Starting /dee2/code/volunteer_pipeline.sh SRR7030796 current disk space = 3051335811072 free memory = 1574108452 SRR7030796 SRAfilesize 1d622c7ab74f7ebf05851d43373a9d3d SRR7030796.sra SRR7030796.sra file validated SRR7030796 is paired end SRR7030796 is conventional basespace SRR7030796 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030796_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.866 32.0 28.0 33.0 18.0 34.0 2 30.613 33.0 29.0 33.0 27.0 34.0 3 31.756 33.0 31.0 33.0 27.0 34.0 4 32.16175 33.0 31.0 33.0 30.0 34.0 5 32.731 33.0 33.0 34.0 32.0 34.0 6 36.2595 38.0 36.0 38.0 33.0 38.0 7 36.79675 38.0 37.0 38.0 34.0 38.0 8 37.20175 38.0 38.0 38.0 36.0 38.0 9 37.41475 38.0 38.0 38.0 37.0 38.0 10-14 37.41635 38.0 38.0 38.0 37.0 38.0 15-19 37.4157 38.0 38.0 38.0 37.0 38.0 20-24 37.43145 38.0 38.0 38.0 37.0 38.0 25-29 37.36425 38.0 38.0 38.0 37.0 38.0 30-34 37.27875 38.0 38.0 38.0 37.0 38.0 35-39 37.27329999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.153949999999995 38.0 38.0 38.0 36.2 38.0 45-49 37.196549999999995 38.0 38.0 38.0 36.0 38.0 50-54 37.1385 38.0 38.0 38.0 36.0 38.0 55-59 37.1235 38.0 38.0 38.0 36.0 38.0 60-64 37.023450000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.97735 38.0 38.0 38.0 35.8 38.0 70-74 36.9127 38.0 38.0 38.0 35.0 38.0 75-79 36.8402 38.0 38.0 38.0 35.0 38.0 80-84 36.7757 38.0 38.0 38.0 34.8 38.0 85-89 36.7303 38.0 38.0 38.0 34.8 38.0 90-94 36.54875 38.0 38.0 38.0 34.0 38.0 95-99 36.2404 38.0 37.2 38.0 33.0 38.0 100-104 36.25435 38.0 37.0 38.0 34.0 38.0 105-109 36.0226 38.0 37.0 38.0 32.6 38.0 110-114 35.97545 38.0 37.0 38.0 32.6 38.0 115-119 35.8331 38.0 36.8 38.0 31.8 38.0 120-124 35.658849999999994 38.0 36.0 38.0 31.0 38.0 125-129 35.313 38.0 36.0 38.0 29.2 38.0 130-134 35.0161 38.0 35.0 38.0 28.0 38.0 135-139 34.5607 38.0 35.0 38.0 26.0 38.0 140-144 34.363800000000005 38.0 35.0 38.0 25.8 38.0 145-149 33.5659 38.0 34.6 38.0 21.0 38.0 150-151 30.076 36.5 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 2.0 20 4.0 21 3.0 22 4.0 23 7.0 24 7.0 25 11.0 26 18.0 27 22.0 28 28.0 29 43.0 30 55.0 31 67.0 32 77.0 33 137.0 34 200.0 35 332.0 36 801.0 37 2179.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.12455806363884 11.204786510742453 8.322001631765026 34.348653793853686 2 23.925 13.55 33.875 28.65 3 18.525 21.224999999999998 27.125 33.125 4 21.925 28.725 24.275 25.074999999999996 5 21.825 32.5 25.775 19.900000000000002 6 17.525 36.475 25.75 20.25 7 15.075 25.874999999999996 41.925000000000004 17.125 8 17.974999999999998 25.5 31.275 25.25 9 17.45 24.2 34.525 23.825 10-14 19.735 29.849999999999998 27.134999999999998 23.28 15-19 18.955 28.425 28.09 24.529999999999998 20-24 19.66 28.904999999999998 27.785 23.65 25-29 19.64 28.775000000000002 28.07 23.515 30-34 19.755 28.035 28.155 24.055 35-39 19.775000000000002 28.505000000000003 27.845 23.875 40-44 20.06 28.765 27.96 23.215 45-49 19.785 28.07 28.575 23.57 50-54 19.62 28.310000000000002 28.355000000000004 23.715 55-59 19.925 28.59 27.51 23.974999999999998 60-64 20.145 28.485 28.28 23.09 65-69 19.88 28.13 27.85 24.14 70-74 20.244999999999997 28.615000000000002 27.55 23.59 75-79 19.525000000000002 29.099999999999998 27.605 23.77 80-84 20.055 27.975 28.634999999999998 23.335 85-89 20.195 28.51 28.199999999999996 23.095 90-94 20.255000000000003 28.175 27.825 23.745 95-99 20.52 28.535 27.644999999999996 23.3 100-104 20.395 28.65 27.505000000000003 23.45 105-109 20.275000000000002 28.32 27.705000000000002 23.7 110-114 19.84 28.155 28.415000000000003 23.59 115-119 20.085 28.155 28.02 23.74 120-124 20.235 28.185 28.084999999999997 23.494999999999997 125-129 20.715 27.155 28.04 24.09 130-134 20.44 28.215 27.975 23.369999999999997 135-139 20.79 27.794999999999998 27.62 23.794999999999998 140-144 20.674999999999997 28.810000000000002 27.395000000000003 23.119999999999997 145-149 20.674999999999997 28.505000000000003 27.665 23.155 150-151 20.460518082843198 28.24427480916031 27.993993242397696 23.3012138655988 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.0 22 2.5 23 2.5 24 3.0 25 3.5 26 6.0 27 10.0 28 13.0 29 18.0 30 18.5 31 24.5 32 39.0 33 39.5 34 47.5 35 72.5 36 89.5 37 107.5 38 139.0 39 181.0 40 197.0 41 205.5 42 246.0 43 272.0 44 275.5 45 277.5 46 268.0 47 248.0 48 223.5 49 199.5 50 172.0 51 135.0 52 105.5 53 88.5 54 72.5 55 54.5 56 39.5 57 30.0 58 17.5 59 11.5 60 12.5 61 9.5 62 7.0 63 5.0 64 2.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.075000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.5375 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.7125 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 1.0 0.0 0.0 0.0 0.0 128-129 1.1625 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.3125 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.625 0.0 0.0 0.0 0.0 138-139 1.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030796 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030796_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8015 33.0 33.0 34.0 32.0 34.0 2 32.86475 33.0 33.0 34.0 32.0 34.0 3 32.938 33.0 33.0 34.0 32.0 34.0 4 32.8555 33.0 33.0 34.0 32.0 34.0 5 32.85825 33.0 33.0 34.0 32.0 34.0 6 37.12 38.0 38.0 38.0 37.0 38.0 7 37.22325 38.0 38.0 38.0 37.0 38.0 8 37.191 38.0 38.0 38.0 37.0 38.0 9 37.1715 38.0 38.0 38.0 37.0 38.0 10-14 37.1572 38.0 38.0 38.0 36.8 38.0 15-19 37.028200000000005 38.0 38.0 38.0 36.0 38.0 20-24 37.071749999999994 38.0 38.0 38.0 36.2 38.0 25-29 37.049 38.0 38.0 38.0 36.0 38.0 30-34 37.01795 38.0 38.0 38.0 36.0 38.0 35-39 36.99205 38.0 38.0 38.0 36.0 38.0 40-44 36.8367 38.0 38.0 38.0 35.6 38.0 45-49 36.68535 38.0 38.0 38.0 34.8 38.0 50-54 36.8072 38.0 38.0 38.0 35.2 38.0 55-59 36.76819999999999 38.0 38.0 38.0 35.0 38.0 60-64 36.7453 38.0 38.0 38.0 35.0 38.0 65-69 36.58325000000001 38.0 38.0 38.0 34.6 38.0 70-74 36.5105 38.0 38.0 38.0 34.0 38.0 75-79 36.398 38.0 38.0 38.0 34.0 38.0 80-84 36.38675 38.0 38.0 38.0 34.0 38.0 85-89 36.30129999999999 38.0 38.0 38.0 34.0 38.0 90-94 36.120799999999996 38.0 37.0 38.0 33.2 38.0 95-99 35.96079999999999 38.0 37.0 38.0 32.8 38.0 100-104 35.622299999999996 38.0 37.0 38.0 30.6 38.0 105-109 35.4833 38.0 36.8 38.0 29.6 38.0 110-114 35.280100000000004 38.0 36.2 38.0 29.2 38.0 115-119 35.04504999999999 38.0 36.0 38.0 28.0 38.0 120-124 34.86305 38.0 35.6 38.0 27.4 38.0 125-129 34.4885 38.0 35.0 38.0 25.0 38.0 130-134 34.37045 38.0 35.0 38.0 25.0 38.0 135-139 33.9634 38.0 34.6 38.0 23.0 38.0 140-144 32.6491 37.4 31.8 38.0 17.2 38.0 145-149 31.747450000000004 36.6 31.8 38.0 11.2 38.0 150-151 27.88825 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 2.0 6 1.0 7 1.0 8 1.0 9 1.0 10 0.0 11 2.0 12 2.0 13 3.0 14 2.0 15 0.0 16 5.0 17 5.0 18 4.0 19 2.0 20 7.0 21 10.0 22 12.0 23 11.0 24 10.0 25 16.0 26 30.0 27 32.0 28 46.0 29 40.0 30 59.0 31 58.0 32 85.0 33 152.0 34 234.0 35 362.0 36 784.0 37 2013.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.3 22.725 12.174999999999999 23.799999999999997 2 28.95 25.874999999999996 28.825 16.35 3 20.3 29.299999999999997 31.724999999999998 18.675 4 23.35 35.6 23.400000000000002 17.65 5 24.275 36.975 21.725 17.025000000000002 6 19.35 39.175 23.65 17.825 7 20.5 22.35 38.85 18.3 8 20.875 25.674999999999997 28.349999999999998 25.1 9 20.025000000000002 26.200000000000003 30.9 22.875 10-14 22.445 29.79 26.740000000000002 21.025 15-19 22.57 28.625 27.775 21.029999999999998 20-24 21.815 28.655 28.060000000000002 21.47 25-29 22.505 28.65 28.044999999999998 20.8 30-34 22.37 28.09 28.34 21.2 35-39 22.375 27.834999999999997 28.860000000000003 20.93 40-44 22.845 28.475 28.105000000000004 20.575 45-49 22.46 27.74 28.854999999999997 20.945 50-54 22.770000000000003 27.71 28.505000000000003 21.015 55-59 23.07 28.465 28.310000000000002 20.155 60-64 22.96 28.199999999999996 28.49 20.349999999999998 65-69 22.53 27.755000000000003 28.560000000000002 21.154999999999998 70-74 23.135 27.779999999999998 28.53 20.555 75-79 23.335 27.26 28.395 21.01 80-84 23.1 28.34 28.139999999999997 20.419999999999998 85-89 22.91 28.000000000000004 28.465 20.625 90-94 22.715 28.325 28.03 20.93 95-99 22.89 27.560000000000002 28.494999999999997 21.055 100-104 23.189999999999998 27.955000000000002 27.975 20.880000000000003 105-109 23.025000000000002 28.060000000000002 28.155 20.76 110-114 22.955000000000002 28.185 28.095 20.765 115-119 23.075000000000003 28.32 27.35 21.255 120-124 22.98 28.075 28.310000000000002 20.635 125-129 23.455000000000002 27.985 27.775 20.785 130-134 23.275000000000002 28.28 28.23 20.215 135-139 23.385 28.77 27.67 20.175 140-144 23.525 28.410000000000004 27.985 20.080000000000002 145-149 23.82 28.075 28.115000000000002 19.99 150-151 24.575 26.637499999999996 28.1875 20.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.5 24 3.0 25 3.0 26 4.5 27 6.5 28 8.0 29 12.0 30 21.5 31 28.5 32 30.5 33 34.0 34 54.0 35 73.0 36 86.0 37 108.0 38 146.5 39 191.5 40 227.0 41 249.0 42 271.5 43 284.0 44 279.5 45 274.5 46 264.0 47 242.5 48 210.5 49 185.5 50 159.0 51 121.0 52 101.0 53 85.5 54 60.0 55 45.5 56 35.0 57 30.0 58 23.5 59 13.0 60 7.0 61 4.5 62 3.0 63 3.0 64 2.5 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.5030181086519114 1.0 3 0.0 0.0 4 0.0 0.0 5 0.025150905432595575 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGTTAAGTAAGGAGACACGATGGCTAAGTTTGCTGTGGCTAATCTCGTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.42500000000000004 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 1.0 0.0 0.0 0.0 0.0 128-129 1.1625 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.3375 0.0 0.0 0.0 0.0 134-135 1.4625 0.0 0.0 0.0 0.0 136-137 1.65 0.0 0.0 0.0 0.0 138-139 1.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCTAT 10 0.006830828 145.0 3 ATGCCAT 10 0.006830828 145.0 3 CAGTGAT 10 0.006830828 145.0 9 >>END_MODULE Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319425 spots for SRR7030796.sra Written 1319425 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra Read 1319407 spots for SRR7030796.sra Written 1319407 spots for SRR7030796.sra SRR ids: ['SRR7030796.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q4f9kt4u SRR7030796.sra spots: 26388158 blocks: [[1, 1319407], [1319408, 2638814], [2638815, 3958221], [3958222, 5277628], [5277629, 6597035], [6597036, 7916442], [7916443, 9235849], [9235850, 10555256], [10555257, 11874663], [11874664, 13194070], [13194071, 14513477], [14513478, 15832884], [15832885, 17152291], [17152292, 18471698], [18471699, 19791105], [19791106, 21110512], [21110513, 22429919], [22429920, 23749326], [23749327, 25068733], [25068734, 26388158]] SRR7030796 file size 8920380 SRR7030796 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030796 SRR7030796_1.fastq SRR7030796_2.fastq Input file: SRR7030796_1.fastq Paired file: SRR7030796_2.fastq trimmed: SRR7030796-trimmed-pair1.fastq, SRR7030796-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:29:04 2025 >> started Wed Feb 12 18:29:34 2025 >> done (30.620s) 26388158 read pairs processed; of these: 26949 ( 0.10%) short read pairs filtered out after trimming by size control 25977 ( 0.10%) empty read pairs filtered out after trimming by size control 26335232 (99.80%) read pairs available; of these: 10500836 (39.87%) trimmed read pairs available after processing 15834396 (60.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 11 0.00% 22 5 0.00% 23 8 0.00% 24 4 0.00% 25 6 0.00% 26 7 0.00% 27 8 0.00% 28 7 0.00% 29 10 0.00% 30 10 0.00% 31 4 0.00% 32 9 0.00% 33 5 0.00% 34 7 0.00% 35 7 0.00% 36 5 0.00% 37 9 0.00% 38 9 0.00% 39 6 0.00% 40 12 0.00% 41 5 0.00% 42 10 0.00% 43 10 0.00% 44 5 0.00% 45 11 0.00% 46 15 0.00% 47 17 0.00% 48 29 0.00% 49 17 0.00% 50 28 0.00% 51 23 0.00% 52 35 0.00% 53 24 0.00% 54 34 0.00% 55 33 0.00% 56 42 0.00% 57 44 0.00% 58 65 0.00% 59 57 0.00% 60 63 0.00% 61 72 0.00% 62 84 0.00% 63 86 0.00% 64 92 0.00% 65 91 0.00% 66 119 0.00% 67 122 0.00% 68 151 0.00% 69 174 0.00% 70 189 0.00% 71 248 0.00% 72 233 0.00% 73 285 0.00% 74 326 0.00% 75 359 0.00% 76 466 0.00% 77 464 0.00% 78 497 0.00% 79 643 0.00% 80 692 0.00% 81 820 0.00% 82 941 0.00% 83 1208 0.00% 84 2500 0.01% 85 3237 0.01% 86 3393 0.01% 87 3610 0.01% 88 3722 0.01% 89 3874 0.01% 90 4014 0.02% 91 4178 0.02% 92 4405 0.02% 93 4670 0.02% 94 4884 0.02% 95 5100 0.02% 96 5471 0.02% 97 5826 0.02% 98 6205 0.02% 99 6741 0.03% 100 6615 0.03% 101 7047 0.03% 102 7770 0.03% 103 8201 0.03% 104 8797 0.03% 105 9501 0.04% 106 10093 0.04% 107 10680 0.04% 108 11475 0.04% 109 12363 0.05% 110 12902 0.05% 111 13836 0.05% 112 14928 0.06% 113 16363 0.06% 114 17064 0.06% 115 18903 0.07% 116 19765 0.08% 117 20968 0.08% 118 22005 0.08% 119 23326 0.09% 120 24204 0.09% 121 26043 0.10% 122 27305 0.10% 123 29379 0.11% 124 31503 0.12% 125 33495 0.13% 126 35420 0.13% 127 37780 0.14% 128 39792 0.15% 129 42284 0.16% 130 45277 0.17% 131 47894 0.18% 132 51991 0.20% 133 56328 0.21% 134 60936 0.23% 135 66163 0.25% 136 71370 0.27% 137 77867 0.30% 138 86359 0.33% 139 95731 0.36% 140 105124 0.40% 141 115033 0.44% 142 130628 0.50% 143 151472 0.58% 144 180617 0.69% 145 222293 0.84% 146 289076 1.10% 147 393225 1.49% 148 594289 2.26% 149 1191677 4.53% 150 5786763 21.97% 151 15834396 60.13% 26335232 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=6.01 fanout-score-rank=20 prefix-density=0.22 prefix-fanout=5.2 sequence=AACATCTGAATTGCATATGATACGGCTGGAAGTGACCGCAAAGTCATTCGAAGCGGCTCCGATGATATAACGATCACCAGTTCTAACCTCATCACCGAAGACATCGATCACTGCTTCAGCATGAACGGCACGAGGAAATATTGAAGTTGCCGTGAAGGCAAAGAGAAGAAAGGAGAGCACTAGAAAGTTAGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=56.77 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=14.6 sequence=AACTTCTTCAAT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=36 prefix-density=0.30 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=32.47 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.1 sequence=TCTGGCTATAGCTAAGCACACAAATTAAGGCTTAAAGATATAGAGAGAAAGAAACAACATGTCGTCGACGACAAAACCAAAGGCAGTGAAGCACACTCTATTCGTGAAGTTCAAAGATGACGTTACCAGAGAGCAAATTGAGAAAATCATAAACGACTTCACTCATCTGGTCAATCAAGTTGAACCCTTGAAGAGCTTACACTGGGGCACTAATCTGGGTATTCACGACCTCAATTTCGGATATACTCATGCTTTTGAAACTACCTTTGATGATCTGGAGGGCTTGCAGGAGTATCTTGATTCTTCGGTTGTTGCTAAATTCGCAGAAGGATTCTTGCCAACCATGTCGCA SRR7030796 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:30:16 Started mapping on | Feb 12 18:30:17 Finished on | Feb 12 18:32:31 Mapping speed, Million of reads per hour | 707.51 Number of input reads | 26335232 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 25032399 Uniquely mapped reads % | 95.05% Average mapped length | 297.06 Number of splices: Total | 23402085 Number of splices: Annotated (sjdb) | 22928048 Number of splices: GT/AG | 23028177 Number of splices: GC/AG | 283760 Number of splices: AT/AC | 15807 Number of splices: Non-canonical | 74341 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 714670 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 40779 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.05% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 616483 616483 616483 N_multimapping 714670 714670 714670 N_noFeature 727410 24776065 851754 N_ambiguous 273044 1809 140083 UnstrandedReadsAssigned:24031945 PositiveStrandReadsAssigned:254525 NegativeStrandReadsAssigned:24040562 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030796 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030796-trimmed-pair1.fastq SRR7030796-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,335,232 reads, 23,925,053 reads pseudoaligned [quant] estimated average fragment length: 274.626 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR7030796.ke.tsv 34699 SRR7030796.se.tsv 87100 total ==> SRR7030796.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.37 2535 56.6297 Potri.005G024800.1.v4.1 1035 761.374 1908 97.6531 Potri.004G059700.1.v4.1 961 687.429 45 2.55088 Potri.007G009000.2.v4.1 1416 1142.37 0 0 Potri.003G141000.2.v4.1 2943 2669.37 1267.48 18.5028 Potri.016G087400.1.v4.1 270 64.3733 1967.42 1190.96 Potri.015G069301.1.v4.1 564 297.407 0 0 Potri.010G195200.1.v4.1 1773 1499.37 1009.79 26.2439 Potri.012G127500.1.v4.1 977 703.399 8949 495.768 ==> SRR7030796.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 249 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 229 Potri.001G212900.v4.1 153 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 111 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 26 SRR7030796 completed mapping pipeline successfully