Starting /dee2/code/volunteer_pipeline.sh SRR7030793 current disk space = 3051404484608 free memory = 1581822440 SRR7030793 SRAfilesize aee8654abe95b6c752c03c86502d625d SRR7030793.sra SRR7030793.sra file validated SRR7030793 is paired end SRR7030793 is conventional basespace SRR7030793 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030793_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.79075 33.0 33.0 33.0 28.0 34.0 2 32.2695 33.0 33.0 34.0 29.0 34.0 3 32.63725 33.0 33.0 34.0 30.0 34.0 4 32.97225 34.0 33.0 34.0 31.0 34.0 5 32.3565 33.0 32.0 33.0 31.0 34.0 6 36.2045 38.0 36.0 38.0 33.0 38.0 7 36.9725 38.0 37.0 38.0 35.0 38.0 8 37.207 38.0 38.0 38.0 36.0 38.0 9 37.51625 38.0 38.0 38.0 37.0 38.0 10-14 37.53875 38.0 38.0 38.0 37.2 38.0 15-19 37.53574999999999 38.0 38.0 38.0 37.4 38.0 20-24 37.477250000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.470349999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.4103 38.0 38.0 38.0 37.0 38.0 35-39 37.4174 38.0 38.0 38.0 37.0 38.0 40-44 37.390049999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.32865 38.0 38.0 38.0 37.0 38.0 50-54 37.3492 38.0 38.0 38.0 37.0 38.0 55-59 37.29 38.0 38.0 38.0 37.0 38.0 60-64 37.220099999999995 38.0 38.0 38.0 36.4 38.0 65-69 37.136849999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.0773 38.0 38.0 38.0 36.0 38.0 75-79 37.083450000000006 38.0 38.0 38.0 36.0 38.0 80-84 37.041 38.0 38.0 38.0 36.0 38.0 85-89 36.93730000000001 38.0 38.0 38.0 35.6 38.0 90-94 36.8094 38.0 38.0 38.0 34.8 38.0 95-99 36.6503 38.0 38.0 38.0 34.2 38.0 100-104 36.58175 38.0 38.0 38.0 34.2 38.0 105-109 36.504999999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.430249999999994 38.0 38.0 38.0 34.0 38.0 115-119 36.2087 38.0 37.0 38.0 33.4 38.0 120-124 36.0486 38.0 37.0 38.0 33.0 38.0 125-129 35.89655 38.0 36.6 38.0 32.6 38.0 130-134 35.53815 38.0 36.0 38.0 31.0 38.0 135-139 35.4488 38.0 36.0 38.0 31.0 38.0 140-144 35.0946 38.0 35.4 38.0 29.8 38.0 145-149 34.77595 38.0 35.4 38.0 29.0 38.0 150-151 31.0405 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 2.0 16 1.0 17 0.0 18 0.0 19 2.0 20 2.0 21 2.0 22 2.0 23 3.0 24 7.0 25 8.0 26 8.0 27 10.0 28 12.0 29 27.0 30 43.0 31 55.0 32 64.0 33 95.0 34 155.0 35 281.0 36 676.0 37 2542.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.43401216609362 13.25046284051838 10.526315789473683 36.78920920391431 2 22.061030515257627 13.75687843921961 33.56678339169585 30.61530765382691 3 18.9 19.950000000000003 26.8 34.35 4 23.125 26.174999999999997 24.45 26.25 5 24.537268634317158 30.390195097548773 25.087543771885944 19.984992496248125 6 20.325 34.2 24.175 21.3 7 15.675 25.674999999999997 39.95 18.7 8 18.825 25.174999999999997 30.425 25.575 9 16.0 25.75 34.125 24.125 10-14 20.205000000000002 29.110000000000003 27.08 23.605 15-19 20.385 28.189999999999998 27.33 24.095 20-24 20.294999999999998 28.665000000000003 27.1 23.94 25-29 19.955000000000002 28.555000000000003 27.595 23.895 30-34 20.28 28.634999999999998 26.845000000000002 24.240000000000002 35-39 20.52 28.765 26.889999999999997 23.825 40-44 20.75 28.42 26.965 23.865 45-49 20.355 28.689999999999998 26.955000000000002 24.0 50-54 20.86 27.939999999999998 27.375 23.825 55-59 19.915 28.544999999999998 27.250000000000004 24.29 60-64 20.64 27.96 26.935 24.465 65-69 20.62 27.935 26.919999999999998 24.525 70-74 20.53 28.115000000000002 27.279999999999998 24.075 75-79 20.77 27.694999999999997 27.235 24.3 80-84 20.625 28.105000000000004 27.275 23.995 85-89 20.544999999999998 27.825 27.315 24.315 90-94 21.349999999999998 27.05 27.76 23.84 95-99 20.849999999999998 27.794999999999998 27.584999999999997 23.77 100-104 21.165 27.925 26.31 24.6 105-109 20.93 28.055000000000003 27.134999999999998 23.880000000000003 110-114 21.015 28.395 26.945000000000004 23.645 115-119 20.810000000000002 27.515 27.555000000000003 24.12 120-124 21.19 27.900000000000002 27.21 23.7 125-129 21.38 27.495000000000005 27.500000000000004 23.625 130-134 21.145 27.034999999999997 27.63 24.19 135-139 21.62 27.900000000000002 27.065 23.415 140-144 21.725 27.055 27.35 23.87 145-149 21.815 27.689999999999998 26.99 23.505000000000003 150-151 22.37122446421857 27.146258929690436 26.958265446797846 23.524251159293144 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.0 24 1.0 25 2.5 26 5.0 27 6.0 28 7.5 29 15.0 30 17.0 31 24.0 32 37.5 33 41.5 34 40.5 35 49.5 36 69.0 37 92.5 38 130.5 39 138.0 40 144.0 41 181.5 42 226.5 43 238.0 44 249.0 45 260.0 46 259.5 47 265.0 48 242.0 49 236.0 50 211.5 51 171.0 52 141.0 53 114.5 54 95.0 55 69.5 56 53.0 57 44.0 58 36.5 59 26.5 60 14.5 61 11.0 62 8.0 63 5.0 64 5.0 65 3.5 66 3.0 67 2.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.475 2 0.05 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.2 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.95 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.5250000000000004 0.0 0.0 0.0 0.0 134-135 2.7625 0.0 0.0 0.0 0.0 136-137 3.1375 0.0 0.0 0.0 0.0 138-139 3.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCATAA 10 0.006836113 144.9625 4 TCATAAC 10 0.006836113 144.9625 5 CATAACC 10 0.006836113 144.9625 6 >>END_MODULE SRR7030793 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030793_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77625 33.0 33.0 34.0 32.0 34.0 2 32.8505 33.0 33.0 34.0 32.0 34.0 3 32.965 33.0 33.0 34.0 32.0 34.0 4 32.991 34.0 33.0 34.0 32.0 34.0 5 32.83775 33.0 33.0 34.0 32.0 34.0 6 37.14875 38.0 38.0 38.0 37.0 38.0 7 37.23275 38.0 38.0 38.0 37.0 38.0 8 37.20975 38.0 38.0 38.0 37.0 38.0 9 37.30525 38.0 38.0 38.0 37.0 38.0 10-14 37.160799999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.04775 38.0 38.0 38.0 36.4 38.0 20-24 37.09245 38.0 38.0 38.0 36.8 38.0 25-29 37.045100000000005 38.0 38.0 38.0 36.2 38.0 30-34 37.043899999999994 38.0 38.0 38.0 36.0 38.0 35-39 36.919500000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.8611 38.0 38.0 38.0 36.0 38.0 45-49 36.8019 38.0 38.0 38.0 35.6 38.0 50-54 36.8232 38.0 38.0 38.0 35.6 38.0 55-59 36.7632 38.0 38.0 38.0 35.6 38.0 60-64 36.807 38.0 38.0 38.0 35.8 38.0 65-69 36.66265 38.0 38.0 38.0 35.0 38.0 70-74 36.6566 38.0 38.0 38.0 35.0 38.0 75-79 36.596250000000005 38.0 38.0 38.0 34.8 38.0 80-84 36.557100000000005 38.0 38.0 38.0 34.6 38.0 85-89 36.5314 38.0 38.0 38.0 34.4 38.0 90-94 36.41455 38.0 38.0 38.0 34.0 38.0 95-99 36.348349999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.05745 38.0 37.4 38.0 33.0 38.0 105-109 35.83785 38.0 37.0 38.0 32.2 38.0 110-114 35.61695 38.0 36.8 38.0 30.6 38.0 115-119 35.5089 38.0 36.6 38.0 31.0 38.0 120-124 35.330200000000005 38.0 36.4 38.0 29.8 38.0 125-129 35.14865 38.0 36.0 38.0 29.8 38.0 130-134 34.9948 38.0 35.8 38.0 28.2 38.0 135-139 34.637899999999995 38.0 35.0 38.0 27.0 38.0 140-144 34.084 38.0 34.8 38.0 23.8 38.0 145-149 33.68845 38.0 34.4 38.0 22.6 38.0 150-151 29.873375000000003 36.0 27.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 0.0 6 2.0 7 2.0 8 1.0 9 2.0 10 2.0 11 0.0 12 0.0 13 4.0 14 1.0 15 3.0 16 7.0 17 0.0 18 2.0 19 2.0 20 3.0 21 6.0 22 5.0 23 13.0 24 15.0 25 14.0 26 22.0 27 33.0 28 22.0 29 41.0 30 47.0 31 51.0 32 91.0 33 107.0 34 156.0 35 260.0 36 736.0 37 2340.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.400050037528146 21.641230923192396 14.135601701275958 30.823117338003502 2 26.21310655327664 27.63881940970485 28.639319659829916 17.508754377188595 3 20.090067550662997 27.820865649236925 31.248436327245432 20.84063047285464 4 22.566925193895422 33.02476857643232 24.44333249937453 19.96497373029772 5 23.88694347173587 37.293646823411706 21.060530265132567 17.75887943971986 6 19.925 38.925 23.325000000000003 17.825 7 20.325 21.975 37.475 20.225 8 22.025 24.725 27.650000000000002 25.6 9 21.349999999999998 24.575 29.799999999999997 24.275 10-14 22.825 29.26 25.66 22.255 15-19 22.395 28.08 27.235 22.29 20-24 22.3 28.384999999999998 26.76 22.555 25-29 22.835 28.815 26.825 21.525 30-34 23.335 28.410000000000004 26.474999999999998 21.78 35-39 22.3 28.565 27.305 21.83 40-44 23.26 28.15 27.13 21.46 45-49 23.11 28.395 26.645000000000003 21.85 50-54 23.135 28.22 27.075 21.57 55-59 23.025000000000002 28.065 27.065 21.845 60-64 23.115 27.775 27.405 21.705 65-69 22.939999999999998 27.79 26.97 22.3 70-74 23.080000000000002 27.83 26.974999999999998 22.115000000000002 75-79 23.215 27.3 27.584999999999997 21.9 80-84 23.385 28.285 26.805 21.525 85-89 23.76 27.05 27.24 21.95 90-94 23.5 27.155 27.735 21.61 95-99 23.255 27.52 27.345000000000002 21.88 100-104 23.585 26.515 28.084999999999997 21.815 105-109 23.955000000000002 27.889999999999997 26.974999999999998 21.18 110-114 23.455000000000002 26.779999999999998 27.944999999999997 21.82 115-119 23.915 27.38 27.655 21.05 120-124 23.7 28.325 26.529999999999998 21.445 125-129 24.240000000000002 27.365000000000002 27.27 21.125 130-134 24.265 27.1 27.765 20.87 135-139 24.685000000000002 27.13 27.22 20.965 140-144 24.310000000000002 27.66 27.55 20.48 145-149 25.14 26.900000000000002 27.200000000000003 20.76 150-151 25.068767191797946 26.456614153538382 27.86946736684171 20.605151287821954 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 0.5 25 0.5 26 1.0 27 2.5 28 4.0 29 6.5 30 12.5 31 13.5 32 17.5 33 26.5 34 44.0 35 64.0 36 72.5 37 85.5 38 111.0 39 145.5 40 182.0 41 202.5 42 224.5 43 243.0 44 264.0 45 288.5 46 283.5 47 274.0 48 251.5 49 219.5 50 198.0 51 177.5 52 146.0 53 105.5 54 82.5 55 64.0 56 44.0 57 34.5 58 28.0 59 20.5 60 16.0 61 13.5 62 7.5 63 4.5 64 5.5 65 3.5 66 0.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.05 3 0.075 4 0.075 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4462622703247 98.775 2 0.4278882456581928 0.8500000000000001 3 0.12584948401711551 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.2 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.1500000000000004 0.0 0.0 0.0 0.0 132-133 2.4749999999999996 0.0 0.0 0.0 0.0 134-135 2.7375 0.0 0.0 0.0 0.0 136-137 3.0875 0.0 0.0 0.0 0.0 138-139 3.5875000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937207 spots for SRR7030793.sra Written 937207 spots for SRR7030793.sra Read 937226 spots for SRR7030793.sra Written 937226 spots for SRR7030793.sra SRR ids: ['SRR7030793.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7_zfh5lm SRR7030793.sra spots: 18744159 blocks: [[1, 937207], [937208, 1874414], [1874415, 2811621], [2811622, 3748828], [3748829, 4686035], [4686036, 5623242], [5623243, 6560449], [6560450, 7497656], [7497657, 8434863], [8434864, 9372070], [9372071, 10309277], [10309278, 11246484], [11246485, 12183691], [12183692, 13120898], [13120899, 14058105], [14058106, 14995312], [14995313, 15932519], [15932520, 16869726], [16869727, 17806933], [17806934, 18744159]] SRR7030793 file size 6330080 SRR7030793 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030793 SRR7030793_1.fastq SRR7030793_2.fastq Input file: SRR7030793_1.fastq Paired file: SRR7030793_2.fastq trimmed: SRR7030793-trimmed-pair1.fastq, SRR7030793-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:04:37 2025 >> started Wed Feb 12 18:05:08 2025 >> done (31.165s) 18744159 read pairs processed; of these: 16638 ( 0.09%) short read pairs filtered out after trimming by size control 12773 ( 0.07%) empty read pairs filtered out after trimming by size control 18714748 (99.84%) read pairs available; of these: 7314791 (39.09%) trimmed read pairs available after processing 11399957 (60.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 2 0.00% 24 4 0.00% 25 5 0.00% 26 4 0.00% 27 4 0.00% 28 5 0.00% 29 4 0.00% 30 4 0.00% 31 3 0.00% 32 6 0.00% 33 3 0.00% 34 1 0.00% 35 3 0.00% 36 1 0.00% 37 2 0.00% 38 3 0.00% 39 7 0.00% 40 8 0.00% 41 13 0.00% 42 6 0.00% 43 11 0.00% 44 8 0.00% 45 12 0.00% 46 4 0.00% 47 8 0.00% 48 8 0.00% 49 10 0.00% 50 16 0.00% 51 9 0.00% 52 21 0.00% 53 24 0.00% 54 25 0.00% 55 35 0.00% 56 27 0.00% 57 28 0.00% 58 47 0.00% 59 36 0.00% 60 48 0.00% 61 67 0.00% 62 75 0.00% 63 88 0.00% 64 90 0.00% 65 99 0.00% 66 91 0.00% 67 123 0.00% 68 132 0.00% 69 141 0.00% 70 184 0.00% 71 232 0.00% 72 226 0.00% 73 295 0.00% 74 300 0.00% 75 362 0.00% 76 415 0.00% 77 454 0.00% 78 517 0.00% 79 560 0.00% 80 713 0.00% 81 864 0.00% 82 928 0.00% 83 1125 0.01% 84 1949 0.01% 85 2550 0.01% 86 2761 0.01% 87 2933 0.02% 88 3109 0.02% 89 3339 0.02% 90 3376 0.02% 91 3717 0.02% 92 4048 0.02% 93 4335 0.02% 94 4727 0.03% 95 4953 0.03% 96 5231 0.03% 97 5431 0.03% 98 5904 0.03% 99 6455 0.03% 100 6779 0.04% 101 7357 0.04% 102 8070 0.04% 103 8782 0.05% 104 9558 0.05% 105 10106 0.05% 106 11029 0.06% 107 11425 0.06% 108 12204 0.07% 109 12765 0.07% 110 13431 0.07% 111 14560 0.08% 112 15799 0.08% 113 17010 0.09% 114 18277 0.10% 115 19452 0.10% 116 20680 0.11% 117 21496 0.11% 118 22057 0.12% 119 23437 0.13% 120 24282 0.13% 121 25770 0.14% 122 27463 0.15% 123 29408 0.16% 124 30933 0.17% 125 32902 0.18% 126 34871 0.19% 127 36335 0.19% 128 38084 0.20% 129 39468 0.21% 130 41490 0.22% 131 44097 0.24% 132 46731 0.25% 133 50242 0.27% 134 53713 0.29% 135 56867 0.30% 136 61253 0.33% 137 65763 0.35% 138 70991 0.38% 139 76163 0.41% 140 79926 0.43% 141 86990 0.46% 142 95538 0.51% 143 107575 0.57% 144 124680 0.67% 145 148555 0.79% 146 185616 0.99% 147 250028 1.34% 148 377480 2.02% 149 740701 3.96% 150 3873227 20.70% 151 11399957 60.91% 18714748 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.53 fanout-score-rank=21 prefix-density=0.37 prefix-fanout=3.1 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=72.77 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.3 sequence=CTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=30 prefix-density=0.64 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=33.23 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.4 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7030793 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:05:48 Started mapping on | Feb 12 18:05:48 Finished on | Feb 12 18:07:24 Mapping speed, Million of reads per hour | 701.80 Number of input reads | 18714748 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17743567 Uniquely mapped reads % | 94.81% Average mapped length | 296.44 Number of splices: Total | 17037921 Number of splices: Annotated (sjdb) | 16808499 Number of splices: GT/AG | 16745261 Number of splices: GC/AG | 240207 Number of splices: AT/AC | 12492 Number of splices: Non-canonical | 39961 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 606012 % of reads mapped to multiple loci | 3.24% Number of reads mapped to too many loci | 168985 % of reads mapped to too many loci | 0.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.93% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 381698 381698 381698 N_multimapping 606012 606012 606012 N_noFeature 250986 17576289 313849 N_ambiguous 207067 639 102257 UnstrandedReadsAssigned:17285514 PositiveStrandReadsAssigned:166639 NegativeStrandReadsAssigned:17327461 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030793 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030793-trimmed-pair1.fastq SRR7030793-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,714,748 reads, 17,525,033 reads pseudoaligned [quant] estimated average fragment length: 242.894 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 952 rounds 52401 SRR7030793.ke.tsv 34699 SRR7030793.se.tsv 87100 total ==> SRR7030793.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.11 1375 31.616 Potri.005G024800.1.v4.1 1035 793.106 516 26.57 Potri.004G059700.1.v4.1 961 719.124 16 0.908636 Potri.007G009000.2.v4.1 1416 1174.11 0 0 Potri.003G141000.2.v4.1 2943 2701.11 388 5.86629 Potri.016G087400.1.v4.1 270 73.158 1341.43 748.823 Potri.015G069301.1.v4.1 564 325.03 0 0 Potri.010G195200.1.v4.1 1773 1531.11 12 0.320073 Potri.012G127500.1.v4.1 977 735.112 7273 404.048 ==> SRR7030793.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 307 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7030793 completed mapping pipeline successfully