Starting /dee2/code/volunteer_pipeline.sh SRR7030797 current disk space = 3051618947072 free memory = 1496804332 SRR7030797 SRAfilesize 472fc27ec713ad491ec2ba81bf3ed060 SRR7030797.sra SRR7030797.sra file validated SRR7030797 is paired end SRR7030797 is conventional basespace SRR7030797 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030797_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.497 32.0 25.0 33.0 18.0 34.0 2 31.31275 33.0 30.0 33.0 27.0 34.0 3 30.50775 31.0 29.0 33.0 27.0 33.0 4 31.1665 33.0 31.0 33.0 29.0 33.0 5 32.32775 33.0 33.0 33.0 32.0 34.0 6 36.29575 38.0 36.0 38.0 33.0 38.0 7 36.84575 38.0 37.0 38.0 35.0 38.0 8 37.28875 38.0 38.0 38.0 36.0 38.0 9 37.3905 38.0 38.0 38.0 37.0 38.0 10-14 37.362049999999996 38.0 38.0 38.0 36.8 38.0 15-19 37.459050000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.427749999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.36585 38.0 38.0 38.0 37.0 38.0 30-34 37.31605 38.0 38.0 38.0 37.0 38.0 35-39 37.28025 38.0 38.0 38.0 37.0 38.0 40-44 37.27425000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.285700000000006 38.0 38.0 38.0 36.6 38.0 50-54 37.21315 38.0 38.0 38.0 36.2 38.0 55-59 37.15575 38.0 38.0 38.0 36.0 38.0 60-64 37.049499999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.98895 38.0 38.0 38.0 35.8 38.0 70-74 36.9539 38.0 38.0 38.0 36.0 38.0 75-79 36.88835 38.0 38.0 38.0 35.4 38.0 80-84 36.85475 38.0 38.0 38.0 35.4 38.0 85-89 36.773700000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.70360000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.4927 38.0 37.8 38.0 34.0 38.0 100-104 36.3729 38.0 37.8 38.0 34.0 38.0 105-109 36.386649999999996 38.0 37.6 38.0 34.0 38.0 110-114 36.2912 38.0 37.4 38.0 33.8 38.0 115-119 36.04644999999999 38.0 37.0 38.0 33.0 38.0 120-124 35.74400000000001 38.0 36.6 38.0 31.4 38.0 125-129 35.645050000000005 38.0 36.2 38.0 31.4 38.0 130-134 35.247 38.0 36.0 38.0 29.4 38.0 135-139 34.97285 38.0 35.0 38.0 28.0 38.0 140-144 34.901050000000005 38.0 35.4 38.0 28.4 38.0 145-149 34.193149999999996 38.0 35.0 38.0 25.6 38.0 150-151 30.83875 36.5 30.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 1.0 14 0.0 15 2.0 16 1.0 17 2.0 18 1.0 19 2.0 20 2.0 21 1.0 22 4.0 23 3.0 24 8.0 25 9.0 26 11.0 27 25.0 28 26.0 29 37.0 30 46.0 31 54.0 32 72.0 33 125.0 34 166.0 35 298.0 36 774.0 37 2328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.03942461374534 12.093766648907831 9.296750133191264 40.57005860415557 2 21.325 13.5 34.8 30.375000000000004 3 19.175 18.6 26.200000000000003 36.025 4 21.05 25.2 24.525 29.225 5 23.826261611850363 30.278684408737135 24.956063268892795 20.938990710519708 6 20.349999999999998 33.675 24.575 21.4 7 14.299999999999999 27.525 40.150000000000006 18.025 8 17.025000000000002 26.625 31.624999999999996 24.725 9 17.9 24.0 33.775 24.325 10-14 19.634999999999998 29.18 26.875 24.310000000000002 15-19 19.400000000000002 27.935 28.189999999999998 24.474999999999998 20-24 19.875 28.165000000000003 28.075 23.885 25-29 19.634999999999998 28.465 27.310000000000002 24.59 30-34 19.88 28.275 27.189999999999998 24.654999999999998 35-39 20.29 28.325 27.089999999999996 24.295 40-44 19.775000000000002 28.860000000000003 27.47 23.895 45-49 20.155 27.51 27.925 24.41 50-54 20.41 27.815 27.665 24.11 55-59 20.415 27.884999999999998 26.939999999999998 24.759999999999998 60-64 20.244999999999997 28.07 27.88 23.805 65-69 20.115 27.63 27.465 24.79 70-74 20.345 27.595 27.97 24.09 75-79 20.335 27.395000000000003 28.125 24.145 80-84 20.27 27.88 27.855 23.995 85-89 20.695 28.065 27.250000000000004 23.990000000000002 90-94 20.43 27.765 27.384999999999998 24.42 95-99 20.3 27.97 27.96 23.77 100-104 20.810000000000002 27.595 27.33 24.265 105-109 20.150000000000002 28.025 27.41 24.415 110-114 20.82 28.025 27.675 23.48 115-119 21.115000000000002 27.589999999999996 27.310000000000002 23.985 120-124 21.060000000000002 27.12 27.555000000000003 24.265 125-129 20.89 27.49 27.47 24.15 130-134 21.095 28.025 27.279999999999998 23.599999999999998 135-139 21.154999999999998 27.125 27.525 24.195 140-144 20.9 27.3 27.175 24.625 145-149 21.235 27.58 27.145000000000003 24.04 150-151 20.484194681384846 27.77220270948319 28.098344204716508 23.645258404415454 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 2.0 24 1.0 25 1.0 26 3.0 27 7.5 28 10.5 29 13.0 30 18.0 31 18.0 32 21.0 33 33.5 34 47.5 35 58.0 36 71.5 37 89.0 38 111.5 39 147.5 40 172.5 41 189.0 42 236.5 43 261.5 44 259.5 45 278.5 46 291.5 47 271.5 48 234.5 49 220.0 50 196.0 51 151.0 52 126.0 53 107.5 54 80.5 55 63.5 56 43.5 57 34.0 58 34.0 59 26.5 60 20.0 61 12.5 62 6.5 63 4.5 64 5.5 65 2.5 66 3.0 67 4.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.15 2 0.0 3 0.0 4 0.0 5 0.42500000000000004 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7250000000000001 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.3875000000000002 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.7374999999999998 0.0 0.0 0.0 0.0 130-131 1.925 0.0 0.0 0.0 0.0 132-133 2.1500000000000004 0.0 0.0 0.0 0.0 134-135 2.3 0.0 0.0 0.0 0.0 136-137 2.6 0.0 0.0 0.0 0.0 138-139 3.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAAAC 10 0.0066027166 146.6329 2 >>END_MODULE SRR7030797 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030797_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6185 33.0 33.0 34.0 32.0 34.0 2 32.81675 33.0 33.0 34.0 32.0 34.0 3 32.88075 33.0 33.0 34.0 32.0 34.0 4 32.8465 34.0 33.0 34.0 32.0 34.0 5 32.9005 34.0 33.0 34.0 32.0 34.0 6 37.04575 38.0 38.0 38.0 36.0 38.0 7 37.11475 38.0 38.0 38.0 37.0 38.0 8 37.10325 38.0 38.0 38.0 37.0 38.0 9 37.10925 38.0 38.0 38.0 37.0 38.0 10-14 37.0055 38.0 38.0 38.0 36.4 38.0 15-19 37.013549999999995 38.0 38.0 38.0 36.0 38.0 20-24 37.0439 38.0 38.0 38.0 36.2 38.0 25-29 36.9291 38.0 38.0 38.0 36.0 38.0 30-34 36.95375 38.0 38.0 38.0 36.0 38.0 35-39 36.827299999999994 38.0 38.0 38.0 35.8 38.0 40-44 36.868700000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.74805 38.0 38.0 38.0 35.2 38.0 50-54 36.76965 38.0 38.0 38.0 35.0 38.0 55-59 36.7292 38.0 38.0 38.0 35.2 38.0 60-64 36.66115 38.0 38.0 38.0 35.0 38.0 65-69 36.6589 38.0 38.0 38.0 34.8 38.0 70-74 36.5664 38.0 38.0 38.0 34.0 38.0 75-79 36.5145 38.0 38.0 38.0 34.0 38.0 80-84 36.45815 38.0 38.0 38.0 34.0 38.0 85-89 36.38005 38.0 38.0 38.0 33.8 38.0 90-94 36.28465 38.0 38.0 38.0 33.8 38.0 95-99 36.0173 38.0 37.0 38.0 32.8 38.0 100-104 35.9226 38.0 37.0 38.0 32.2 38.0 105-109 35.75279999999999 38.0 37.0 38.0 31.4 38.0 110-114 35.5007 38.0 36.6 38.0 30.0 38.0 115-119 35.3811 38.0 36.0 38.0 29.6 38.0 120-124 35.1279 38.0 35.8 38.0 28.4 38.0 125-129 34.933899999999994 38.0 35.6 38.0 27.8 38.0 130-134 34.681799999999996 38.0 35.0 38.0 27.0 38.0 135-139 34.48485000000001 38.0 35.0 38.0 26.4 38.0 140-144 34.086800000000004 38.0 34.8 38.0 24.0 38.0 145-149 33.2919 38.0 33.8 38.0 20.0 38.0 150-151 29.580125 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 1.0 4 0.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 3.0 14 0.0 15 0.0 16 3.0 17 4.0 18 3.0 19 5.0 20 10.0 21 12.0 22 5.0 23 13.0 24 17.0 25 23.0 26 28.0 27 39.0 28 38.0 29 33.0 30 55.0 31 59.0 32 91.0 33 99.0 34 172.0 35 296.0 36 660.0 37 2319.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.025 20.349999999999998 13.8 30.825000000000003 2 25.94445834375782 26.244683512634477 30.89817363022267 16.91268451338504 3 20.040030022516888 28.796597448086064 30.572929697272954 20.590442832124094 4 23.667750813109834 32.974731048286216 23.217413059794847 20.140105078809107 5 25.18129532383096 34.858714678669664 22.930732683170792 17.029257314328582 6 19.504876219054765 38.834708677169296 23.905976494123532 17.75443860965241 7 20.225 23.150000000000002 36.475 20.150000000000002 8 21.525 25.424999999999997 28.549999999999997 24.5 9 21.85 25.35 29.599999999999998 23.200000000000003 10-14 22.88 29.439999999999998 25.82 21.86 15-19 23.18 28.76 26.47 21.59 20-24 22.98 28.13 27.250000000000004 21.64 25-29 23.27 28.79 26.63 21.310000000000002 30-34 22.945 28.544999999999998 27.495000000000005 21.015 35-39 23.47 28.125 26.974999999999998 21.43 40-44 23.080000000000002 28.23 27.205000000000002 21.485000000000003 45-49 23.575 28.015 27.02 21.39 50-54 23.25 27.865000000000002 27.529999999999998 21.355 55-59 23.544999999999998 27.565 27.185 21.705 60-64 23.61 28.1 27.05 21.240000000000002 65-69 23.41 27.439999999999998 27.655 21.495 70-74 23.535 28.194999999999997 27.200000000000003 21.07 75-79 23.755000000000003 27.265 27.400000000000002 21.58 80-84 23.674999999999997 27.994999999999997 27.05 21.279999999999998 85-89 23.34 28.175 27.235 21.25 90-94 23.39 28.38 27.08 21.15 95-99 23.96 27.74 27.055 21.245 100-104 23.669999999999998 27.52 27.785 21.025 105-109 23.799999999999997 27.715 27.205000000000002 21.279999999999998 110-114 23.93 27.815 27.235 21.02 115-119 23.935000000000002 27.83 27.37 20.865000000000002 120-124 23.97 28.01 26.915 21.105 125-129 25.25 27.82 26.540000000000003 20.39 130-134 24.69 27.52 26.96 20.830000000000002 135-139 24.27 27.694999999999997 27.55 20.485 140-144 24.610000000000003 27.905 26.82 20.665 145-149 24.88 27.985 27.125 20.01 150-151 25.159514575253343 27.761791567621668 26.54822970098836 20.530464156136617 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 2.0 26 3.5 27 2.5 28 2.5 29 5.5 30 9.0 31 12.5 32 19.0 33 29.0 34 35.0 35 49.5 36 73.5 37 91.0 38 121.5 39 165.5 40 199.5 41 222.5 42 237.0 43 260.0 44 280.0 45 272.0 46 259.0 47 275.0 48 261.0 49 217.0 50 178.5 51 149.5 52 127.0 53 104.5 54 80.0 55 52.0 56 46.0 57 37.5 58 31.5 59 25.5 60 16.0 61 10.0 62 6.5 63 5.5 64 3.0 65 3.0 66 3.0 67 2.0 68 1.5 69 2.5 70 2.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.075 4 0.075 5 0.025 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1670873296315 98.225 2 0.7319535588086825 1.4500000000000002 3 0.0757193336698637 0.22499999999999998 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7250000000000001 0.0 0.0 0.0 0.0 118-119 0.8500000000000001 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.4874999999999998 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.05 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.5 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCGT 10 0.006577216 146.82278 145 GGAACAC 10 0.006832588 144.9875 7 TGAAACT 10 0.006832588 144.9875 2 >>END_MODULE Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030953 spots for SRR7030797.sra Written 1030953 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra Read 1030936 spots for SRR7030797.sra Written 1030936 spots for SRR7030797.sra SRR ids: ['SRR7030797.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dme9jbhz SRR7030797.sra spots: 20618737 blocks: [[1, 1030936], [1030937, 2061872], [2061873, 3092808], [3092809, 4123744], [4123745, 5154680], [5154681, 6185616], [6185617, 7216552], [7216553, 8247488], [8247489, 9278424], [9278425, 10309360], [10309361, 11340296], [11340297, 12371232], [12371233, 13402168], [13402169, 14433104], [14433105, 15464040], [15464041, 16494976], [16494977, 17525912], [17525913, 18556848], [18556849, 19587784], [19587785, 20618737]] SRR7030797 file size 6965313 SRR7030797 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030797 SRR7030797_1.fastq SRR7030797_2.fastq Input file: SRR7030797_1.fastq Paired file: SRR7030797_2.fastq trimmed: SRR7030797-trimmed-pair1.fastq, SRR7030797-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:55:44 2025 >> started Wed Feb 12 17:56:06 2025 >> done (22.405s) 20618737 read pairs processed; of these: 14234 ( 0.07%) short read pairs filtered out after trimming by size control 16062 ( 0.08%) empty read pairs filtered out after trimming by size control 20588441 (99.85%) read pairs available; of these: 7889120 (38.32%) trimmed read pairs available after processing 12699321 (61.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 4 0.00% 22 2 0.00% 23 0 0.00% 24 1 0.00% 25 6 0.00% 26 4 0.00% 27 4 0.00% 28 1 0.00% 29 6 0.00% 30 2 0.00% 31 4 0.00% 32 1 0.00% 33 5 0.00% 34 9 0.00% 35 4 0.00% 36 4 0.00% 37 3 0.00% 38 5 0.00% 39 7 0.00% 40 6 0.00% 41 4 0.00% 42 4 0.00% 43 6 0.00% 44 6 0.00% 45 6 0.00% 46 13 0.00% 47 14 0.00% 48 16 0.00% 49 14 0.00% 50 18 0.00% 51 14 0.00% 52 20 0.00% 53 21 0.00% 54 24 0.00% 55 27 0.00% 56 27 0.00% 57 33 0.00% 58 37 0.00% 59 38 0.00% 60 52 0.00% 61 49 0.00% 62 65 0.00% 63 74 0.00% 64 107 0.00% 65 94 0.00% 66 86 0.00% 67 102 0.00% 68 119 0.00% 69 112 0.00% 70 131 0.00% 71 155 0.00% 72 196 0.00% 73 213 0.00% 74 291 0.00% 75 297 0.00% 76 323 0.00% 77 371 0.00% 78 429 0.00% 79 512 0.00% 80 564 0.00% 81 617 0.00% 82 764 0.00% 83 891 0.00% 84 1696 0.01% 85 2125 0.01% 86 2306 0.01% 87 2478 0.01% 88 2668 0.01% 89 2818 0.01% 90 2908 0.01% 91 3102 0.02% 92 3340 0.02% 93 3620 0.02% 94 3871 0.02% 95 4157 0.02% 96 4357 0.02% 97 4794 0.02% 98 5227 0.03% 99 5444 0.03% 100 5780 0.03% 101 6382 0.03% 102 6679 0.03% 103 7074 0.03% 104 7658 0.04% 105 8423 0.04% 106 9060 0.04% 107 9404 0.05% 108 10219 0.05% 109 10810 0.05% 110 11575 0.06% 111 12117 0.06% 112 13290 0.06% 113 14130 0.07% 114 15162 0.07% 115 16580 0.08% 116 17778 0.09% 117 18647 0.09% 118 19553 0.09% 119 20393 0.10% 120 21515 0.10% 121 22801 0.11% 122 24297 0.12% 123 25576 0.12% 124 27161 0.13% 125 29027 0.14% 126 30736 0.15% 127 32157 0.16% 128 34046 0.17% 129 36105 0.18% 130 38098 0.19% 131 41078 0.20% 132 43137 0.21% 133 46717 0.23% 134 50071 0.24% 135 54292 0.26% 136 58369 0.28% 137 62696 0.30% 138 67492 0.33% 139 74676 0.36% 140 80056 0.39% 141 87389 0.42% 142 96986 0.47% 143 110023 0.53% 144 129969 0.63% 145 158504 0.77% 146 200986 0.98% 147 274439 1.33% 148 422761 2.05% 149 841224 4.09% 150 4364069 21.20% 151 12699321 61.68% 20588441 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=7.73 fanout-score-rank=17 prefix-density=0.46 prefix-fanout=5.0 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACCGCCTTTCCGGCTAGCGAAGGGGACGAGAGGGCCATTGTTGCTGCTGCCATT criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=354.31 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=32.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=40 prefix-density=0.40 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=111.81 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.1 sequence=TCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGG SRR7030797 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:56:50 Started mapping on | Feb 12 17:56:50 Finished on | Feb 12 17:58:55 Mapping speed, Million of reads per hour | 592.95 Number of input reads | 20588441 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19311749 Uniquely mapped reads % | 93.80% Average mapped length | 297.15 Number of splices: Total | 19929658 Number of splices: Annotated (sjdb) | 19625709 Number of splices: GT/AG | 19585641 Number of splices: GC/AG | 283178 Number of splices: AT/AC | 14217 Number of splices: Non-canonical | 46622 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 600816 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 433042 % of reads mapped to too many loci | 2.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.85% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 689921 689921 689921 N_multimapping 600816 600816 600816 N_noFeature 390713 19116318 460020 N_ambiguous 237107 818 110511 UnstrandedReadsAssigned:18683929 PositiveStrandReadsAssigned:194613 NegativeStrandReadsAssigned:18741218 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030797 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030797-trimmed-pair1.fastq SRR7030797-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,588,441 reads, 19,039,396 reads pseudoaligned [quant] estimated average fragment length: 252.833 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR7030797.ke.tsv 34699 SRR7030797.se.tsv 87100 total ==> SRR7030797.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.17 1265 26.2601 Potri.005G024800.1.v4.1 1035 783.167 412 19.2877 Potri.004G059700.1.v4.1 961 709.179 27 1.39587 Potri.007G009000.2.v4.1 1416 1164.17 0 0 Potri.003G141000.2.v4.1 2943 2691.17 530 7.22059 Potri.016G087400.1.v4.1 270 68.2917 1499.15 804.852 Potri.015G069301.1.v4.1 564 315.349 0 0 Potri.010G195200.1.v4.1 1773 1521.17 29 0.69897 Potri.012G127500.1.v4.1 977 725.167 7610 384.755 ==> SRR7030797.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 358 Potri.001G212900.v4.1 40 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7030797 completed mapping pipeline successfully