Starting /dee2/code/volunteer_pipeline.sh SRR7030790 current disk space = 3051812519936 free memory = 1443315240 SRR7030790 SRAfilesize ea6ea4cf63807c764b7ffc6156274850 SRR7030790.sra SRR7030790.sra file validated SRR7030790 is paired end SRR7030790 is conventional basespace SRR7030790 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030790_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.66625 33.0 32.0 33.0 30.0 34.0 2 30.711 33.0 31.0 33.0 25.0 34.0 3 31.7925 33.0 31.0 33.0 29.0 34.0 4 32.3065 33.0 33.0 34.0 31.0 34.0 5 32.58225 33.0 33.0 34.0 32.0 34.0 6 36.83675 38.0 37.0 38.0 35.0 38.0 7 37.357 38.0 38.0 38.0 37.0 38.0 8 37.4705 38.0 38.0 38.0 37.0 38.0 9 37.58375 38.0 38.0 38.0 38.0 38.0 10-14 37.497550000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.5397 38.0 38.0 38.0 38.0 38.0 20-24 37.46515 38.0 38.0 38.0 37.6 38.0 25-29 37.37765 38.0 38.0 38.0 37.4 38.0 30-34 37.3515 38.0 38.0 38.0 37.2 38.0 35-39 37.354049999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.381600000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.316950000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.23975 38.0 38.0 38.0 37.0 38.0 55-59 37.24285 38.0 38.0 38.0 37.0 38.0 60-64 37.216750000000005 38.0 38.0 38.0 36.8 38.0 65-69 37.1897 38.0 38.0 38.0 36.8 38.0 70-74 37.22065 38.0 38.0 38.0 36.6 38.0 75-79 37.07785 38.0 38.0 38.0 36.0 38.0 80-84 36.855050000000006 38.0 38.0 38.0 35.6 38.0 85-89 36.66565 38.0 38.0 38.0 34.4 38.0 90-94 36.73440000000001 38.0 38.0 38.0 34.8 38.0 95-99 36.715650000000004 38.0 38.0 38.0 34.8 38.0 100-104 36.5901 38.0 38.0 38.0 34.2 38.0 105-109 36.4012 38.0 38.0 38.0 34.0 38.0 110-114 36.10015 38.0 37.6 38.0 32.8 38.0 115-119 36.011700000000005 38.0 37.0 38.0 32.8 38.0 120-124 35.877599999999994 38.0 37.0 38.0 32.0 38.0 125-129 35.7077 38.0 36.6 38.0 31.2 38.0 130-134 35.42615 38.0 36.0 38.0 29.8 38.0 135-139 34.9645 38.0 35.6 38.0 28.0 38.0 140-144 34.29435 38.0 35.0 38.0 24.0 38.0 145-149 33.938900000000004 38.0 34.6 38.0 23.6 38.0 150-151 29.631375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 0.0 15 2.0 16 2.0 17 0.0 18 2.0 19 1.0 20 4.0 21 6.0 22 3.0 23 5.0 24 8.0 25 7.0 26 10.0 27 23.0 28 26.0 29 31.0 30 43.0 31 56.0 32 84.0 33 127.0 34 150.0 35 270.0 36 640.0 37 2496.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.2442748091603 11.170483460559796 9.79643765903308 40.78880407124682 2 21.55 13.575000000000001 36.0 28.875 3 19.025 18.2 27.500000000000004 35.275 4 23.625 25.900000000000002 24.175 26.3 5 22.972972972972975 30.83083083083083 25.2002002002002 20.995995995995994 6 18.475 35.5 25.275 20.75 7 14.325 25.474999999999998 41.55 18.65 8 17.474999999999998 24.55 32.025 25.95 9 16.625 24.275 35.5 23.599999999999998 10-14 20.31 29.244999999999997 27.185 23.26 15-19 19.689999999999998 28.605000000000004 28.249999999999996 23.455000000000002 20-24 19.64 28.21 28.02 24.13 25-29 19.64 28.444999999999997 27.694999999999997 24.22 30-34 19.66 27.765 28.134999999999998 24.44 35-39 19.68 28.294999999999998 27.779999999999998 24.245 40-44 19.830000000000002 28.34 27.83 24.0 45-49 20.080000000000002 28.549999999999997 27.51 23.86 50-54 20.135 27.985 27.560000000000002 24.32 55-59 20.23 28.660000000000004 27.644999999999996 23.465 60-64 19.865 28.360000000000003 27.725 24.05 65-69 20.345 28.425 27.584999999999997 23.645 70-74 19.72 28.605000000000004 27.99 23.685000000000002 75-79 19.475 28.665000000000003 27.694999999999997 24.165 80-84 20.635 28.244999999999997 28.000000000000004 23.119999999999997 85-89 20.43 27.68 27.935 23.955000000000002 90-94 20.315 27.415 27.915 24.355 95-99 20.285 27.935 27.544999999999998 24.235 100-104 20.5 27.26 28.02 24.22 105-109 20.349999999999998 27.884999999999998 27.529999999999998 24.235 110-114 20.5 27.589999999999996 28.044999999999998 23.865 115-119 20.265 28.294999999999998 27.725 23.715 120-124 20.28 27.950000000000003 27.975 23.794999999999998 125-129 20.28 27.42 28.23 24.07 130-134 20.44 27.985 27.779999999999998 23.794999999999998 135-139 20.474999999999998 27.36 28.025 24.14 140-144 20.66 27.96 27.615000000000002 23.765 145-149 20.674999999999997 28.065 27.384999999999998 23.875 150-151 20.4375 27.35 28.1125 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.0 23 2.0 24 4.0 25 2.5 26 3.0 27 7.5 28 11.5 29 13.5 30 16.5 31 26.5 32 38.0 33 45.0 34 53.5 35 62.5 36 71.0 37 97.5 38 118.5 39 146.0 40 193.0 41 225.0 42 249.5 43 259.0 44 255.0 45 263.0 46 279.5 47 265.5 48 232.0 49 208.0 50 179.0 51 142.0 52 113.0 53 94.0 54 76.5 55 59.0 56 43.5 57 33.5 58 28.5 59 21.0 60 16.0 61 13.5 62 6.5 63 3.5 64 3.0 65 3.0 66 3.0 67 3.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.38749999999999996 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 0.9875 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.3375 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.6875 0.0 0.0 0.0 0.0 134-135 1.9 0.0 0.0 0.0 0.0 136-137 2.1500000000000004 0.0 0.0 0.0 0.0 138-139 2.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030790 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030790_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72675 33.0 33.0 34.0 32.0 34.0 2 32.8085 34.0 33.0 34.0 32.0 34.0 3 32.7795 34.0 33.0 34.0 32.0 34.0 4 32.75725 34.0 33.0 34.0 32.0 34.0 5 32.74025 34.0 33.0 34.0 32.0 34.0 6 36.94625 38.0 38.0 38.0 36.0 38.0 7 37.01525 38.0 38.0 38.0 37.0 38.0 8 37.0575 38.0 38.0 38.0 36.0 38.0 9 36.9715 38.0 38.0 38.0 37.0 38.0 10-14 36.98125 38.0 38.0 38.0 36.8 38.0 15-19 37.014799999999994 38.0 38.0 38.0 37.0 38.0 20-24 36.894600000000004 38.0 38.0 38.0 36.4 38.0 25-29 36.8028 38.0 38.0 38.0 35.8 38.0 30-34 36.814150000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.7797 38.0 38.0 38.0 36.0 38.0 40-44 36.6821 38.0 38.0 38.0 35.4 38.0 45-49 36.57725000000001 38.0 38.0 38.0 35.0 38.0 50-54 36.439499999999995 38.0 38.0 38.0 34.8 38.0 55-59 36.464000000000006 38.0 38.0 38.0 34.8 38.0 60-64 36.498450000000005 38.0 38.0 38.0 34.4 38.0 65-69 36.50895 38.0 38.0 38.0 35.0 38.0 70-74 36.239850000000004 38.0 38.0 38.0 33.8 38.0 75-79 36.0924 38.0 38.0 38.0 33.2 38.0 80-84 36.206500000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.1099 38.0 38.0 38.0 33.4 38.0 90-94 36.17775 38.0 38.0 38.0 34.0 38.0 95-99 35.8493 38.0 37.6 38.0 32.4 38.0 100-104 35.5067 38.0 37.0 38.0 30.4 38.0 105-109 35.34275 38.0 37.0 38.0 29.2 38.0 110-114 35.313900000000004 38.0 37.0 38.0 29.4 38.0 115-119 35.12285000000001 38.0 36.4 38.0 28.6 38.0 120-124 34.763549999999995 38.0 36.0 38.0 27.2 38.0 125-129 34.29375 38.0 35.0 38.0 23.2 38.0 130-134 34.154399999999995 38.0 35.0 38.0 23.2 38.0 135-139 33.622400000000006 38.0 34.2 38.0 20.6 38.0 140-144 32.82585 38.0 33.0 38.0 13.8 38.0 145-149 31.753849999999993 38.0 32.0 38.0 10.8 38.0 150-151 27.387999999999998 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 7.0 4 0.0 5 3.0 6 3.0 7 0.0 8 3.0 9 0.0 10 2.0 11 2.0 12 2.0 13 3.0 14 0.0 15 2.0 16 7.0 17 7.0 18 5.0 19 7.0 20 3.0 21 11.0 22 17.0 23 18.0 24 20.0 25 22.0 26 41.0 27 31.0 28 37.0 29 45.0 30 69.0 31 63.0 32 103.0 33 122.0 34 182.0 35 287.0 36 612.0 37 2251.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.56140350877193 20.902255639097746 14.736842105263156 29.79949874686717 2 26.785266850413432 26.33425206715109 29.616637434227012 17.263843648208468 3 20.30584106292304 28.002005515166704 30.809726748558536 20.882426673351716 4 22.325231771485843 33.80105236782761 24.50513655725382 19.368579303432725 5 24.34804413239719 35.8826479438315 22.316950852557675 17.45235707121364 6 20.349999999999998 39.2 22.0 18.45 7 20.075000000000003 22.45 38.85 18.625 8 21.955488872218055 27.231807951987996 27.25681420355089 23.55588897224306 9 21.975 26.875 28.299999999999997 22.85 10-14 22.75 30.075000000000003 26.265 20.91 15-19 22.655 29.455 26.985 20.905 20-24 23.422026607982392 28.693608082424728 27.39821946583975 20.486145843753125 25-29 22.640188084638087 28.85298384272923 27.47736481416638 21.02946325846631 30-34 22.686134306715335 29.43647182359118 27.42137106855343 20.456022801140055 35-39 23.44117205860293 28.491424571228563 27.36136806840342 20.706035301765088 40-44 23.380000000000003 28.325 27.52 20.775 45-49 23.26477505879998 28.67437321723465 27.64850122604214 20.412350497923235 50-54 22.967010929509676 28.266319061465957 27.815100772084627 20.951569236939736 55-59 23.154412870245075 28.000801884428405 27.855460331779682 20.989324913546838 60-64 23.152734003702037 28.055430486767722 28.07043874130772 20.721396768222522 65-69 23.473521028154224 27.89418412761914 27.584137620643094 21.048157223583537 70-74 23.71618580929046 28.741437071853593 26.86134306715336 20.681034051702586 75-79 23.8371511453436 28.68860658197459 27.29818945683705 20.176052815844752 80-84 23.838575786367954 28.73431014652198 26.934040106015907 20.49307396109416 85-89 23.805 28.105000000000004 27.750000000000004 20.34 90-94 23.58853828074211 28.404260639095863 27.559133870080508 20.44806721008151 95-99 23.46377101681345 28.727982385908728 27.206765412329865 20.60148118494796 100-104 23.776118655108483 28.150523625795458 27.719597133837752 20.353760585258303 105-109 23.687900641025642 27.669270833333332 27.844551282051285 20.798277243589745 110-114 23.854770954190837 28.075615123024605 27.805561112222442 20.264052810562113 115-119 23.73 28.13 27.175 20.965 120-124 23.39 27.93 27.85 20.830000000000002 125-129 24.482448244824482 27.952795279527955 27.482748274827486 20.08200820082008 130-134 24.09 28.24 27.425 20.244999999999997 135-139 23.69 28.189999999999998 27.46 20.66 140-144 24.297802032744205 28.142993040604818 27.376958894507585 20.182246032143393 145-149 24.747854884841185 27.84384565206483 27.30693963570676 20.101359827387224 150-151 25.062593890836254 27.341011517275916 27.278417626439662 20.317976965448175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.5 21 2.5 22 2.0 23 1.0 24 2.0 25 3.5 26 4.0 27 5.5 28 7.5 29 13.0 30 17.0 31 21.0 32 31.5 33 43.0 34 49.5 35 62.0 36 77.0 37 104.0 38 136.0 39 162.5 40 216.0 41 242.5 42 249.0 43 279.5 44 279.5 45 271.0 46 271.0 47 253.5 48 226.0 49 197.0 50 169.5 51 133.0 52 109.5 53 88.5 54 71.5 55 51.5 56 30.0 57 30.0 58 24.5 59 18.0 60 13.0 61 8.5 62 5.5 63 4.0 64 3.0 65 2.5 66 1.5 67 1.0 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.22499999999999998 3 0.27499999999999997 4 0.22499999999999998 5 0.3 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.0 20-24 0.03 25-29 0.045 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.08499999999999999 50-54 0.27 55-59 0.23500000000000001 60-64 0.055 65-69 0.015 70-74 0.005 75-79 0.03 80-84 0.015 85-89 0.0 90-94 0.015 95-99 0.08 100-104 0.215 105-109 0.16 110-114 0.02 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.135 145-149 0.35500000000000004 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5538771399798591 1.0999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.38749999999999996 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.7125 0.0 0.0 0.0 0.0 134-135 1.9249999999999998 0.0 0.0 0.0 0.0 136-137 2.2 0.0 0.0 0.0 0.0 138-139 2.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAGCA 10 0.006830828 145.0 8 GTAGTGA 10 0.006830828 145.0 145 >>END_MODULE Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra Read 916134 spots for SRR7030790.sra Written 916134 spots for SRR7030790.sra Read 916130 spots for SRR7030790.sra Written 916130 spots for SRR7030790.sra SRR ids: ['SRR7030790.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dshcwm0n SRR7030790.sra spots: 18322604 blocks: [[1, 916130], [916131, 1832260], [1832261, 2748390], [2748391, 3664520], [3664521, 4580650], [4580651, 5496780], [5496781, 6412910], [6412911, 7329040], [7329041, 8245170], [8245171, 9161300], [9161301, 10077430], [10077431, 10993560], [10993561, 11909690], [11909691, 12825820], [12825821, 13741950], [13741951, 14658080], [14658081, 15574210], [15574211, 16490340], [16490341, 17406470], [17406471, 18322604]] SRR7030790 file size 6187228 SRR7030790 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030790 SRR7030790_1.fastq SRR7030790_2.fastq Input file: SRR7030790_1.fastq Paired file: SRR7030790_2.fastq trimmed: SRR7030790-trimmed-pair1.fastq, SRR7030790-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:27:32 2025 >> started Wed Feb 12 17:28:03 2025 >> done (30.609s) 18322604 read pairs processed; of these: 59124 ( 0.32%) short read pairs filtered out after trimming by size control 60982 ( 0.33%) empty read pairs filtered out after trimming by size control 18202498 (99.34%) read pairs available; of these: 7177170 (39.43%) trimmed read pairs available after processing 11025328 (60.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 1 0.00% 21 3 0.00% 22 6 0.00% 23 4 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 3 0.00% 29 5 0.00% 30 4 0.00% 31 6 0.00% 32 3 0.00% 33 1 0.00% 34 1 0.00% 35 7 0.00% 36 6 0.00% 37 4 0.00% 38 5 0.00% 39 9 0.00% 40 3 0.00% 41 5 0.00% 42 5 0.00% 43 6 0.00% 44 13 0.00% 45 10 0.00% 46 16 0.00% 47 13 0.00% 48 14 0.00% 49 14 0.00% 50 23 0.00% 51 15 0.00% 52 28 0.00% 53 25 0.00% 54 29 0.00% 55 32 0.00% 56 36 0.00% 57 55 0.00% 58 54 0.00% 59 56 0.00% 60 65 0.00% 61 61 0.00% 62 82 0.00% 63 79 0.00% 64 112 0.00% 65 99 0.00% 66 121 0.00% 67 138 0.00% 68 161 0.00% 69 165 0.00% 70 221 0.00% 71 240 0.00% 72 254 0.00% 73 302 0.00% 74 314 0.00% 75 392 0.00% 76 398 0.00% 77 469 0.00% 78 538 0.00% 79 633 0.00% 80 653 0.00% 81 850 0.00% 82 923 0.01% 83 1357 0.01% 84 3825 0.02% 85 4109 0.02% 86 3572 0.02% 87 3695 0.02% 88 3748 0.02% 89 3811 0.02% 90 3926 0.02% 91 3969 0.02% 92 4303 0.02% 93 4463 0.02% 94 4910 0.03% 95 5264 0.03% 96 5914 0.03% 97 9004 0.05% 98 8399 0.05% 99 6068 0.03% 100 6359 0.03% 101 6679 0.04% 102 7119 0.04% 103 7511 0.04% 104 8195 0.05% 105 8772 0.05% 106 9364 0.05% 107 9782 0.05% 108 10260 0.06% 109 10970 0.06% 110 11505 0.06% 111 12156 0.07% 112 13234 0.07% 113 14048 0.08% 114 15338 0.08% 115 16380 0.09% 116 17018 0.09% 117 18168 0.10% 118 18824 0.10% 119 19478 0.11% 120 20708 0.11% 121 22039 0.12% 122 23818 0.13% 123 24391 0.13% 124 25264 0.14% 125 26870 0.15% 126 28235 0.16% 127 29594 0.16% 128 31213 0.17% 129 32776 0.18% 130 34722 0.19% 131 36940 0.20% 132 39116 0.21% 133 41890 0.23% 134 44693 0.25% 135 48601 0.27% 136 52572 0.29% 137 57120 0.31% 138 62214 0.34% 139 68090 0.37% 140 75555 0.42% 141 84113 0.46% 142 96168 0.53% 143 113394 0.62% 144 140623 0.77% 145 173355 0.95% 146 217014 1.19% 147 277003 1.52% 148 385205 2.12% 149 696361 3.83% 150 3838210 21.09% 151 11025328 60.57% 18202498 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=40 prefix-density=0.18 prefix-fanout=2.2 sequence=GTGGACTCCTTCTGGATGTTGTAGTCAGC criterion=fanout-score sequence-density=0.12 sequence-density-rank=6 fanout-score=93.50 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=18.8 sequence=CCTTCTTCTTGA criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=36 prefix-density=0.48 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=12 fanout-score=328.07 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=30.1 sequence=AAGAAGAAGAAA SRR7030790 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:28:49 Started mapping on | Feb 12 17:28:50 Finished on | Feb 12 17:30:54 Mapping speed, Million of reads per hour | 528.46 Number of input reads | 18202498 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17238335 Uniquely mapped reads % | 94.70% Average mapped length | 296.55 Number of splices: Total | 15621429 Number of splices: Annotated (sjdb) | 15332150 Number of splices: GT/AG | 15364085 Number of splices: GC/AG | 206849 Number of splices: AT/AC | 10631 Number of splices: Non-canonical | 39864 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 530696 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 119724 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.46% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 462208 462208 462208 N_multimapping 530696 530696 530696 N_noFeature 383120 17074543 464481 N_ambiguous 167020 969 84073 UnstrandedReadsAssigned:16688195 PositiveStrandReadsAssigned:162823 NegativeStrandReadsAssigned:16689781 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030790 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030790-trimmed-pair1.fastq SRR7030790-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,202,498 reads, 16,766,573 reads pseudoaligned [quant] estimated average fragment length: 259.763 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR7030790.ke.tsv 34699 SRR7030790.se.tsv 87100 total ==> SRR7030790.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.24 3188 81.0961 Potri.005G024800.1.v4.1 1035 776.237 1465 84.4597 Potri.004G059700.1.v4.1 961 702.248 29 1.84805 Potri.007G009000.2.v4.1 1416 1157.24 0 0 Potri.003G141000.2.v4.1 2943 2684.24 738.249 12.308 Potri.016G087400.1.v4.1 270 67.3355 780 518.39 Potri.015G069301.1.v4.1 564 309.754 0 0 Potri.010G195200.1.v4.1 1773 1514.24 67 1.9801 Potri.012G127500.1.v4.1 977 718.243 3498 217.949 ==> SRR7030790.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 182 Potri.001G212900.v4.1 36 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 107 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7030790 completed mapping pipeline successfully