Starting /dee2/code/volunteer_pipeline.sh SRR7030794 current disk space = 3051230920704 free memory = 1580238792 SRR7030794 SRAfilesize 873b4c4c78dadb932c0ee4b1b7beeddd SRR7030794.sra SRR7030794.sra file validated SRR7030794 is paired end SRR7030794 is conventional basespace SRR7030794 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030794_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.2265 32.0 18.0 33.0 18.0 34.0 2 31.0805 33.0 29.0 33.0 27.0 34.0 3 31.892 33.0 31.0 33.0 28.0 34.0 4 31.59975 33.0 31.0 33.0 29.0 34.0 5 32.405 33.0 33.0 33.0 32.0 34.0 6 36.58625 38.0 37.0 38.0 34.0 38.0 7 36.7735 38.0 37.0 38.0 34.0 38.0 8 37.1505 38.0 38.0 38.0 36.0 38.0 9 37.4195 38.0 38.0 38.0 37.0 38.0 10-14 37.38735 38.0 38.0 38.0 36.8 38.0 15-19 37.44475 38.0 38.0 38.0 37.0 38.0 20-24 37.40875 38.0 38.0 38.0 37.0 38.0 25-29 37.399249999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.29299999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.28465 38.0 38.0 38.0 37.0 38.0 40-44 37.255500000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.249300000000005 38.0 38.0 38.0 36.8 38.0 50-54 37.22175 38.0 38.0 38.0 36.6 38.0 55-59 37.16355 38.0 38.0 38.0 36.0 38.0 60-64 37.1192 38.0 38.0 38.0 36.0 38.0 65-69 36.9902 38.0 38.0 38.0 36.0 38.0 70-74 36.9283 38.0 38.0 38.0 36.0 38.0 75-79 36.86919999999999 38.0 38.0 38.0 35.6 38.0 80-84 36.79214999999999 38.0 38.0 38.0 35.0 38.0 85-89 36.75225 38.0 38.0 38.0 35.0 38.0 90-94 36.66735 38.0 38.0 38.0 34.2 38.0 95-99 36.4799 38.0 38.0 38.0 34.2 38.0 100-104 36.403499999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.330600000000004 38.0 37.8 38.0 34.0 38.0 110-114 36.20125 38.0 37.4 38.0 33.8 38.0 115-119 36.03635 38.0 37.0 38.0 33.0 38.0 120-124 35.76165 38.0 36.8 38.0 31.0 38.0 125-129 35.58215 38.0 36.2 38.0 31.0 38.0 130-134 35.186899999999994 38.0 35.8 38.0 29.8 38.0 135-139 34.86005 38.0 35.0 38.0 28.0 38.0 140-144 34.84259999999999 38.0 35.6 38.0 28.4 38.0 145-149 34.173500000000004 38.0 35.0 38.0 24.8 38.0 150-151 30.65475 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 0.0 17 0.0 18 1.0 19 2.0 20 5.0 21 1.0 22 8.0 23 6.0 24 6.0 25 21.0 26 16.0 27 21.0 28 29.0 29 36.0 30 36.0 31 52.0 32 75.0 33 112.0 34 167.0 35 279.0 36 745.0 37 2376.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.01133297355639 13.464651915812196 7.906098219104156 35.61791689152725 2 21.3 13.575000000000001 34.0 31.125000000000004 3 18.375 18.475 26.474999999999998 36.675000000000004 4 21.2 26.625 24.075 28.1 5 23.04991221469777 31.778279408076248 24.354150990719837 20.817657386506145 6 19.15 34.300000000000004 25.224999999999998 21.325 7 15.525 26.525 39.574999999999996 18.375 8 17.75 26.450000000000003 30.049999999999997 25.75 9 17.7 23.325000000000003 34.275 24.7 10-14 19.955000000000002 29.465000000000003 27.029999999999998 23.549999999999997 15-19 20.375 28.225 27.295 24.104999999999997 20-24 20.34 27.915 28.189999999999998 23.555 25-29 19.97 28.405 27.575 24.05 30-34 20.52 28.73 26.784999999999997 23.965 35-39 20.355 28.444999999999997 27.0 24.2 40-44 20.495 27.865000000000002 27.725 23.915 45-49 19.835 27.384999999999998 27.584999999999997 25.195 50-54 20.765 27.950000000000003 27.125 24.16 55-59 20.135 27.63 27.235 25.0 60-64 20.380000000000003 28.23 27.279999999999998 24.11 65-69 20.405 27.43 27.725 24.44 70-74 20.555 28.64 27.315 23.49 75-79 20.8 27.700000000000003 27.16 24.34 80-84 20.375 28.144999999999996 27.245 24.235 85-89 20.47 27.694999999999997 27.534999999999997 24.3 90-94 20.285 27.744999999999997 28.044999999999998 23.925 95-99 20.674999999999997 28.07 27.165 24.09 100-104 20.544999999999998 28.015 26.875 24.565 105-109 20.544999999999998 27.644999999999996 28.389999999999997 23.419999999999998 110-114 21.11 28.405 27.175 23.31 115-119 21.035 27.889999999999997 27.279999999999998 23.794999999999998 120-124 20.225 28.050000000000004 27.515 24.21 125-129 20.915 27.134999999999998 27.62 24.33 130-134 20.84 27.625 27.315 24.22 135-139 21.455 27.33 27.455000000000002 23.76 140-144 21.060000000000002 27.305 27.235 24.4 145-149 21.41 27.939999999999998 26.83 23.82 150-151 21.718946047678795 27.063989962358846 27.61606022584693 23.601003764115433 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 2.0 26 2.5 27 5.0 28 6.5 29 8.5 30 15.5 31 23.0 32 31.0 33 37.0 34 52.5 35 55.5 36 65.5 37 104.5 38 123.5 39 126.5 40 150.5 41 190.0 42 220.5 43 243.0 44 262.5 45 271.5 46 278.0 47 280.0 48 251.5 49 231.0 50 199.0 51 159.5 52 138.0 53 111.5 54 89.0 55 65.0 56 42.5 57 29.5 58 25.0 59 27.0 60 22.5 61 11.5 62 9.5 63 7.0 64 5.0 65 4.0 66 2.0 67 2.5 68 2.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.35 2 0.0 3 0.0 4 0.0 5 0.325 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0750000000000002 0.0 0.0 0.0 0.0 124-125 1.1875 0.0 0.0 0.0 0.0 126-127 1.3375 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.625 0.0 0.0 0.0 0.0 132-133 1.8625 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030794 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030794_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68475 33.0 33.0 34.0 32.0 34.0 2 32.762 33.0 33.0 34.0 32.0 34.0 3 32.74625 33.0 33.0 34.0 32.0 34.0 4 32.79075 33.0 33.0 34.0 32.0 34.0 5 32.79925 33.0 33.0 34.0 32.0 34.0 6 36.97725 38.0 38.0 38.0 36.0 38.0 7 37.01575 38.0 38.0 38.0 37.0 38.0 8 37.018 38.0 38.0 38.0 37.0 38.0 9 37.068 38.0 38.0 38.0 37.0 38.0 10-14 36.86275 38.0 38.0 38.0 35.8 38.0 15-19 36.9662 38.0 38.0 38.0 36.2 38.0 20-24 36.9089 38.0 38.0 38.0 36.2 38.0 25-29 36.85835 38.0 38.0 38.0 36.0 38.0 30-34 36.85269999999999 38.0 38.0 38.0 36.0 38.0 35-39 36.721000000000004 38.0 38.0 38.0 35.6 38.0 40-44 36.729200000000006 38.0 38.0 38.0 35.8 38.0 45-49 36.5767 38.0 38.0 38.0 35.2 38.0 50-54 36.65984999999999 38.0 38.0 38.0 35.2 38.0 55-59 36.58669999999999 38.0 38.0 38.0 35.0 38.0 60-64 36.488 38.0 38.0 38.0 34.4 38.0 65-69 36.54505 38.0 38.0 38.0 34.6 38.0 70-74 36.42515 38.0 38.0 38.0 34.0 38.0 75-79 36.33385 38.0 38.0 38.0 34.0 38.0 80-84 36.32959999999999 38.0 38.0 38.0 34.0 38.0 85-89 36.23565 38.0 38.0 38.0 33.8 38.0 90-94 36.0649 38.0 37.8 38.0 33.2 38.0 95-99 35.80215 38.0 37.0 38.0 32.0 38.0 100-104 35.7988 38.0 37.0 38.0 32.0 38.0 105-109 35.635450000000006 38.0 37.0 38.0 31.4 38.0 110-114 35.39235000000001 38.0 36.6 38.0 30.0 38.0 115-119 35.17999999999999 38.0 36.0 38.0 28.6 38.0 120-124 34.93315 38.0 36.0 38.0 27.6 38.0 125-129 34.8187 38.0 35.6 38.0 27.4 38.0 130-134 34.550850000000004 38.0 35.0 38.0 26.2 38.0 135-139 34.306200000000004 38.0 35.0 38.0 24.6 38.0 140-144 34.036199999999994 38.0 35.0 38.0 22.8 38.0 145-149 33.20195 38.0 33.6 38.0 18.0 38.0 150-151 29.343 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 4.0 4 5.0 5 2.0 6 2.0 7 1.0 8 1.0 9 1.0 10 3.0 11 2.0 12 1.0 13 3.0 14 6.0 15 1.0 16 1.0 17 4.0 18 1.0 19 2.0 20 3.0 21 5.0 22 7.0 23 11.0 24 18.0 25 24.0 26 22.0 27 31.0 28 36.0 29 45.0 30 66.0 31 58.0 32 80.0 33 110.0 34 178.0 35 303.0 36 644.0 37 2305.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.15 24.05 11.85 25.95 2 26.433041301627036 26.708385481852314 30.312891113892366 16.545682102628284 3 20.05006257822278 27.609511889862326 32.21526908635794 20.125156445556946 4 24.60575719649562 32.390488110137674 23.479349186483102 19.524405506883603 5 23.311655827913956 37.618809404702354 22.386193096548272 16.683341670835418 6 21.03551775887944 39.09454727363682 21.660830415207606 18.209104552276138 7 19.979994998749685 23.755938984746187 37.4593648412103 18.804701175293822 8 20.775 26.474999999999998 27.275 25.474999999999998 9 22.675 26.025 27.425 23.875 10-14 22.945 29.315 25.729999999999997 22.009999999999998 15-19 23.080000000000002 28.305000000000003 26.669999999999998 21.945 20-24 22.955000000000002 28.59 27.305 21.15 25-29 23.119999999999997 28.27 27.3 21.310000000000002 30-34 22.720000000000002 28.615000000000002 26.865 21.8 35-39 22.97 27.810000000000002 27.005000000000003 22.215 40-44 22.84 28.494999999999997 27.185 21.48 45-49 23.22 28.025 27.29 21.465 50-54 23.68 28.005000000000003 27.375 20.94 55-59 23.575 27.485 27.68 21.26 60-64 23.74 28.305000000000003 27.1 20.855 65-69 23.244999999999997 27.839999999999996 27.29 21.625 70-74 23.630000000000003 28.044999999999998 27.04 21.285 75-79 23.45 28.325 26.6 21.625 80-84 22.935 28.115000000000002 27.534999999999997 21.415 85-89 23.9 27.395000000000003 27.38 21.325 90-94 23.78 27.694999999999997 27.52 21.005 95-99 24.215 27.83 26.945000000000004 21.01 100-104 23.815 27.32 27.73 21.135 105-109 23.765 27.255000000000003 27.68 21.3 110-114 23.34 27.345000000000002 28.065 21.25 115-119 23.615 27.51 27.529999999999998 21.345 120-124 24.240000000000002 27.224999999999998 27.655 20.880000000000003 125-129 24.425 27.77 26.979999999999997 20.825 130-134 24.68 27.72 26.695 20.905 135-139 24.41 27.73 27.500000000000004 20.36 140-144 24.58 27.860000000000003 26.795 20.765 145-149 25.035 27.66 27.224999999999998 20.080000000000002 150-151 25.012506253126567 26.788394197098548 27.37618809404702 20.822911455727862 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 3.0 23 3.0 24 4.0 25 2.5 26 0.0 27 2.0 28 3.5 29 6.5 30 12.0 31 18.0 32 25.0 33 31.0 34 38.5 35 57.0 36 74.0 37 83.5 38 116.0 39 161.5 40 192.5 41 218.5 42 234.5 43 253.0 44 278.0 45 286.5 46 265.5 47 251.5 48 244.5 49 218.0 50 183.0 51 153.0 52 131.0 53 103.0 54 81.0 55 57.5 56 45.5 57 38.5 58 26.5 59 25.0 60 19.5 61 10.0 62 10.0 63 9.0 64 4.5 65 2.5 66 2.0 67 2.5 68 1.0 69 0.5 70 1.0 71 1.5 72 1.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.125 4 0.125 5 0.05 6 0.05 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4526024641689716 0.8999999999999999 3 0.025144581342720643 0.075 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 0.9625 0.0 0.0 0.0 0.0 122-123 1.125 0.0 0.0 0.0 0.0 124-125 1.2375 0.0 0.0 0.0 0.0 126-127 1.3875000000000002 0.0 0.0 0.0 0.0 128-129 1.5125000000000002 0.0 0.0 0.0 0.0 130-131 1.675 0.0 0.0 0.0 0.0 132-133 1.8875 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035260 spots for SRR7030794.sra Written 1035260 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra Read 1035245 spots for SRR7030794.sra Written 1035245 spots for SRR7030794.sra SRR ids: ['SRR7030794.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_329djb3p SRR7030794.sra spots: 20704915 blocks: [[1, 1035245], [1035246, 2070490], [2070491, 3105735], [3105736, 4140980], [4140981, 5176225], [5176226, 6211470], [6211471, 7246715], [7246716, 8281960], [8281961, 9317205], [9317206, 10352450], [10352451, 11387695], [11387696, 12422940], [12422941, 13458185], [13458186, 14493430], [14493431, 15528675], [15528676, 16563920], [16563921, 17599165], [17599166, 18634410], [18634411, 19669655], [19669656, 20704915]] SRR7030794 file size 6994515 SRR7030794 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030794 SRR7030794_1.fastq SRR7030794_2.fastq Input file: SRR7030794_1.fastq Paired file: SRR7030794_2.fastq trimmed: SRR7030794-trimmed-pair1.fastq, SRR7030794-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:38:44 2025 >> started Wed Feb 12 18:39:08 2025 >> done (24.178s) 20704915 read pairs processed; of these: 28844 ( 0.14%) short read pairs filtered out after trimming by size control 28011 ( 0.14%) empty read pairs filtered out after trimming by size control 20648060 (99.73%) read pairs available; of these: 7911611 (38.32%) trimmed read pairs available after processing 12736449 (61.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 5 0.00% 22 5 0.00% 23 7 0.00% 24 5 0.00% 25 4 0.00% 26 5 0.00% 27 3 0.00% 28 13 0.00% 29 4 0.00% 30 8 0.00% 31 5 0.00% 32 8 0.00% 33 4 0.00% 34 6 0.00% 35 9 0.00% 36 7 0.00% 37 8 0.00% 38 2 0.00% 39 8 0.00% 40 9 0.00% 41 9 0.00% 42 13 0.00% 43 7 0.00% 44 8 0.00% 45 8 0.00% 46 15 0.00% 47 18 0.00% 48 10 0.00% 49 15 0.00% 50 16 0.00% 51 20 0.00% 52 24 0.00% 53 28 0.00% 54 26 0.00% 55 33 0.00% 56 26 0.00% 57 41 0.00% 58 33 0.00% 59 49 0.00% 60 53 0.00% 61 56 0.00% 62 63 0.00% 63 93 0.00% 64 96 0.00% 65 98 0.00% 66 99 0.00% 67 132 0.00% 68 116 0.00% 69 146 0.00% 70 172 0.00% 71 174 0.00% 72 262 0.00% 73 261 0.00% 74 296 0.00% 75 351 0.00% 76 411 0.00% 77 423 0.00% 78 529 0.00% 79 552 0.00% 80 657 0.00% 81 729 0.00% 82 879 0.00% 83 1055 0.01% 84 2322 0.01% 85 3229 0.02% 86 3435 0.02% 87 3645 0.02% 88 3865 0.02% 89 3744 0.02% 90 3797 0.02% 91 4146 0.02% 92 4236 0.02% 93 4452 0.02% 94 4765 0.02% 95 4979 0.02% 96 5377 0.03% 97 5811 0.03% 98 6148 0.03% 99 6407 0.03% 100 6817 0.03% 101 7269 0.04% 102 7638 0.04% 103 7988 0.04% 104 8796 0.04% 105 9509 0.05% 106 10151 0.05% 107 10894 0.05% 108 11377 0.06% 109 12259 0.06% 110 13035 0.06% 111 14043 0.07% 112 14858 0.07% 113 15682 0.08% 114 16822 0.08% 115 17984 0.09% 116 19343 0.09% 117 20575 0.10% 118 21756 0.11% 119 22764 0.11% 120 23924 0.12% 121 25492 0.12% 122 26480 0.13% 123 28016 0.14% 124 29798 0.14% 125 31314 0.15% 126 33613 0.16% 127 35269 0.17% 128 37217 0.18% 129 39185 0.19% 130 41376 0.20% 131 43916 0.21% 132 46819 0.23% 133 49771 0.24% 134 53903 0.26% 135 57358 0.28% 136 61929 0.30% 137 66279 0.32% 138 72001 0.35% 139 77912 0.38% 140 83229 0.40% 141 91471 0.44% 142 99356 0.48% 143 112771 0.55% 144 132121 0.64% 145 158262 0.77% 146 200733 0.97% 147 271960 1.32% 148 412400 2.00% 149 816831 3.96% 150 4302757 20.84% 151 12736449 61.68% 20648060 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=35 prefix-density=0.21 prefix-fanout=2.2 sequence=ACTGATTCCTTTGCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=365.59 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=32.9 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=37 prefix-density=0.36 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=69.22 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.2 sequence=AACTCTCTTGCAACCTGAAACAGGGAAACCAGTTAGTCGGGAACCAAAATCAAGGCTATGGCATCACTAGCAACCTTTGCTGCAGTGCAACCGGCCACCATCAAAGGCCTTGGTGGTAGCTCCCTCAGTGGAACCAAGCTCCATGTTAAACCATCACGCCAGGGCTTAAGACCCAAAAGCTTGAGGAGTGGTGCTGTGGTGGCCAAGTATGGTGACAAGAGTGTCTACTTTGATTTGGAGGATTTGGGCAACACTACTGGGCAATGGGACTTGTATGGATCTGATGCACCTTCACCATACAACCCTCTCCAGAGCAAATTCTTTGAGACATTTG SRR7030794 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:39:52 Started mapping on | Feb 12 18:39:52 Finished on | Feb 12 18:41:49 Mapping speed, Million of reads per hour | 635.32 Number of input reads | 20648060 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19497535 Uniquely mapped reads % | 94.43% Average mapped length | 296.77 Number of splices: Total | 19656702 Number of splices: Annotated (sjdb) | 19354824 Number of splices: GT/AG | 19329456 Number of splices: GC/AG | 265195 Number of splices: AT/AC | 14370 Number of splices: Non-canonical | 47681 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 570416 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 312536 % of reads mapped to too many loci | 1.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.06% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 607410 607410 607410 N_multimapping 570416 570416 570416 N_noFeature 394959 19283039 485337 N_ambiguous 230984 1123 106275 UnstrandedReadsAssigned:18871592 PositiveStrandReadsAssigned:213373 NegativeStrandReadsAssigned:18905923 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030794 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030794-trimmed-pair1.fastq SRR7030794-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,648,060 reads, 19,082,092 reads pseudoaligned [quant] estimated average fragment length: 247.794 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR7030794.ke.tsv 34699 SRR7030794.se.tsv 87100 total ==> SRR7030794.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.21 1527 31.5639 Potri.005G024800.1.v4.1 1035 788.206 735 34.1404 Potri.004G059700.1.v4.1 961 714.212 23 1.17902 Potri.007G009000.2.v4.1 1416 1169.21 1 0.0313134 Potri.003G141000.2.v4.1 2943 2696.21 554 7.52277 Potri.016G087400.1.v4.1 270 69.6025 1343.6 706.748 Potri.015G069301.1.v4.1 564 320.223 0 0 Potri.010G195200.1.v4.1 1773 1526.21 21 0.503764 Potri.012G127500.1.v4.1 977 730.212 13416 672.66 ==> SRR7030794.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 430 Potri.001G212900.v4.1 65 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 4 SRR7030794 completed mapping pipeline successfully