Starting /dee2/code/volunteer_pipeline.sh SRR7030792 current disk space = 3051735715840 free memory = 1468999436 SRR7030792 SRAfilesize 5a5d59d6a86bd6c2642598a2ce83b35f SRR7030792.sra SRR7030792.sra file validated SRR7030792 is paired end SRR7030792 is conventional basespace SRR7030792 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030792_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.408 33.0 33.0 34.0 25.0 34.0 2 32.27625 33.0 33.0 34.0 28.0 34.0 3 31.49525 33.0 31.0 33.0 27.0 34.0 4 32.391 33.0 33.0 33.0 32.0 34.0 5 32.932 33.0 33.0 34.0 32.0 34.0 6 36.51675 38.0 37.0 38.0 34.0 38.0 7 36.56775 38.0 37.0 38.0 34.0 38.0 8 37.117 38.0 38.0 38.0 36.0 38.0 9 37.28925 38.0 38.0 38.0 37.0 38.0 10-14 37.4195 38.0 38.0 38.0 37.0 38.0 15-19 37.426249999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.369749999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.3614 38.0 38.0 38.0 37.0 38.0 30-34 37.335249999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.240899999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.18265 38.0 38.0 38.0 36.4 38.0 45-49 37.14845 38.0 38.0 38.0 36.2 38.0 50-54 37.218 38.0 38.0 38.0 36.4 38.0 55-59 37.147149999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.0828 38.0 38.0 38.0 36.0 38.0 65-69 36.9497 38.0 38.0 38.0 35.8 38.0 70-74 36.9833 38.0 38.0 38.0 35.8 38.0 75-79 36.8869 38.0 38.0 38.0 35.2 38.0 80-84 36.84695000000001 38.0 38.0 38.0 35.2 38.0 85-89 36.7832 38.0 38.0 38.0 35.0 38.0 90-94 36.6386 38.0 38.0 38.0 34.2 38.0 95-99 36.44045 38.0 37.8 38.0 33.8 38.0 100-104 36.38245 38.0 38.0 38.0 34.0 38.0 105-109 36.052499999999995 38.0 37.2 38.0 32.6 38.0 110-114 36.16585 38.0 37.6 38.0 33.6 38.0 115-119 36.01635 38.0 37.0 38.0 32.6 38.0 120-124 35.7938 38.0 36.4 38.0 32.2 38.0 125-129 35.34739999999999 38.0 36.0 38.0 29.4 38.0 130-134 35.103449999999995 38.0 35.8 38.0 28.0 38.0 135-139 34.73135 38.0 35.2 38.0 27.2 38.0 140-144 34.65089999999999 38.0 35.0 38.0 27.0 38.0 145-149 34.230599999999995 38.0 35.0 38.0 25.2 38.0 150-151 30.969125 36.5 30.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 2.0 17 1.0 18 3.0 19 3.0 20 1.0 21 1.0 22 2.0 23 8.0 24 11.0 25 7.0 26 14.0 27 14.0 28 31.0 29 34.0 30 40.0 31 56.0 32 92.0 33 122.0 34 180.0 35 294.0 36 744.0 37 2335.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.703504043126685 11.428571428571429 9.137466307277627 39.73045822102426 2 22.575 14.149999999999999 34.699999999999996 28.575 3 19.1 19.725 27.375 33.800000000000004 4 22.675 28.575 23.599999999999998 25.15 5 22.6 31.25 24.7 21.45 6 18.35 34.675 24.75 22.225 7 14.625 25.25 42.699999999999996 17.424999999999997 8 17.9 25.324999999999996 31.5 25.275 9 17.05 23.525 35.325 24.099999999999998 10-14 19.759999999999998 29.325000000000003 26.840000000000003 24.075 15-19 19.715 28.52 27.744999999999997 24.02 20-24 20.385 28.23 27.534999999999997 23.849999999999998 25-29 19.56 28.325 27.994999999999997 24.12 30-34 19.35 29.080000000000002 27.57 24.0 35-39 19.45 28.235 27.884999999999998 24.43 40-44 20.200000000000003 28.689999999999998 27.255000000000003 23.855 45-49 19.97 28.075 27.97 23.985 50-54 19.665 28.18 28.144999999999996 24.01 55-59 19.73 29.099999999999998 27.939999999999998 23.23 60-64 19.685 28.12 28.050000000000004 24.145 65-69 19.71 28.08 28.07 24.14 70-74 19.869999999999997 28.57 27.41 24.15 75-79 20.205000000000002 28.305000000000003 27.43 24.060000000000002 80-84 20.235 27.689999999999998 28.08 23.995 85-89 20.335 27.74 27.725 24.2 90-94 19.77 27.57 28.449999999999996 24.21 95-99 20.39 27.765 27.950000000000003 23.895 100-104 20.24 28.59 27.565 23.605 105-109 20.28 27.894999999999996 28.000000000000004 23.825 110-114 19.85 28.435 27.965 23.75 115-119 20.54 27.639999999999997 28.005000000000003 23.815 120-124 20.18 27.54 28.455000000000002 23.825 125-129 21.01 27.48 27.49 24.02 130-134 20.265 27.534999999999997 28.425 23.775 135-139 20.205000000000002 28.32 27.27 24.205 140-144 20.805 28.535 27.560000000000002 23.1 145-149 20.3 28.09 27.395000000000003 24.215 150-151 20.060030015007506 28.23911955977989 27.313656828414207 24.387193596798397 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 2.5 25 1.5 26 4.0 27 8.0 28 9.5 29 11.0 30 15.5 31 19.5 32 26.5 33 39.5 34 58.0 35 67.5 36 78.0 37 98.5 38 129.0 39 171.5 40 195.5 41 213.0 42 251.0 43 272.0 44 269.0 45 264.5 46 253.5 47 250.5 48 252.0 49 217.0 50 171.5 51 141.5 52 117.5 53 95.5 54 77.0 55 63.0 56 43.5 57 29.5 58 17.5 59 13.0 60 12.0 61 9.5 62 7.5 63 4.5 64 5.5 65 5.0 66 1.0 67 0.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.249999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.2625000000000002 0.0 0.0 0.0 0.0 124-125 1.3875 0.0 0.0 0.0 0.0 126-127 1.45 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.7875 0.0 0.0 0.0 0.0 132-133 2.0625 0.0 0.0 0.0 0.0 134-135 2.375 0.0 0.0 0.0 0.0 136-137 2.5999999999999996 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCCCT 10 0.0068378756 144.95 9 CATCTTC 45 0.008969499 48.316666 5 >>END_MODULE SRR7030792 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030792_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7665 33.0 33.0 34.0 32.0 34.0 2 32.8915 33.0 33.0 34.0 32.0 34.0 3 32.90625 33.0 33.0 34.0 32.0 34.0 4 32.91525 33.0 33.0 34.0 32.0 34.0 5 32.87175 33.0 33.0 34.0 32.0 34.0 6 37.13275 38.0 38.0 38.0 36.0 38.0 7 37.132 38.0 38.0 38.0 36.0 38.0 8 37.182 38.0 38.0 38.0 37.0 38.0 9 37.1745 38.0 38.0 38.0 37.0 38.0 10-14 37.1734 38.0 38.0 38.0 36.4 38.0 15-19 37.0202 38.0 38.0 38.0 36.0 38.0 20-24 37.0959 38.0 38.0 38.0 36.0 38.0 25-29 37.0196 38.0 38.0 38.0 36.0 38.0 30-34 36.99975 38.0 38.0 38.0 36.0 38.0 35-39 36.8282 38.0 38.0 38.0 35.6 38.0 40-44 36.8394 38.0 38.0 38.0 35.6 38.0 45-49 36.79735000000001 38.0 38.0 38.0 35.6 38.0 50-54 36.734449999999995 38.0 38.0 38.0 35.2 38.0 55-59 36.675599999999996 38.0 38.0 38.0 35.0 38.0 60-64 36.6839 38.0 38.0 38.0 34.8 38.0 65-69 36.632549999999995 38.0 38.0 38.0 34.2 38.0 70-74 36.5192 38.0 38.0 38.0 34.0 38.0 75-79 36.4317 38.0 38.0 38.0 34.0 38.0 80-84 36.3904 38.0 38.0 38.0 34.0 38.0 85-89 36.1383 38.0 37.2 38.0 33.2 38.0 90-94 36.1225 38.0 37.0 38.0 33.2 38.0 95-99 35.9159 38.0 37.0 38.0 32.6 38.0 100-104 35.66315 38.0 37.0 38.0 31.2 38.0 105-109 35.558350000000004 38.0 36.8 38.0 30.2 38.0 110-114 35.3241 38.0 36.2 38.0 29.2 38.0 115-119 35.1496 38.0 36.0 38.0 28.2 38.0 120-124 34.98225 38.0 36.0 38.0 28.0 38.0 125-129 34.71045 38.0 35.0 38.0 27.0 38.0 130-134 34.34165 38.0 35.0 38.0 24.2 38.0 135-139 33.87975 38.0 34.4 38.0 22.2 38.0 140-144 33.62065 38.0 34.2 38.0 21.8 38.0 145-149 32.70065 38.0 33.6 38.0 14.0 38.0 150-151 28.982125000000003 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 0.0 5 1.0 6 2.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 1.0 13 1.0 14 3.0 15 2.0 16 4.0 17 5.0 18 6.0 19 3.0 20 5.0 21 6.0 22 7.0 23 16.0 24 19.0 25 19.0 26 15.0 27 27.0 28 40.0 29 58.0 30 72.0 31 67.0 32 100.0 33 132.0 34 190.0 35 321.0 36 742.0 37 2126.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.01750875437719 20.96048024012006 14.457228614307155 29.5647823911956 2 27.75275275275275 26.101101101101097 30.405405405405407 15.74074074074074 3 19.294294294294296 29.429429429429426 31.58158158158158 19.694694694694697 4 21.996996996996998 34.85985985985986 24.14914914914915 18.993993993993993 5 23.961980990495245 37.24362181090545 21.76088044022011 17.03351675837919 6 19.5 38.9 23.549999999999997 18.05 7 20.0 22.275 39.324999999999996 18.4 8 22.05 24.825 28.4 24.725 9 21.825 24.4 29.725 24.05 10-14 23.025000000000002 29.455 26.66 20.86 15-19 22.720000000000002 28.560000000000002 27.32 21.4 20-24 22.689999999999998 29.09 27.91 20.31 25-29 23.28 29.025000000000002 27.465 20.23 30-34 23.235 28.634999999999998 27.439999999999998 20.69 35-39 23.215 28.835 27.565 20.385 40-44 23.41 28.075 28.185 20.330000000000002 45-49 22.900000000000002 28.310000000000002 28.325 20.465 50-54 23.56 28.04 27.400000000000002 21.0 55-59 22.98 28.34 28.560000000000002 20.119999999999997 60-64 23.080000000000002 27.375 28.585 20.96 65-69 23.515 27.589999999999996 27.744999999999997 21.15 70-74 23.355 28.07 27.589999999999996 20.985 75-79 22.91 28.055000000000003 28.315 20.72 80-84 23.175 28.285 27.555000000000003 20.985 85-89 23.580000000000002 27.884999999999998 27.785 20.75 90-94 23.315 27.455000000000002 28.075 21.154999999999998 95-99 23.315 28.610000000000003 27.950000000000003 20.125 100-104 23.79 27.845 28.13 20.235 105-109 23.89 27.665 28.055000000000003 20.39 110-114 23.985 28.165000000000003 27.72 20.13 115-119 24.46 28.199999999999996 27.565 19.775000000000002 120-124 24.085 27.875 27.85 20.19 125-129 24.349999999999998 28.025 27.500000000000004 20.125 130-134 24.465 28.96 26.815 19.759999999999998 135-139 24.19 28.125 27.389999999999997 20.294999999999998 140-144 24.555 27.83 27.744999999999997 19.869999999999997 145-149 24.365000000000002 28.895 27.345000000000002 19.395 150-151 25.05 27.212500000000002 27.175 20.5625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.5 23 2.5 24 2.0 25 4.0 26 6.0 27 5.5 28 8.0 29 10.5 30 12.0 31 17.0 32 25.0 33 36.5 34 52.5 35 71.5 36 87.5 37 105.0 38 132.5 39 168.5 40 212.5 41 241.0 42 270.0 43 290.5 44 286.5 45 279.5 46 256.0 47 233.0 48 225.0 49 215.0 50 181.0 51 126.5 52 95.0 53 80.0 54 57.0 55 44.0 56 39.0 57 32.5 58 21.5 59 16.5 60 15.5 61 12.0 62 6.5 63 2.0 64 2.0 65 1.5 66 2.0 67 2.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.1 3 0.1 4 0.1 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.2625000000000002 0.0 0.0 0.0 0.0 124-125 1.3875 0.0 0.0 0.0 0.0 126-127 1.45 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.7875 0.0 0.0 0.0 0.0 132-133 2.0375 0.0 0.0 0.0 0.0 134-135 2.35 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTGCC 10 0.006830828 145.0 7 ACTTCTT 10 0.006830828 145.0 8 AGGCTGC 10 0.006830828 145.0 6 TACTTCT 10 0.006830828 145.0 7 >>END_MODULE Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385710 spots for SRR7030792.sra Written 1385710 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra Read 1385696 spots for SRR7030792.sra Written 1385696 spots for SRR7030792.sra SRR ids: ['SRR7030792.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d02c3sln SRR7030792.sra spots: 27713934 blocks: [[1, 1385696], [1385697, 2771392], [2771393, 4157088], [4157089, 5542784], [5542785, 6928480], [6928481, 8314176], [8314177, 9699872], [9699873, 11085568], [11085569, 12471264], [12471265, 13856960], [13856961, 15242656], [15242657, 16628352], [16628353, 18014048], [18014049, 19399744], [19399745, 20785440], [20785441, 22171136], [22171137, 23556832], [23556833, 24942528], [24942529, 26328224], [26328225, 27713934]] SRR7030792 file size 9369642 SRR7030792 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030792 SRR7030792_1.fastq SRR7030792_2.fastq Input file: SRR7030792_1.fastq Paired file: SRR7030792_2.fastq trimmed: SRR7030792-trimmed-pair1.fastq, SRR7030792-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:43:25 2025 >> started Wed Feb 12 17:43:56 2025 >> done (31.252s) 27713934 read pairs processed; of these: 13296 ( 0.05%) short read pairs filtered out after trimming by size control 11013 ( 0.04%) empty read pairs filtered out after trimming by size control 27689625 (99.91%) read pairs available; of these: 10610491 (38.32%) trimmed read pairs available after processing 17079134 (61.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 3 0.00% 20 8 0.00% 21 6 0.00% 22 2 0.00% 23 3 0.00% 24 8 0.00% 25 5 0.00% 26 7 0.00% 27 5 0.00% 28 4 0.00% 29 4 0.00% 30 5 0.00% 31 3 0.00% 32 9 0.00% 33 11 0.00% 34 4 0.00% 35 6 0.00% 36 6 0.00% 37 5 0.00% 38 6 0.00% 39 7 0.00% 40 13 0.00% 41 10 0.00% 42 10 0.00% 43 11 0.00% 44 6 0.00% 45 14 0.00% 46 16 0.00% 47 18 0.00% 48 23 0.00% 49 23 0.00% 50 27 0.00% 51 34 0.00% 52 36 0.00% 53 41 0.00% 54 49 0.00% 55 35 0.00% 56 46 0.00% 57 50 0.00% 58 56 0.00% 59 63 0.00% 60 81 0.00% 61 83 0.00% 62 113 0.00% 63 115 0.00% 64 114 0.00% 65 135 0.00% 66 131 0.00% 67 174 0.00% 68 199 0.00% 69 267 0.00% 70 253 0.00% 71 291 0.00% 72 340 0.00% 73 385 0.00% 74 494 0.00% 75 515 0.00% 76 584 0.00% 77 658 0.00% 78 758 0.00% 79 778 0.00% 80 903 0.00% 81 1051 0.00% 82 1270 0.00% 83 1518 0.01% 84 2299 0.01% 85 2808 0.01% 86 3009 0.01% 87 3147 0.01% 88 3470 0.01% 89 3690 0.01% 90 3950 0.01% 91 4285 0.02% 92 4691 0.02% 93 5245 0.02% 94 5488 0.02% 95 6116 0.02% 96 6465 0.02% 97 6860 0.02% 98 7264 0.03% 99 7616 0.03% 100 8245 0.03% 101 8758 0.03% 102 9711 0.04% 103 10505 0.04% 104 11304 0.04% 105 12290 0.04% 106 12990 0.05% 107 13396 0.05% 108 13894 0.05% 109 14779 0.05% 110 15855 0.06% 111 17071 0.06% 112 18570 0.07% 113 19809 0.07% 114 21022 0.08% 115 22788 0.08% 116 24138 0.09% 117 25585 0.09% 118 26235 0.09% 119 27514 0.10% 120 29084 0.11% 121 30755 0.11% 122 32784 0.12% 123 34554 0.12% 124 36829 0.13% 125 38983 0.14% 126 41219 0.15% 127 43372 0.16% 128 45317 0.16% 129 48660 0.18% 130 50118 0.18% 131 53811 0.19% 132 57438 0.21% 133 61647 0.22% 134 66514 0.24% 135 71773 0.26% 136 77586 0.28% 137 83542 0.30% 138 90938 0.33% 139 99842 0.36% 140 106889 0.39% 141 117585 0.42% 142 130868 0.47% 143 150291 0.54% 144 176291 0.64% 145 213937 0.77% 146 272561 0.98% 147 374061 1.35% 148 577870 2.09% 149 1161999 4.20% 150 5810596 20.98% 151 17079134 61.68% 27689625 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.60 fanout-score-rank=27 prefix-density=0.25 prefix-fanout=3.1 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=147.85 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=17.5 sequence=TTCTCCTTCTCTTCTTCAGTCTTGGGGTGGTACCCAGGTAACTTCTCCTTGATCTTCTCGAGTAGTCCCTTCTTCTCCTTGGCATCTCCTTCATGGGAAACTGCAGCTTCAGGGGAAACATGTTCAGGAGCTGGAGGAGGGACCTCGTCAGCTTTCTTATGTCCTGGCAATTTCTCCTTGATTTTGTCAAGGAAACCCTTCTTATCCTCTGGTTCATGGGGTGTCTCTGTATGGACTACCTCGACAGGAACACTAGTATCCTCGTGTTCCTTCTCCT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=35 prefix-density=0.37 prefix-fanout=2.0 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=299.87 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=26.1 sequence=CAAAGAAGAAAAACAGTTTCTCAAGAGCAGTATATATAGATCTTTCAGAAGAATTAAGGAGATGGCAGACGAGGGAACAGCTACTTGCATAGACATCTTGTTGGCCATCATCTTGCCTCCGCTTGGTGTCTTCCTCAAGTT SRR7030792 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:44:41 Started mapping on | Feb 12 17:44:41 Finished on | Feb 12 17:47:18 Mapping speed, Million of reads per hour | 634.92 Number of input reads | 27689625 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 26552991 Uniquely mapped reads % | 95.90% Average mapped length | 296.99 Number of splices: Total | 25241845 Number of splices: Annotated (sjdb) | 24813351 Number of splices: GT/AG | 24840642 Number of splices: GC/AG | 318341 Number of splices: AT/AC | 16605 Number of splices: Non-canonical | 66257 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 740135 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 37251 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.26% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 411546 411546 411546 N_multimapping 740135 740135 740135 N_noFeature 525549 26293660 656224 N_ambiguous 258570 1559 129087 UnstrandedReadsAssigned:25768872 PositiveStrandReadsAssigned:257772 NegativeStrandReadsAssigned:25767680 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030792 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030792-trimmed-pair1.fastq SRR7030792-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,689,625 reads, 25,640,556 reads pseudoaligned [quant] estimated average fragment length: 260.105 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,043 rounds 52401 SRR7030792.ke.tsv 34699 SRR7030792.se.tsv 87100 total ==> SRR7030792.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.9 3482 66.315 Potri.005G024800.1.v4.1 1035 775.895 2684 115.878 Potri.004G059700.1.v4.1 961 701.895 15 0.715882 Potri.007G009000.2.v4.1 1416 1156.9 0 0 Potri.003G141000.2.v4.1 2943 2683.9 1031 12.8681 Potri.016G087400.1.v4.1 270 67.699 1706.65 844.47 Potri.015G069301.1.v4.1 564 309.231 0 0 Potri.010G195200.1.v4.1 1773 1513.9 380 8.40835 Potri.012G127500.1.v4.1 977 717.895 23188 1081.99 ==> SRR7030792.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 122 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 86 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 190 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR7030792 completed mapping pipeline successfully