Starting /dee2/code/volunteer_pipeline.sh SRR7030795 current disk space = 3051403186176 free memory = 1579322272 SRR7030795 SRAfilesize 28406695025b4fd7dd512c66fbbf0279 SRR7030795.sra SRR7030795.sra file validated SRR7030795 is paired end SRR7030795 is conventional basespace SRR7030795 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030795_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.684 33.0 33.0 34.0 27.0 34.0 2 32.58075 34.0 33.0 34.0 28.0 34.0 3 32.806 34.0 33.0 34.0 30.0 34.0 4 33.11375 34.0 33.0 34.0 31.0 34.0 5 33.13725 34.0 33.0 34.0 32.0 34.0 6 36.10175 38.0 36.0 38.0 33.0 38.0 7 37.072 38.0 38.0 38.0 35.0 38.0 8 37.34825 38.0 38.0 38.0 37.0 38.0 9 37.48325 38.0 38.0 38.0 37.0 38.0 10-14 37.481399999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.50025000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.46205 38.0 38.0 38.0 37.0 38.0 25-29 37.4317 38.0 38.0 38.0 37.0 38.0 30-34 37.35915000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.3702 38.0 38.0 38.0 37.0 38.0 40-44 37.31785 38.0 38.0 38.0 37.0 38.0 45-49 37.30425 38.0 38.0 38.0 37.0 38.0 50-54 37.27235 38.0 38.0 38.0 36.8 38.0 55-59 37.21939999999999 38.0 38.0 38.0 36.4 38.0 60-64 37.164199999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.09855 38.0 38.0 38.0 36.0 38.0 70-74 37.08515 38.0 38.0 38.0 36.0 38.0 75-79 37.03975 38.0 38.0 38.0 36.0 38.0 80-84 36.982899999999994 38.0 38.0 38.0 35.8 38.0 85-89 36.86445 38.0 38.0 38.0 35.4 38.0 90-94 36.6364 38.0 38.0 38.0 34.4 38.0 95-99 36.54565 38.0 38.0 38.0 34.0 38.0 100-104 36.548449999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.499849999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.42895 38.0 38.0 38.0 34.0 38.0 115-119 36.1355 38.0 37.0 38.0 33.2 38.0 120-124 36.066250000000004 38.0 37.0 38.0 33.0 38.0 125-129 35.830600000000004 38.0 36.8 38.0 32.2 38.0 130-134 35.55425 38.0 36.0 38.0 30.6 38.0 135-139 35.305099999999996 38.0 36.0 38.0 30.6 38.0 140-144 34.838800000000006 38.0 35.2 38.0 27.8 38.0 145-149 34.56825 38.0 35.0 38.0 27.2 38.0 150-151 30.719375 36.5 29.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 3.0 22 3.0 23 5.0 24 6.0 25 9.0 26 12.0 27 6.0 28 23.0 29 38.0 30 35.0 31 49.0 32 76.0 33 104.0 34 174.0 35 277.0 36 662.0 37 2509.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.006472491909385 11.650485436893204 6.310679611650485 35.032362459546924 2 21.360680340170084 13.156578289144571 35.392696348174084 30.09004502251126 3 18.675 18.025 28.549999999999997 34.75 4 23.525 26.025 23.525 26.924999999999997 5 22.655663915978995 32.50812703175794 25.156289072268066 19.679919979995 6 18.825 34.75 24.725 21.7 7 14.774999999999999 25.825 41.349999999999994 18.05 8 16.1 25.85 33.4 24.65 9 16.05 24.75 34.325 24.875 10-14 19.55 30.044999999999998 27.57 22.835 15-19 20.044999999999998 28.439999999999998 27.68 23.835 20-24 19.72 28.854999999999997 27.694999999999997 23.73 25-29 19.81 29.145 27.500000000000004 23.544999999999998 30-34 20.465 28.134999999999998 27.894999999999996 23.505000000000003 35-39 20.11 28.475 27.655 23.76 40-44 20.265 28.544999999999998 27.455000000000002 23.735 45-49 19.314999999999998 28.83 27.85 24.005000000000003 50-54 19.615 28.975 27.515 23.895 55-59 20.135 28.84 27.735 23.29 60-64 19.900000000000002 28.410000000000004 27.675 24.015 65-69 20.645 28.27 27.700000000000003 23.385 70-74 20.095 27.915 28.365000000000002 23.625 75-79 20.095 28.37 27.839999999999996 23.695 80-84 20.044999999999998 27.534999999999997 28.34 24.08 85-89 19.865 28.37 27.650000000000002 24.115000000000002 90-94 19.99 28.65 27.365000000000002 23.995 95-99 19.93 28.544999999999998 27.85 23.674999999999997 100-104 20.635 28.73 27.51 23.125 105-109 20.52 27.700000000000003 27.944999999999997 23.835 110-114 20.169999999999998 28.060000000000002 28.244999999999997 23.525 115-119 20.544999999999998 27.96 27.98 23.515 120-124 20.41 28.4 27.544999999999998 23.645 125-129 20.43 27.944999999999997 27.794999999999998 23.830000000000002 130-134 20.46 27.955000000000002 27.83 23.755000000000003 135-139 20.59 27.675 27.77 23.965 140-144 20.669999999999998 28.249999999999996 28.02 23.06 145-149 20.745 27.750000000000004 27.560000000000002 23.945 150-151 20.674523570712136 28.48545636910732 27.4197592778335 23.42026078234704 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 1.5 24 3.5 25 3.0 26 5.5 27 12.0 28 14.0 29 15.0 30 23.0 31 32.0 32 33.0 33 36.5 34 50.0 35 53.0 36 71.0 37 110.5 38 124.0 39 143.0 40 196.5 41 230.5 42 240.0 43 259.0 44 284.5 45 294.0 46 266.0 47 254.5 48 250.0 49 218.5 50 178.0 51 129.0 52 101.5 53 85.5 54 68.0 55 57.0 56 42.5 57 29.5 58 23.5 59 16.0 60 9.5 61 9.0 62 8.0 63 5.0 64 3.0 65 2.0 66 2.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.3 2 0.05 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.9125 0.0 0.0 0.0 0.0 124-125 1.0125 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.2375 0.0 0.0 0.0 0.0 130-131 1.45 0.0 0.0 0.0 0.0 132-133 1.6625 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138-139 2.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030795 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030795_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7425 33.0 33.0 34.0 32.0 34.0 2 32.798 33.0 33.0 34.0 32.0 34.0 3 32.8875 33.0 33.0 34.0 32.0 34.0 4 32.8825 34.0 33.0 34.0 32.0 34.0 5 32.7625 33.0 33.0 34.0 32.0 34.0 6 37.12775 38.0 38.0 38.0 37.0 38.0 7 37.173 38.0 38.0 38.0 37.0 38.0 8 37.132 38.0 38.0 38.0 37.0 38.0 9 37.22625 38.0 38.0 38.0 37.0 38.0 10-14 37.1605 38.0 38.0 38.0 36.8 38.0 15-19 36.9787 38.0 38.0 38.0 36.2 38.0 20-24 37.017 38.0 38.0 38.0 36.0 38.0 25-29 36.99365 38.0 38.0 38.0 36.0 38.0 30-34 36.94485 38.0 38.0 38.0 36.0 38.0 35-39 36.86605 38.0 38.0 38.0 35.8 38.0 40-44 36.8107 38.0 38.0 38.0 35.8 38.0 45-49 36.7787 38.0 38.0 38.0 35.8 38.0 50-54 36.783950000000004 38.0 38.0 38.0 35.6 38.0 55-59 36.73715 38.0 38.0 38.0 35.4 38.0 60-64 36.6834 38.0 38.0 38.0 35.2 38.0 65-69 36.5153 38.0 38.0 38.0 34.6 38.0 70-74 36.5655 38.0 38.0 38.0 34.4 38.0 75-79 36.4105 38.0 38.0 38.0 34.2 38.0 80-84 36.45765 38.0 38.0 38.0 34.0 38.0 85-89 36.35845 38.0 38.0 38.0 34.0 38.0 90-94 36.27935 38.0 38.0 38.0 33.8 38.0 95-99 36.16345 38.0 37.8 38.0 33.6 38.0 100-104 35.80005 38.0 37.0 38.0 32.2 38.0 105-109 35.59955 38.0 37.0 38.0 31.0 38.0 110-114 35.4605 38.0 36.8 38.0 30.6 38.0 115-119 35.2033 38.0 36.0 38.0 28.6 38.0 120-124 35.140350000000005 38.0 36.0 38.0 29.0 38.0 125-129 34.9081 38.0 35.8 38.0 27.4 38.0 130-134 34.8063 38.0 35.4 38.0 27.8 38.0 135-139 34.38245 38.0 35.0 38.0 25.0 38.0 140-144 33.89935 38.0 34.6 38.0 22.6 38.0 145-149 33.33655 38.0 34.0 38.0 18.2 38.0 150-151 29.522624999999998 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 1.0 5 2.0 6 1.0 7 3.0 8 3.0 9 3.0 10 0.0 11 2.0 12 1.0 13 2.0 14 0.0 15 3.0 16 2.0 17 3.0 18 2.0 19 5.0 20 5.0 21 5.0 22 12.0 23 9.0 24 10.0 25 19.0 26 17.0 27 15.0 28 34.0 29 33.0 30 58.0 31 68.0 32 88.0 33 128.0 34 172.0 35 326.0 36 635.0 37 2318.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.27659574468085 24.20525657071339 9.637046307884855 24.881101376720903 2 26.476476476476474 27.77777777777778 30.88088088088088 14.864864864864865 3 20.500625782227786 28.760951188986233 31.23904881101377 19.499374217772214 4 23.429286608260323 34.643304130162704 22.778473091364205 19.148936170212767 5 24.69352014010508 38.4038028521391 20.490367775831874 16.412309231923945 6 19.825 39.475 23.1 17.599999999999998 7 20.775 22.85 37.475 18.9 8 20.925 25.974999999999998 28.199999999999996 24.9 9 21.2 25.825 29.325000000000003 23.65 10-14 23.0 29.349999999999998 26.810000000000002 20.84 15-19 22.795 28.349999999999998 28.15 20.705000000000002 20-24 23.355 28.634999999999998 27.705000000000002 20.305 25-29 22.49 28.599999999999998 28.549999999999997 20.36 30-34 22.85 28.63 27.644999999999996 20.875 35-39 22.86 28.455000000000002 27.855 20.830000000000002 40-44 22.82 28.52 27.61 21.05 45-49 22.52 27.900000000000002 28.075 21.505 50-54 22.555 28.64 27.96 20.845 55-59 22.825 28.044999999999998 28.57 20.560000000000002 60-64 23.02 28.17 28.01 20.8 65-69 23.49 28.265 27.99 20.255000000000003 70-74 23.415 28.205000000000002 27.495000000000005 20.885 75-79 23.11 28.134999999999998 27.894999999999996 20.86 80-84 23.075000000000003 28.515 27.54 20.87 85-89 23.105 28.915000000000003 27.400000000000002 20.580000000000002 90-94 23.18 28.415000000000003 27.589999999999996 20.815 95-99 23.544999999999998 28.000000000000004 27.97 20.485 100-104 24.044999999999998 27.255000000000003 27.91 20.79 105-109 23.605 28.34 27.685 20.369999999999997 110-114 23.68 27.91 28.08 20.330000000000002 115-119 23.685000000000002 27.525 28.265 20.525 120-124 23.625 28.144999999999996 27.71 20.52 125-129 23.46 27.529999999999998 28.365000000000002 20.645 130-134 24.09 28.16 27.589999999999996 20.16 135-139 24.060000000000002 28.09 28.1 19.75 140-144 24.025 28.084999999999997 27.935 19.955000000000002 145-149 24.005000000000003 27.67 27.66 20.665 150-151 24.878109763720467 27.340917614701837 27.040880110013752 20.740092511563944 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 3.0 25 3.0 26 4.5 27 6.5 28 7.5 29 12.0 30 16.5 31 21.0 32 29.0 33 35.0 34 49.5 35 75.0 36 93.5 37 106.0 38 138.0 39 178.0 40 212.0 41 235.5 42 256.0 43 283.0 44 287.5 45 278.5 46 260.0 47 238.0 48 216.5 49 210.5 50 196.5 51 145.5 52 108.5 53 83.0 54 53.5 55 37.5 56 26.0 57 19.5 58 19.5 59 15.5 60 10.5 61 5.5 62 3.5 63 4.5 64 4.5 65 2.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.1 3 0.125 4 0.125 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5284348263714143 1.05 3 0.025163563160543533 0.075 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.925 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.1375 0.0 0.0 0.0 0.0 128-129 1.275 0.0 0.0 0.0 0.0 130-131 1.4625 0.0 0.0 0.0 0.0 132-133 1.6625 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138-139 2.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAACA 10 0.006830828 145.0 4 TTTTTTT 55 1.1668232E-4 18.454546 80-84 >>END_MODULE Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra Read 1150269 spots for SRR7030795.sra Written 1150269 spots for SRR7030795.sra SRR ids: ['SRR7030795.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8gp4f79s SRR7030795.sra spots: 23005380 blocks: [[1, 1150269], [1150270, 2300538], [2300539, 3450807], [3450808, 4601076], [4601077, 5751345], [5751346, 6901614], [6901615, 8051883], [8051884, 9202152], [9202153, 10352421], [10352422, 11502690], [11502691, 12652959], [12652960, 13803228], [13803229, 14953497], [14953498, 16103766], [16103767, 17254035], [17254036, 18404304], [18404305, 19554573], [19554574, 20704842], [20704843, 21855111], [21855112, 23005380]] SRR7030795 file size 7774068 SRR7030795 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030795 SRR7030795_1.fastq SRR7030795_2.fastq Input file: SRR7030795_1.fastq Paired file: SRR7030795_2.fastq trimmed: SRR7030795-trimmed-pair1.fastq, SRR7030795-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:24:09 2025 >> started Wed Feb 12 18:24:35 2025 >> done (25.895s) 23005380 read pairs processed; of these: 20543 ( 0.09%) short read pairs filtered out after trimming by size control 16964 ( 0.07%) empty read pairs filtered out after trimming by size control 22967873 (99.84%) read pairs available; of these: 8624876 (37.55%) trimmed read pairs available after processing 14342997 (62.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 12 0.00% 21 5 0.00% 22 2 0.00% 23 3 0.00% 24 4 0.00% 25 8 0.00% 26 5 0.00% 27 4 0.00% 28 7 0.00% 29 8 0.00% 30 5 0.00% 31 8 0.00% 32 7 0.00% 33 10 0.00% 34 5 0.00% 35 3 0.00% 36 5 0.00% 37 7 0.00% 38 9 0.00% 39 7 0.00% 40 6 0.00% 41 11 0.00% 42 8 0.00% 43 10 0.00% 44 8 0.00% 45 9 0.00% 46 21 0.00% 47 13 0.00% 48 19 0.00% 49 22 0.00% 50 17 0.00% 51 17 0.00% 52 30 0.00% 53 26 0.00% 54 29 0.00% 55 32 0.00% 56 46 0.00% 57 35 0.00% 58 47 0.00% 59 55 0.00% 60 57 0.00% 61 63 0.00% 62 65 0.00% 63 65 0.00% 64 75 0.00% 65 92 0.00% 66 105 0.00% 67 106 0.00% 68 110 0.00% 69 147 0.00% 70 166 0.00% 71 203 0.00% 72 229 0.00% 73 240 0.00% 74 302 0.00% 75 338 0.00% 76 384 0.00% 77 402 0.00% 78 499 0.00% 79 485 0.00% 80 599 0.00% 81 686 0.00% 82 809 0.00% 83 1016 0.00% 84 2067 0.01% 85 2648 0.01% 86 2766 0.01% 87 2942 0.01% 88 3156 0.01% 89 3364 0.01% 90 3516 0.02% 91 3711 0.02% 92 3887 0.02% 93 4179 0.02% 94 4413 0.02% 95 4661 0.02% 96 5067 0.02% 97 5227 0.02% 98 5729 0.02% 99 6011 0.03% 100 6351 0.03% 101 6855 0.03% 102 7423 0.03% 103 8011 0.03% 104 8409 0.04% 105 9083 0.04% 106 9709 0.04% 107 10172 0.04% 108 11259 0.05% 109 11597 0.05% 110 12560 0.05% 111 13353 0.06% 112 14299 0.06% 113 15135 0.07% 114 16312 0.07% 115 17536 0.08% 116 18979 0.08% 117 19722 0.09% 118 21110 0.09% 119 21537 0.09% 120 22621 0.10% 121 24068 0.10% 122 25611 0.11% 123 27166 0.12% 124 28516 0.12% 125 29880 0.13% 126 31914 0.14% 127 33745 0.15% 128 35680 0.16% 129 38262 0.17% 130 40569 0.18% 131 43046 0.19% 132 45448 0.20% 133 48822 0.21% 134 52239 0.23% 135 56816 0.25% 136 61135 0.27% 137 66315 0.29% 138 72706 0.32% 139 79861 0.35% 140 85626 0.37% 141 94559 0.41% 142 104660 0.46% 143 119651 0.52% 144 140657 0.61% 145 170268 0.74% 146 218713 0.95% 147 301175 1.31% 148 461560 2.01% 149 917826 4.00% 150 4815167 20.96% 151 14342997 62.45% 22967873 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=42 prefix-density=0.13 prefix-fanout=2.4 sequence=GTGGACTCCTTCTGGATGTTGTA criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=139.92 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=19.7 sequence=CATCTTCTTCATCT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=31 prefix-density=0.32 prefix-fanout=1.8 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=382.06 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=31.3 sequence=AAGAAGAAGAAA SRR7030795 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:25:19 Started mapping on | Feb 12 18:25:23 Finished on | Feb 12 18:27:23 Mapping speed, Million of reads per hour | 689.04 Number of input reads | 22967873 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21878587 Uniquely mapped reads % | 95.26% Average mapped length | 297.11 Number of splices: Total | 19817826 Number of splices: Annotated (sjdb) | 19444835 Number of splices: GT/AG | 19487745 Number of splices: GC/AG | 265536 Number of splices: AT/AC | 12814 Number of splices: Non-canonical | 51731 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 669169 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 59287 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 441061 441061 441061 N_multimapping 669169 669169 669169 N_noFeature 618507 21622130 754924 N_ambiguous 231600 1491 110792 UnstrandedReadsAssigned:21028480 PositiveStrandReadsAssigned:254966 NegativeStrandReadsAssigned:21012871 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030795 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030795-trimmed-pair1.fastq SRR7030795-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,967,873 reads, 20,948,097 reads pseudoaligned [quant] estimated average fragment length: 259.855 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR7030795.ke.tsv 34699 SRR7030795.se.tsv 87100 total ==> SRR7030795.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.14 3331 67.9735 Potri.005G024800.1.v4.1 1035 776.145 1729 79.9685 Potri.004G059700.1.v4.1 961 702.167 67 3.42532 Potri.007G009000.2.v4.1 1416 1157.14 0 0 Potri.003G141000.2.v4.1 2943 2684.14 686 9.17455 Potri.016G087400.1.v4.1 270 65.9114 920.735 501.466 Potri.015G069301.1.v4.1 564 308.482 0 0 Potri.010G195200.1.v4.1 1773 1514.14 91 2.15745 Potri.012G127500.1.v4.1 977 718.161 2724 136.161 ==> SRR7030795.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 130 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 207 Potri.001G212900.v4.1 110 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 171 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7030795 completed mapping pipeline successfully