39.0 35.0 39.0 10 37.651 39.0 37.0 39.0 35.0 39.0 11 37.61975 39.0 37.0 39.0 35.0 39.0 12 37.50525 39.0 37.0 39.0 35.0 39.0 13 37.48675 39.0 37.0 39.0 34.0 39.0 14 38.864 40.0 38.0 41.0 34.0 41.0 15 38.86325 40.0 38.0 41.0 35.0 41.0 16 38.9035 40.0 38.0 41.0 35.0 41.0 17 38.81475 40.0 38.0 41.0 34.0 41.0 18 38.70575 40.0 38.0 41.0 34.0 41.0 19 38.702 40.0 38.0 41.0 34.0 41.0 20 38.58325 40.0 38.0 41.0 34.0 41.0 21 38.61525 40.0 38.0 41.0 34.0 41.0 22 38.44425 40.0 38.0 41.0 34.0 41.0 23 38.3685 40.0 38.0 41.0 34.0 41.0 24 38.433 40.0 38.0 41.0 34.0 41.0 25 38.2575 40.0 38.0 41.0 33.0 41.0 26 38.0885 40.0 38.0 41.0 33.0 41.0 27 37.85325 40.0 38.0 41.0 32.0 41.0 28 37.83425 40.0 37.0 41.0 33.0 41.0 29 37.76375 40.0 37.0 41.0 32.0 41.0 30 37.44775 40.0 37.0 41.0 32.0 41.0 31 37.41675 40.0 37.0 41.0 31.0 41.0 32 37.47825 40.0 37.0 41.0 32.0 41.0 33 37.24575 40.0 37.0 41.0 31.0 41.0 34 37.088 40.0 37.0 41.0 30.0 41.0 35 36.907 39.0 36.0 41.0 30.0 41.0 36 37.1745 40.0 37.0 41.0 31.0 41.0 37 37.383 40.0 37.0 41.0 32.0 41.0 38 37.4 40.0 37.0 41.0 31.0 41.0 39 37.0215 40.0 37.0 41.0 30.0 41.0 40 37.1505 40.0 37.0 41.0 31.0 41.0 41 37.1485 40.0 37.0 41.0 31.0 41.0 42 37.073 40.0 37.0 41.0 31.0 41.0 43 37.01475 40.0 37.0 41.0 31.0 41.0 44 36.81725 40.0 36.0 41.0 31.0 41.0 45 36.6295 40.0 36.0 41.0 30.0 41.0 46 36.564 40.0 36.0 41.0 30.0 41.0 47 36.49275 40.0 36.0 41.0 30.0 41.0 48 36.28875 40.0 36.0 41.0 30.0 41.0 49 35.9655 39.0 36.0 41.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 2.0 12 1.0 13 0.0 14 2.0 15 0.0 16 0.0 17 3.0 18 3.0 19 6.0 20 5.0 21 10.0 22 10.0 23 9.0 24 17.0 25 19.0 26 30.0 27 20.0 28 35.0 29 51.0 30 65.0 31 81.0 32 79.0 33 129.0 34 166.0 35 193.0 36 268.0 37 461.0 38 738.0 39 1595.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.200000000000003 17.925 11.899999999999999 42.975 2 22.875 20.3 41.025 15.8 3 18.125 20.150000000000002 33.85 27.875 4 23.311655827913956 26.263131565782892 27.63881940970485 22.786393196598297 5 24.125 27.250000000000004 29.025000000000002 19.6 6 19.175 30.125 30.55 20.150000000000002 7 18.475 18.2 42.725 20.599999999999998 8 17.625 21.725 35.55 25.1 9 19.900000000000002 22.85 34.4 22.85 10 20.075000000000003 35.275 26.55 18.099999999999998 11 24.375 28.65 23.425 23.549999999999997 12 21.375 27.025 28.299999999999997 23.3 13 19.225 28.925 31.775 20.075000000000003 14 20.05 29.025000000000002 29.799999999999997 21.125 15 20.775 27.3 29.575000000000003 22.35 16 20.275000000000002 27.925 29.349999999999998 22.45 17 22.05 27.525 28.525 21.9 18 21.625 28.725 27.625 22.025 19 20.4 28.775000000000002 28.549999999999997 22.275 20 22.475 28.95 27.075 21.5 21 21.7 28.799999999999997 27.224999999999998 22.275 22 22.7 26.674999999999997 28.199999999999996 22.425 23 22.375 28.675 27.474999999999998 21.475 24 21.7 28.65 27.0 22.650000000000002 25 19.75 28.375 28.199999999999996 23.674999999999997 26 21.2 27.875 29.15 21.775 27 22.575 26.6 28.9 21.925 28 22.3 27.200000000000003 27.800000000000004 22.7 29 22.1 29.025000000000002 27.6 21.275 30 22.0 28.15 27.3 22.55 31 21.660830415207606 27.48874437218609 28.864432216108053 21.98599299649825 32 21.763085399449036 27.948910593538695 28.575006260956677 21.7129977460556 33 22.01352366641623 26.421237165038818 29.526671675432002 22.03856749311295 34 22.464312546957174 27.523165539694467 28.07412972702229 21.93839218632607 35 21.695510408828696 29.144720341108606 26.51116127414096 22.648607975921745 36 21.30653266331658 27.939698492462313 28.266331658291456 22.48743718592965 37 22.185929648241206 28.467336683417084 27.63819095477387 21.708542713567837 38 22.61457550713749 27.222639619333833 27.773603806661658 22.389181066867017 39 22.31135622963149 28.12735021308599 28.07721233391828 21.484081223364253 40 21.437515652391685 27.87377911344853 29.37640871525169 21.312296518908088 41 21.65 27.250000000000004 27.500000000000004 23.599999999999998 42 22.675 27.250000000000004 27.625 22.45 43 22.02202202202202 28.128128128128125 27.677677677677675 22.17217217217217 44 21.675 28.749999999999996 28.000000000000004 21.575 45 22.14697767745172 26.761976423375973 29.49586155003762 21.595184349134687 46 21.553884711779446 26.992481203007518 28.496240601503757 22.957393483709275 47 21.322976697569533 27.662240040090204 29.140566274116765 21.874216988223502 48 22.425457278877474 27.737409170633924 27.58707090954648 22.25006264094212 49 20.95 26.825 29.799999999999997 22.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 1.0 8 2.0 9 2.0 10 2.0 11 3.0 12 4.0 13 2.5 14 1.0 15 1.5 16 2.0 17 3.5 18 5.0 19 5.5 20 6.0 21 11.0 22 16.0 23 16.5 24 17.0 25 17.0 26 33.0 27 49.0 28 57.0 29 65.0 30 76.0 31 87.0 32 119.0 33 151.0 34 161.5 35 172.0 36 212.0 37 252.0 38 282.5 39 313.0 40 353.0 41 393.0 42 397.5 43 402.0 44 403.0 45 404.0 46 401.5 47 399.0 48 368.5 49 338.0 50 313.5 51 289.0 52 246.0 53 203.0 54 174.5 55 146.0 56 120.5 57 95.0 58 86.0 59 77.0 60 64.5 61 52.0 62 41.5 63 31.0 64 18.5 65 6.0 66 6.0 67 6.0 68 5.5 69 5.0 70 3.0 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.05 32 0.17500000000000002 33 0.17500000000000002 34 0.17500000000000002 35 0.325 36 0.5 37 0.5 38 0.17500000000000002 39 0.27499999999999997 40 0.17500000000000002 41 0.0 42 0.0 43 0.1 44 0.0 45 0.325 46 0.25 47 0.22499999999999998 48 0.22499999999999998 49 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 49 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57243460764587 98.97500000000001 2 0.35211267605633806 0.7000000000000001 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025150905432595575 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATGGTTCATCTCGT 7 0.17500000000000002 TruSeq Adapter, Index 9 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10 0.175 0.0 0.0 0.0 0.0 11 0.175 0.0 0.0 0.0 0.0 12 0.175 0.0 0.0 0.0 0.0 13 0.175 0.0 0.0 0.0 0.0 14 0.175 0.0 0.0 0.0 0.0 15 0.175 0.0 0.0 0.0 0.0 16 0.175 0.0 0.0 0.0 0.0 17 0.175 0.0 0.0 0.0 0.0 18 0.175 0.0 0.0 0.0 0.0 19 0.175 0.0 0.0 0.0 0.0 20 0.175 0.0 0.0 0.0 0.0 21 0.175 0.0 0.0 0.0 0.0 22 0.175 0.0 0.0 0.0 0.0 23 0.175 0.0 0.0 0.0 0.0 24 0.175 0.0 0.0 0.0 0.0 25 0.175 0.0 0.0 0.0 0.0 26 0.175 0.0 0.0 0.0 0.0 27 0.175 0.0 0.0 0.0 0.0 28 0.175 0.0 0.0 0.0 0.0 29 0.175 0.0 0.0 0.0 0.0 30 0.175 0.0 0.0 0.0 0.0 31 0.175 0.0 0.0 0.0 0.0 32 0.175 0.0 0.0 0.0 0.0 33 0.175 0.0 0.0 0.0 0.0 34 0.175 0.0 0.0 0.0 0.0 35 0.175 0.0 0.0 0.0 0.0 36 0.175 0.0 0.0 0.0 0.0 37 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307175 spots for SRR6509758.sra Written 307175 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra Read 307171 spots for SRR6509758.sra Written 307171 spots for SRR6509758.sra SRR ids: ['SRR6509758.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zggbqhkz SRR6509758.sra spots: 6143424 blocks: [[1, 307171], [307172, 614342], [614343, 921513], [921514, 1228684], [1228685, 1535855], [1535856, 1843026], [1843027, 2150197], [2150198, 2457368], [2457369, 2764539], [2764540, 3071710], [3071711, 3378881], [3378882, 3686052], [3686053, 3993223], [3993224, 4300394], [4300395, 4607565], [4607566, 4914736], [4914737, 5221907], [5221908, 5529078], [5529079, 5836249], [5836250, 6143424]] SRR6509758 file size 976996 SRR6509758 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6509758 SRR6509758_1.fastq Input file: SRR6509758_1.fastq trimmed: SRR6509758-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:54:22 2025 >> started Wed Feb 12 22:54:24 2025 >> done (2.832s) 6143424 reads processed; of these: 1034 ( 0.02%) short reads filtered out after trimming by size control 10407 ( 0.17%) empty reads filtered out after trimming by size control 6131983 (99.81%) reads available; of these: 263157 ( 4.29%) trimmed reads available after processing 5868826 (95.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 312 0.01% 19 386 0.01% 20 570 0.01% 21 798 0.01% 22 1186 0.02% 23 1564 0.03% 24 2164 0.04% 25 2798 0.05% 26 2771 0.05% 27 2768 0.05% 28 3010 0.05% 29 3076 0.05% 30 3465 0.06% 31 3629 0.06% 32 3909 0.06% 33 4115 0.07% 34 4150 0.07% 35 4434 0.07% 36 4756 0.08% 37 5299 0.09% 38 5681 0.09% 39 6832 0.11% 40 7423 0.12% 41 8707 0.14% 42 10566 0.17% 43 12634 0.21% 44 15217 0.25% 45 19746 0.32% 46 26552 0.43% 47 33135 0.54% 48 61504 1.00% 49 5868826 95.71% 6131983 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=31 prefix-density=0.07 prefix-fanout=2.0 sequence=ACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=16.74 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.5 sequence=AAACAAAAAAAAATGGATGCCAAAGCTCTCTTCTTCTTTGCTTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCTGGCCTTTGCAGAAAATGAAGA Started job on | Feb 12 22:54:40 Started mapping on | Feb 12 22:54:41 Finished on | Feb 12 22:55:00 Mapping speed, Million of reads per hour | 1161.85 Number of input reads | 6131983 Average input read length | 48 UNIQUE READS: Uniquely mapped reads number | 5250746 Uniquely mapped reads % | 85.63% Average mapped length | 47.98 Number of splices: Total | 661910 Number of splices: Annotated (sjdb) | 645667 Number of splices: GT/AG | 649530 Number of splices: GC/AG | 8659 Number of splices: AT/AC | 550 Number of splices: Non-canonical | 3171 Mismatch rate per base, % | 2.24% Deletion rate per base | 0.03% Deletion average length | 1.92 Insertion rate per base | 0.02% Insertion average length | 1.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 527040 % of reads mapped to multiple loci | 8.59% Number of reads mapped to too many loci | 31044 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.15% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 354197 354197 354197 N_multimapping 527040 527040 527040 N_noFeature 269948 2619563 2877200 N_ambiguous 46668 12152 10654 UnstrandedReadsAssigned:4934130 PositiveStrandReadsAssigned:2619031 NegativeStrandReadsAssigned:2362892 Dataset is classified unstranded MeadianReadLen=49 20thPercentileLength=49 echo kmer=45 SRR6509758 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR6509758-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,131,983 reads, 3,816,572 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR6509758.ke.tsv 34699 SRR6509758.se.tsv 87100 total ==> SRR6509758.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 125 22.0429 Potri.005G024800.1.v4.1 1035 936 43 15.5463 Potri.004G059700.1.v4.1 961 862 6 2.35547 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 120.021 14.2811 Potri.016G087400.1.v4.1 270 171 110.63 218.932 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 3 0.606456 Potri.012G127500.1.v4.1 977 878 294 113.315 ==> SRR6509758.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 24 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR6509758 completed mapping pipeline successfully