Starting /dee2/code/volunteer_pipeline.sh SRR7030791 current disk space = 3051424157696 free memory = 1577550536 SRR7030791 SRAfilesize c6bc015d19739a64c16848c892111aa5 SRR7030791.sra SRR7030791.sra file validated SRR7030791 is paired end SRR7030791 is conventional basespace SRR7030791 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030791_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.6365 32.0 18.0 33.0 18.0 34.0 2 31.26775 33.0 30.0 33.0 27.0 34.0 3 30.3355 31.0 29.0 33.0 27.0 33.0 4 31.45925 33.0 31.0 33.0 29.0 33.0 5 32.3375 33.0 33.0 33.0 32.0 34.0 6 35.87825 38.0 36.0 38.0 32.0 38.0 7 36.799 38.0 37.0 38.0 34.0 38.0 8 36.65025 38.0 37.0 38.0 34.0 38.0 9 37.3015 38.0 38.0 38.0 36.0 38.0 10-14 37.38755 38.0 38.0 38.0 36.8 38.0 15-19 37.415749999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.44245 38.0 38.0 38.0 37.0 38.0 25-29 37.394949999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.3437 38.0 38.0 38.0 37.0 38.0 35-39 37.2928 38.0 38.0 38.0 37.0 38.0 40-44 37.25315 38.0 38.0 38.0 37.0 38.0 45-49 37.221650000000004 38.0 38.0 38.0 36.8 38.0 50-54 37.202149999999996 38.0 38.0 38.0 36.2 38.0 55-59 37.142900000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.083549999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.02865 38.0 38.0 38.0 36.0 38.0 70-74 36.988600000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.933350000000004 38.0 38.0 38.0 35.6 38.0 80-84 36.81135 38.0 38.0 38.0 35.0 38.0 85-89 36.831900000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.64915 38.0 38.0 38.0 34.0 38.0 95-99 36.43044999999999 38.0 38.0 38.0 33.8 38.0 100-104 36.41575 38.0 38.0 38.0 34.0 38.0 105-109 36.3472 38.0 37.6 38.0 33.8 38.0 110-114 36.29135 38.0 37.2 38.0 33.8 38.0 115-119 35.973200000000006 38.0 37.0 38.0 32.8 38.0 120-124 35.738 38.0 36.8 38.0 31.0 38.0 125-129 35.49935 38.0 36.0 38.0 30.6 38.0 130-134 35.0995 38.0 35.6 38.0 28.2 38.0 135-139 34.8298 38.0 35.0 38.0 27.8 38.0 140-144 34.819900000000004 38.0 35.4 38.0 27.8 38.0 145-149 34.1965 38.0 35.0 38.0 25.6 38.0 150-151 30.6565 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.0 21 2.0 22 3.0 23 8.0 24 7.0 25 15.0 26 19.0 27 25.0 28 31.0 29 22.0 30 43.0 31 72.0 32 86.0 33 104.0 34 184.0 35 294.0 36 788.0 37 2291.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.82212462256382 12.352456766401318 9.634916277793028 42.19050233324184 2 20.25 14.85 36.675000000000004 28.225 3 18.224999999999998 19.075 28.575 34.125 4 21.85 26.674999999999997 24.9 26.575 5 22.350577599196384 30.36162732295329 25.36413862380713 21.923656454043194 6 18.5 33.7 25.575 22.225 7 13.725000000000001 28.050000000000004 40.525 17.7 8 18.5 24.6 31.4 25.5 9 16.675 24.5 33.15 25.674999999999997 10-14 19.1 29.630000000000003 27.455000000000002 23.815 15-19 19.025 28.83 28.21 23.935000000000002 20-24 19.400000000000002 28.965000000000003 27.76 23.875 25-29 20.145 29.01 26.889999999999997 23.955000000000002 30-34 19.355 28.185 27.889999999999997 24.57 35-39 19.395 28.475 27.689999999999998 24.44 40-44 18.89 28.915000000000003 27.765 24.43 45-49 19.585 28.405 27.71 24.3 50-54 20.01 28.349999999999998 27.82 23.82 55-59 19.134999999999998 28.27 28.365000000000002 24.23 60-64 19.755 28.349999999999998 27.689999999999998 24.205 65-69 20.095 28.68 27.500000000000004 23.724999999999998 70-74 20.285 28.63 27.43 23.655 75-79 19.86 28.555000000000003 27.439999999999998 24.145 80-84 20.015 28.105000000000004 27.505000000000003 24.375 85-89 20.03 28.405 27.155 24.41 90-94 19.775000000000002 28.34 28.244999999999997 23.64 95-99 19.650000000000002 28.43 27.655 24.265 100-104 19.715 28.08 27.82 24.385 105-109 19.855 28.425 28.12 23.599999999999998 110-114 20.19 28.4 27.87 23.54 115-119 20.200000000000003 28.139999999999997 27.85 23.810000000000002 120-124 20.465 28.62 27.71 23.205000000000002 125-129 19.865 28.144999999999996 27.73 24.26 130-134 20.755000000000003 27.810000000000002 27.334999999999997 24.099999999999998 135-139 20.785 27.93 27.894999999999996 23.39 140-144 20.645 27.955000000000002 27.43 23.97 145-149 20.125 28.21 27.71 23.955000000000002 150-151 21.179422835633627 28.05520702634881 27.879548306148056 22.88582183186951 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 3.0 24 2.0 25 1.5 26 5.0 27 8.0 28 9.0 29 11.5 30 18.5 31 25.5 32 32.0 33 47.5 34 58.0 35 73.0 36 92.5 37 100.0 38 118.5 39 150.0 40 190.5 41 213.5 42 240.0 43 270.0 44 281.5 45 278.0 46 271.5 47 268.0 48 243.0 49 213.0 50 173.5 51 140.5 52 111.5 53 87.0 54 71.5 55 52.0 56 38.5 57 24.5 58 16.0 59 13.5 60 13.0 61 10.0 62 4.5 63 4.0 64 3.5 65 2.0 66 2.0 67 1.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.924999999999999 2 0.0 3 0.0 4 0.0 5 0.44999999999999996 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.38749999999999996 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.7250000000000001 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.175 0.0 0.0 0.0 0.0 128-129 1.3250000000000002 0.0 0.0 0.0 0.0 130-131 1.5125 0.0 0.0 0.0 0.0 132-133 1.775 0.0 0.0 0.0 0.0 134-135 1.9 0.0 0.0 0.0 0.0 136-137 2.25 0.0 0.0 0.0 0.0 138-139 2.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGATTG 10 0.006594202 146.6962 3 >>END_MODULE SRR7030791 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030791_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82225 33.0 33.0 34.0 32.0 34.0 2 32.89 33.0 33.0 34.0 32.0 34.0 3 32.91675 33.0 33.0 34.0 32.0 34.0 4 32.8975 33.0 33.0 34.0 32.0 34.0 5 32.90025 33.0 33.0 34.0 32.0 34.0 6 37.136 38.0 38.0 38.0 36.0 38.0 7 37.14125 38.0 38.0 38.0 36.0 38.0 8 37.254 38.0 38.0 38.0 37.0 38.0 9 37.28775 38.0 38.0 38.0 37.0 38.0 10-14 37.14095 38.0 38.0 38.0 36.8 38.0 15-19 37.1543 38.0 38.0 38.0 36.6 38.0 20-24 37.141 38.0 38.0 38.0 36.6 38.0 25-29 37.1486 38.0 38.0 38.0 36.6 38.0 30-34 37.0617 38.0 38.0 38.0 36.0 38.0 35-39 36.93515000000001 38.0 38.0 38.0 35.8 38.0 40-44 36.87605 38.0 38.0 38.0 35.8 38.0 45-49 36.8492 38.0 38.0 38.0 35.6 38.0 50-54 36.8478 38.0 38.0 38.0 35.8 38.0 55-59 36.78145 38.0 38.0 38.0 35.4 38.0 60-64 36.7042 38.0 38.0 38.0 35.2 38.0 65-69 36.707350000000005 38.0 38.0 38.0 35.0 38.0 70-74 36.60600000000001 38.0 38.0 38.0 35.0 38.0 75-79 36.51055 38.0 38.0 38.0 34.4 38.0 80-84 36.52265 38.0 38.0 38.0 34.0 38.0 85-89 36.3006 38.0 38.0 38.0 33.8 38.0 90-94 36.304500000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.10245 38.0 37.4 38.0 33.2 38.0 100-104 35.919200000000004 38.0 37.0 38.0 32.6 38.0 105-109 35.84475 38.0 37.0 38.0 32.2 38.0 110-114 35.6003 38.0 36.8 38.0 30.6 38.0 115-119 35.287 38.0 36.2 38.0 29.0 38.0 120-124 35.1284 38.0 36.0 38.0 28.2 38.0 125-129 35.0154 38.0 36.0 38.0 27.8 38.0 130-134 34.6195 38.0 35.2 38.0 26.4 38.0 135-139 34.373900000000006 38.0 35.0 38.0 24.8 38.0 140-144 33.87645 38.0 34.6 38.0 22.4 38.0 145-149 33.0109 38.0 33.6 38.0 16.6 38.0 150-151 29.114125 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 5.0 4 2.0 5 0.0 6 4.0 7 0.0 8 2.0 9 0.0 10 2.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 3.0 17 2.0 18 2.0 19 2.0 20 5.0 21 7.0 22 8.0 23 15.0 24 17.0 25 12.0 26 27.0 27 15.0 28 37.0 29 39.0 30 58.0 31 68.0 32 99.0 33 120.0 34 196.0 35 304.0 36 661.0 37 2280.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.2 20.9 13.200000000000001 28.7 2 26.23279098873592 26.282853566958696 31.11389236545682 16.37046307884856 3 19.839679358717436 28.80761523046092 31.437875751503007 19.914829659318638 4 23.79759519038076 33.69238476953908 24.273547094188377 18.236472945891784 5 24.112056028014006 36.493246623311656 22.861430715357677 16.53326663331666 6 20.68534267133567 38.344172086043024 23.81190595297649 17.158579289644823 7 20.58529264632316 22.28614307153577 38.46923461730866 18.659329664832416 8 21.65 26.375 29.299999999999997 22.675 9 22.175 25.775 29.975 22.075 10-14 23.285 29.349999999999998 26.640000000000004 20.724999999999998 15-19 22.96 28.189999999999998 28.005000000000003 20.845 20-24 23.175 28.355000000000004 27.48 20.990000000000002 25-29 23.02 28.235 27.894999999999996 20.849999999999998 30-34 22.884999999999998 28.43 27.744999999999997 20.94 35-39 23.135 28.18 27.755000000000003 20.93 40-44 23.305 28.194999999999997 27.845 20.655 45-49 23.005 28.294999999999998 27.950000000000003 20.75 50-54 23.365 28.63 27.805000000000003 20.200000000000003 55-59 23.669999999999998 28.355000000000004 27.54 20.435 60-64 22.745 28.215 28.395 20.645 65-69 23.615 28.1 28.005000000000003 20.28 70-74 23.775 28.689999999999998 27.325 20.21 75-79 23.485 27.925 28.549999999999997 20.04 80-84 23.64 28.37 28.065 19.925 85-89 23.830000000000002 28.044999999999998 28.125 20.0 90-94 23.849999999999998 27.725 28.415000000000003 20.01 95-99 23.794999999999998 27.36 28.34 20.505000000000003 100-104 24.195 27.85 27.725 20.23 105-109 23.875 27.905 28.405 19.814999999999998 110-114 24.245 27.71 28.125 19.919999999999998 115-119 23.794999999999998 28.144999999999996 27.534999999999997 20.525 120-124 23.880000000000003 28.26 28.115000000000002 19.744999999999997 125-129 23.785 27.939999999999998 28.310000000000002 19.965 130-134 24.3 28.38 27.46 19.86 135-139 24.585 27.79 27.91 19.715 140-144 24.365000000000002 27.944999999999997 27.705000000000002 19.985 145-149 24.959999999999997 27.685 27.54 19.814999999999998 150-151 24.81231231231231 28.866366366366364 27.25225225225225 19.06906906906907 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.5 23 2.0 24 4.5 25 3.5 26 2.5 27 4.0 28 8.5 29 12.5 30 15.5 31 20.0 32 24.5 33 36.0 34 51.5 35 71.0 36 89.5 37 103.5 38 136.0 39 181.0 40 202.0 41 236.5 42 255.5 43 266.0 44 284.5 45 292.5 46 277.5 47 259.5 48 242.0 49 195.0 50 158.0 51 130.0 52 107.5 53 81.5 54 62.0 55 46.0 56 35.0 57 26.5 58 16.5 59 13.0 60 10.0 61 8.0 62 7.5 63 6.5 64 5.0 65 1.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.2 4 0.2 5 0.05 6 0.05 7 0.05 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5032712632108707 1.0 3 0.0754906894816306 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.38749999999999996 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.5375 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.2999999999999998 0.0 0.0 0.0 0.0 130-131 1.4875 0.0 0.0 0.0 0.0 132-133 1.75 0.0 0.0 0.0 0.0 134-135 1.875 0.0 0.0 0.0 0.0 136-137 2.175 0.0 0.0 0.0 0.0 138-139 2.3499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCATAT 10 0.006577216 146.82278 145 >>END_MODULE Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra Read 1416179 spots for SRR7030791.sra Written 1416179 spots for SRR7030791.sra SRR ids: ['SRR7030791.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ds5j6qs SRR7030791.sra spots: 28323580 blocks: [[1, 1416179], [1416180, 2832358], [2832359, 4248537], [4248538, 5664716], [5664717, 7080895], [7080896, 8497074], [8497075, 9913253], [9913254, 11329432], [11329433, 12745611], [12745612, 14161790], [14161791, 15577969], [15577970, 16994148], [16994149, 18410327], [18410328, 19826506], [19826507, 21242685], [21242686, 22658864], [22658865, 24075043], [24075044, 25491222], [25491223, 26907401], [26907402, 28323580]] SRR7030791 file size 9576231 SRR7030791 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030791 SRR7030791_1.fastq SRR7030791_2.fastq Input file: SRR7030791_1.fastq Paired file: SRR7030791_2.fastq trimmed: SRR7030791-trimmed-pair1.fastq, SRR7030791-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:15:41 2025 >> started Wed Feb 12 18:16:12 2025 >> done (30.911s) 28323580 read pairs processed; of these: 22853 ( 0.08%) short read pairs filtered out after trimming by size control 26410 ( 0.09%) empty read pairs filtered out after trimming by size control 28274317 (99.83%) read pairs available; of these: 10906503 (38.57%) trimmed read pairs available after processing 17367814 (61.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 7 0.00% 21 5 0.00% 22 4 0.00% 23 5 0.00% 24 8 0.00% 25 3 0.00% 26 3 0.00% 27 6 0.00% 28 3 0.00% 29 6 0.00% 30 4 0.00% 31 6 0.00% 32 5 0.00% 33 6 0.00% 34 7 0.00% 35 6 0.00% 36 8 0.00% 37 7 0.00% 38 14 0.00% 39 9 0.00% 40 6 0.00% 41 8 0.00% 42 9 0.00% 43 19 0.00% 44 13 0.00% 45 7 0.00% 46 8 0.00% 47 12 0.00% 48 11 0.00% 49 17 0.00% 50 16 0.00% 51 24 0.00% 52 23 0.00% 53 26 0.00% 54 27 0.00% 55 29 0.00% 56 44 0.00% 57 36 0.00% 58 51 0.00% 59 61 0.00% 60 58 0.00% 61 88 0.00% 62 75 0.00% 63 100 0.00% 64 115 0.00% 65 111 0.00% 66 130 0.00% 67 152 0.00% 68 165 0.00% 69 196 0.00% 70 188 0.00% 71 244 0.00% 72 316 0.00% 73 340 0.00% 74 372 0.00% 75 412 0.00% 76 484 0.00% 77 521 0.00% 78 654 0.00% 79 687 0.00% 80 785 0.00% 81 959 0.00% 82 1087 0.00% 83 1251 0.00% 84 2436 0.01% 85 3217 0.01% 86 3282 0.01% 87 3486 0.01% 88 3833 0.01% 89 3912 0.01% 90 4042 0.01% 91 4376 0.02% 92 4859 0.02% 93 4998 0.02% 94 5517 0.02% 95 5821 0.02% 96 6356 0.02% 97 6753 0.02% 98 7194 0.03% 99 7560 0.03% 100 8251 0.03% 101 9101 0.03% 102 9399 0.03% 103 10307 0.04% 104 11024 0.04% 105 11852 0.04% 106 12735 0.05% 107 13452 0.05% 108 14264 0.05% 109 15378 0.05% 110 16398 0.06% 111 17304 0.06% 112 18836 0.07% 113 19977 0.07% 114 21524 0.08% 115 23383 0.08% 116 24817 0.09% 117 25981 0.09% 118 27314 0.10% 119 28525 0.10% 120 30156 0.11% 121 31781 0.11% 122 33593 0.12% 123 35740 0.13% 124 38061 0.13% 125 40393 0.14% 126 42555 0.15% 127 45193 0.16% 128 47318 0.17% 129 50128 0.18% 130 52687 0.19% 131 56526 0.20% 132 59716 0.21% 133 64552 0.23% 134 70054 0.25% 135 75001 0.27% 136 80738 0.29% 137 86477 0.31% 138 94450 0.33% 139 103762 0.37% 140 111446 0.39% 141 121001 0.43% 142 134142 0.47% 143 153580 0.54% 144 180223 0.64% 145 221104 0.78% 146 282067 1.00% 147 385258 1.36% 148 591051 2.09% 149 1173047 4.15% 150 5987170 21.18% 151 17367814 61.43% 28274317 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=36 prefix-density=0.22 prefix-fanout=2.2 sequence=ACTGATTCCTTTGCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=187.01 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=16.5 sequence=TCTCTTCTTCAGTCTTGGGGTGGTACCCAGGTAACTTCTCCTTGATCTTCTCGAGTAGTCCCTTCTTCTCCTTGGCATCTCCTTCATGGGAAACTGCAGCTTCAGGGGAAACATGTTCAGGAGCTGGAGGAGGGACCTCGTCAGCTTTCTTATGTCCTGGCAATTTCTCCTTGATTTTGTCAAGGAAACCCTTCTTATCCTCTGGTTCATGGGGTGTCTCTGTATGGACTACCTCGACAGGAACACTAGTATCCTCGTGTTCCTTCTCCT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=37 prefix-density=0.48 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=215.00 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=24.6 sequence=AAAGAAGAAAAACAGTTTCTCAAGAGCAGTATATATAGATCTTTCAGAAGAATTAAGGAGATGGCAGACGAGGGAACAGCTACTTGCATAGACATCTTGTTGGCCATCATCTTGCCTCCGCTTGGTGTCTTCCTCAAGTT SRR7030791 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:16:55 Started mapping on | Feb 12 18:16:56 Finished on | Feb 12 18:19:22 Mapping speed, Million of reads per hour | 697.17 Number of input reads | 28274317 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 27099974 Uniquely mapped reads % | 95.85% Average mapped length | 296.98 Number of splices: Total | 24883648 Number of splices: Annotated (sjdb) | 24414236 Number of splices: GT/AG | 24516352 Number of splices: GC/AG | 284531 Number of splices: AT/AC | 16110 Number of splices: Non-canonical | 66655 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 760078 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 115942 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.98% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 436598 436598 436598 N_multimapping 760078 760078 760078 N_noFeature 617977 26824795 750683 N_ambiguous 259038 1589 115788 UnstrandedReadsAssigned:26222959 PositiveStrandReadsAssigned:273590 NegativeStrandReadsAssigned:26233503 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030791 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030791-trimmed-pair1.fastq SRR7030791-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,274,317 reads, 26,178,314 reads pseudoaligned [quant] estimated average fragment length: 256.488 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR7030791.ke.tsv 34699 SRR7030791.se.tsv 87100 total ==> SRR7030791.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.51 3767 61.3595 Potri.005G024800.1.v4.1 1035 779.512 2422 89.2009 Potri.004G059700.1.v4.1 961 705.536 19 0.773129 Potri.007G009000.2.v4.1 1416 1160.51 0 0 Potri.003G141000.2.v4.1 2943 2687.51 1480 15.8099 Potri.016G087400.1.v4.1 270 68.1214 2204.31 928.98 Potri.015G069301.1.v4.1 564 312.01 0 0 Potri.010G195200.1.v4.1 1773 1517.51 307 5.80797 Potri.012G127500.1.v4.1 977 721.53 14674 583.864 ==> SRR7030791.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 181 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 31 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 78 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR7030791 completed mapping pipeline successfully