Starting /dee2/code/volunteer_pipeline.sh SRR7030798 current disk space = 3051240722432 free memory = 1580262356 SRR7030798 SRAfilesize f5d96c5935c503458d5842cbdd6d33d9 SRR7030798.sra SRR7030798.sra file validated SRR7030798 is paired end SRR7030798 is conventional basespace SRR7030798 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030798_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.24825 18.0 18.0 32.0 18.0 33.0 2 26.69375 27.0 18.0 31.0 18.0 33.0 3 29.6165 31.0 27.0 33.0 25.0 33.0 4 30.8355 31.0 30.0 33.0 27.0 33.0 5 31.89775 33.0 32.0 33.0 31.0 33.0 6 36.25175 37.0 36.0 38.0 33.0 38.0 7 36.56675 38.0 37.0 38.0 34.0 38.0 8 37.056 38.0 38.0 38.0 36.0 38.0 9 37.247 38.0 38.0 38.0 36.0 38.0 10-14 37.3143 38.0 38.0 38.0 36.8 38.0 15-19 37.3515 38.0 38.0 38.0 37.0 38.0 20-24 37.40905 38.0 38.0 38.0 37.0 38.0 25-29 37.348349999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.27120000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.25155 38.0 38.0 38.0 36.8 38.0 40-44 37.18115 38.0 38.0 38.0 36.2 38.0 45-49 37.176649999999995 38.0 38.0 38.0 36.0 38.0 50-54 37.124 38.0 38.0 38.0 36.0 38.0 55-59 37.06425 38.0 38.0 38.0 36.0 38.0 60-64 36.9524 38.0 38.0 38.0 35.8 38.0 65-69 36.8691 38.0 38.0 38.0 35.0 38.0 70-74 36.8431 38.0 38.0 38.0 35.0 38.0 75-79 36.7562 38.0 38.0 38.0 34.6 38.0 80-84 36.683299999999996 38.0 38.0 38.0 34.6 38.0 85-89 36.668699999999994 38.0 38.0 38.0 34.8 38.0 90-94 36.45335 38.0 38.0 38.0 34.0 38.0 95-99 36.05415 38.0 37.2 38.0 32.8 38.0 100-104 36.17725 38.0 37.0 38.0 33.4 38.0 105-109 35.876250000000006 38.0 37.0 38.0 31.8 38.0 110-114 35.820049999999995 38.0 37.0 38.0 31.6 38.0 115-119 35.72924999999999 38.0 37.0 38.0 31.4 38.0 120-124 35.51375 38.0 36.0 38.0 31.0 38.0 125-129 35.171200000000006 38.0 36.0 38.0 28.2 38.0 130-134 34.946000000000005 38.0 35.2 38.0 27.8 38.0 135-139 34.589549999999996 38.0 35.0 38.0 26.2 38.0 140-144 34.384699999999995 38.0 35.0 38.0 26.4 38.0 145-149 33.53060000000001 38.0 34.6 38.0 20.6 38.0 150-151 29.997500000000002 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 4.0 18 3.0 19 3.0 20 0.0 21 9.0 22 7.0 23 10.0 24 8.0 25 14.0 26 15.0 27 28.0 28 32.0 29 40.0 30 59.0 31 63.0 32 83.0 33 142.0 34 195.0 35 338.0 36 862.0 37 2080.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.3936922240348 16.938553561718326 10.304513322457858 38.36324089178901 2 21.3 14.475 33.324999999999996 30.9 3 19.125 18.875 28.15 33.85 4 23.400000000000002 26.400000000000002 22.525000000000002 27.675 5 23.599999999999998 31.6 24.375 20.424999999999997 6 19.3 35.275 24.575 20.849999999999998 7 14.45 26.174999999999997 41.9 17.474999999999998 8 17.7 26.35 30.9 25.05 9 17.2 24.375 34.849999999999994 23.575 10-14 19.535 29.9 27.48 23.085 15-19 19.655 28.749999999999996 27.845 23.75 20-24 19.8 28.599999999999998 28.015 23.585 25-29 19.78 28.720000000000002 27.785 23.715 30-34 19.59 28.715000000000003 27.685 24.01 35-39 19.759999999999998 28.994999999999997 27.339999999999996 23.905 40-44 19.634999999999998 29.14 27.24 23.985 45-49 19.919999999999998 28.139999999999997 27.395000000000003 24.545 50-54 20.24 28.54 27.655 23.565 55-59 20.035 28.215 27.779999999999998 23.97 60-64 20.315 29.154999999999998 26.985 23.544999999999998 65-69 19.53 28.375 27.555000000000003 24.54 70-74 20.05 28.52 27.375 24.055 75-79 19.98 28.64 27.250000000000004 24.13 80-84 20.28 28.175 27.975 23.57 85-89 20.535 27.665 27.935 23.865 90-94 19.425 28.435 27.83 24.310000000000002 95-99 20.23 28.075 27.37 24.325 100-104 19.955000000000002 28.134999999999998 28.515 23.395 105-109 20.599999999999998 28.349999999999998 27.48 23.57 110-114 20.385 27.900000000000002 27.77 23.945 115-119 20.655 28.26 27.465 23.62 120-124 20.385 28.215 27.639999999999997 23.76 125-129 20.544999999999998 27.825 27.275 24.355 130-134 20.13 28.365000000000002 27.54 23.965 135-139 20.24 28.065 27.66 24.035 140-144 20.845 27.365000000000002 27.894999999999996 23.895 145-149 20.544999999999998 27.775 27.785 23.895 150-151 20.477858393795348 27.75831873905429 27.207905929447087 24.55591693770328 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 2.0 22 3.5 23 3.0 24 5.0 25 5.0 26 5.5 27 8.5 28 9.5 29 20.0 30 27.5 31 24.0 32 26.0 33 36.5 34 57.5 35 63.5 36 73.0 37 105.0 38 130.0 39 153.0 40 191.5 41 228.0 42 247.5 43 262.5 44 282.5 45 274.5 46 259.0 47 240.5 48 218.0 49 204.5 50 167.5 51 140.5 52 113.0 53 92.0 54 71.5 55 50.5 56 47.5 57 40.5 58 27.5 59 21.5 60 20.0 61 10.0 62 7.0 63 6.5 64 4.0 65 3.5 66 2.0 67 2.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.36250000000000004 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.075 0.0 0.0 0.0 0.0 124-125 1.2 0.0 0.0 0.0 0.0 126-127 1.2625000000000002 0.0 0.0 0.0 0.0 128-129 1.3625 0.0 0.0 0.0 0.0 130-131 1.5125000000000002 0.0 0.0 0.0 0.0 132-133 1.6875 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 2.0999999999999996 0.0 0.0 0.0 0.0 138-139 2.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCGTAG 10 0.0056249425 154.6 1 >>END_MODULE SRR7030798 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030798_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.565 33.0 33.0 34.0 32.0 34.0 2 32.68725 33.0 33.0 34.0 32.0 34.0 3 32.7215 33.0 33.0 34.0 32.0 34.0 4 32.61525 33.0 33.0 34.0 32.0 34.0 5 32.7035 33.0 33.0 34.0 32.0 34.0 6 36.9315 38.0 38.0 38.0 36.0 38.0 7 36.98375 38.0 38.0 38.0 36.0 38.0 8 36.83725 38.0 38.0 38.0 36.0 38.0 9 36.91325 38.0 38.0 38.0 36.0 38.0 10-14 36.951449999999994 38.0 38.0 38.0 36.0 38.0 15-19 36.814949999999996 38.0 38.0 38.0 35.4 38.0 20-24 36.857299999999995 38.0 38.0 38.0 35.6 38.0 25-29 36.83895 38.0 38.0 38.0 35.8 38.0 30-34 36.7793 38.0 38.0 38.0 35.6 38.0 35-39 36.6952 38.0 38.0 38.0 34.8 38.0 40-44 36.5646 38.0 38.0 38.0 35.0 38.0 45-49 36.402849999999994 38.0 38.0 38.0 34.0 38.0 50-54 36.6248 38.0 38.0 38.0 34.6 38.0 55-59 36.58065 38.0 38.0 38.0 34.2 38.0 60-64 36.4308 38.0 38.0 38.0 34.0 38.0 65-69 36.2347 38.0 38.0 38.0 33.2 38.0 70-74 36.2132 38.0 38.0 38.0 33.6 38.0 75-79 36.10934999999999 38.0 37.8 38.0 33.0 38.0 80-84 36.16185 38.0 37.8 38.0 33.4 38.0 85-89 35.9658 38.0 37.0 38.0 32.8 38.0 90-94 35.8755 38.0 37.0 38.0 31.4 38.0 95-99 35.69225 38.0 37.0 38.0 31.2 38.0 100-104 35.260450000000006 38.0 36.0 38.0 28.8 38.0 105-109 35.16759999999999 38.0 36.2 38.0 28.2 38.0 110-114 34.986599999999996 38.0 36.0 38.0 27.6 38.0 115-119 34.86450000000001 38.0 35.8 38.0 27.0 38.0 120-124 34.581 38.0 35.2 38.0 25.4 38.0 125-129 34.06165 38.0 34.8 38.0 22.6 38.0 130-134 33.9591 38.0 34.6 38.0 23.0 38.0 135-139 33.45585 38.0 34.0 38.0 19.8 38.0 140-144 32.2352 37.4 31.6 38.0 14.0 38.0 145-149 31.5079 36.8 31.8 38.0 11.2 38.0 150-151 27.531625 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 2.0 5 0.0 6 2.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 1.0 13 2.0 14 3.0 15 3.0 16 2.0 17 6.0 18 8.0 19 7.0 20 11.0 21 12.0 22 13.0 23 13.0 24 33.0 25 31.0 26 30.0 27 36.0 28 48.0 29 63.0 30 50.0 31 94.0 32 87.0 33 119.0 34 230.0 35 384.0 36 749.0 37 1946.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.30907726931733 22.83070767691923 14.17854463615904 26.6816704176044 2 28.75751503006012 24.32364729458918 28.75751503006012 18.161322645290582 3 20.20050125313283 28.020050125313283 32.00501253132832 19.774436090225564 4 24.02304609218437 32.765531062124246 25.150300601202403 18.061122244488978 5 25.53191489361702 36.69586983729662 20.67584480600751 17.09637046307885 6 20.40560841261893 38.35753630445669 23.209814722083124 18.02704056084126 7 20.810405202601302 21.810905452726363 38.169084542271136 19.209604802401202 8 22.36118059029515 25.18759379689845 27.43871935967984 25.012506253126567 9 20.45 25.474999999999998 30.925000000000004 23.150000000000002 10-14 23.25 28.884999999999998 26.279999999999998 21.584999999999997 15-19 22.95 28.73 27.005000000000003 21.315 20-24 23.35 28.544999999999998 27.495000000000005 20.61 25-29 23.035 28.37 27.939999999999998 20.655 30-34 22.384999999999998 28.349999999999998 28.384999999999998 20.880000000000003 35-39 22.975 27.83 28.299999999999997 20.895 40-44 23.585 27.495000000000005 27.975 20.945 45-49 23.064999999999998 27.965 28.025 20.945 50-54 22.846142307115354 28.511425571278565 27.281364068203413 21.361068053402672 55-59 23.330000000000002 27.77 27.77 21.13 60-64 23.754750950190036 27.845569113822766 27.975595119023804 20.424084816963394 65-69 23.425 27.67 28.12 20.785 70-74 23.23848577286593 27.859178876831525 28.019202880432065 20.883132469870482 75-79 22.981149057452875 28.046402320116005 28.21141057052853 20.761038051902595 80-84 23.317331733173315 27.952795279527955 27.85778577857786 20.87208720872087 85-89 23.091154557727886 27.76638831941597 28.25141257062853 20.891044552227612 90-94 23.91 28.26 27.650000000000002 20.18 95-99 23.49 28.52 27.87 20.119999999999997 100-104 24.262278683605082 27.9333800140042 27.838351505451637 19.96598979693908 105-109 23.632363236323634 28.267826782678267 27.59275927592759 20.507050705070505 110-114 23.51617580879044 27.706385319265962 28.07140357017851 20.706035301765088 115-119 23.69473894778956 27.885577115423082 27.665533106621325 20.754150830166033 120-124 23.980995248812203 28.032008002000502 28.02700675168792 19.959989997499374 125-129 24.495 27.555000000000003 27.855 20.095 130-134 23.974999999999998 28.499999999999996 27.134999999999998 20.39 135-139 24.305 28.01 27.58 20.105 140-144 24.317431743174318 28.052805280528055 27.652765276527653 19.976997699769978 145-149 23.9747949589918 28.040608121624327 27.630526105221044 20.354070814162835 150-151 24.343585896474117 28.107026756689173 27.656914228557138 19.892473118279568 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 2.0 22 2.0 23 1.0 24 2.0 25 3.5 26 3.5 27 4.5 28 8.0 29 10.0 30 10.5 31 19.5 32 28.0 33 35.5 34 46.0 35 61.5 36 84.5 37 101.5 38 130.0 39 180.5 40 220.5 41 237.5 42 235.0 43 258.5 44 290.5 45 280.5 46 275.0 47 260.5 48 219.0 49 191.5 50 160.0 51 126.5 52 108.5 53 99.0 54 78.5 55 49.0 56 40.5 57 33.5 58 24.0 59 15.5 60 10.0 61 10.5 62 11.5 63 9.0 64 5.0 65 3.0 66 2.0 67 1.0 68 0.0 69 2.0 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.2 3 0.25 4 0.2 5 0.125 6 0.15 7 0.05 8 0.05 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.02 65-69 0.0 70-74 0.015 75-79 0.005 80-84 0.01 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.01 110-114 0.005 115-119 0.02 120-124 0.025 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.02 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.45271629778672035 0.8999999999999999 3 0.07545271629778671 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.36250000000000004 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.075 0.0 0.0 0.0 0.0 124-125 1.2 0.0 0.0 0.0 0.0 126-127 1.2625000000000002 0.0 0.0 0.0 0.0 128-129 1.3875 0.0 0.0 0.0 0.0 130-131 1.5375 0.0 0.0 0.0 0.0 132-133 1.6875 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 2.0999999999999996 0.0 0.0 0.0 0.0 138-139 2.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCTTC 10 0.006585701 146.75949 5 >>END_MODULE Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131138 spots for SRR7030798.sra Written 1131138 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra Read 1131129 spots for SRR7030798.sra Written 1131129 spots for SRR7030798.sra SRR ids: ['SRR7030798.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bzzedhpl SRR7030798.sra spots: 22622589 blocks: [[1, 1131129], [1131130, 2262258], [2262259, 3393387], [3393388, 4524516], [4524517, 5655645], [5655646, 6786774], [6786775, 7917903], [7917904, 9049032], [9049033, 10180161], [10180162, 11311290], [11311291, 12442419], [12442420, 13573548], [13573549, 14704677], [14704678, 15835806], [15835807, 16966935], [16966936, 18098064], [18098065, 19229193], [19229194, 20360322], [20360323, 21491451], [21491452, 22622589]] SRR7030798 file size 7644352 SRR7030798 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030798 SRR7030798_1.fastq SRR7030798_2.fastq Input file: SRR7030798_1.fastq Paired file: SRR7030798_2.fastq trimmed: SRR7030798-trimmed-pair1.fastq, SRR7030798-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:41:02 2025 >> started Wed Feb 12 18:41:34 2025 >> done (31.620s) 22622589 read pairs processed; of these: 24185 ( 0.11%) short read pairs filtered out after trimming by size control 26712 ( 0.12%) empty read pairs filtered out after trimming by size control 22571692 (99.78%) read pairs available; of these: 9094781 (40.29%) trimmed read pairs available after processing 13476911 (59.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 4 0.00% 21 6 0.00% 22 11 0.00% 23 7 0.00% 24 6 0.00% 25 16 0.00% 26 6 0.00% 27 5 0.00% 28 12 0.00% 29 3 0.00% 30 8 0.00% 31 10 0.00% 32 6 0.00% 33 4 0.00% 34 10 0.00% 35 5 0.00% 36 9 0.00% 37 5 0.00% 38 9 0.00% 39 16 0.00% 40 5 0.00% 41 15 0.00% 42 9 0.00% 43 10 0.00% 44 11 0.00% 45 18 0.00% 46 16 0.00% 47 18 0.00% 48 17 0.00% 49 22 0.00% 50 17 0.00% 51 28 0.00% 52 25 0.00% 53 33 0.00% 54 34 0.00% 55 43 0.00% 56 46 0.00% 57 41 0.00% 58 49 0.00% 59 63 0.00% 60 49 0.00% 61 71 0.00% 62 75 0.00% 63 92 0.00% 64 94 0.00% 65 101 0.00% 66 109 0.00% 67 148 0.00% 68 161 0.00% 69 137 0.00% 70 165 0.00% 71 211 0.00% 72 255 0.00% 73 251 0.00% 74 337 0.00% 75 371 0.00% 76 416 0.00% 77 500 0.00% 78 532 0.00% 79 584 0.00% 80 708 0.00% 81 772 0.00% 82 958 0.00% 83 1099 0.00% 84 2403 0.01% 85 3157 0.01% 86 3167 0.01% 87 3378 0.01% 88 3672 0.02% 89 3697 0.02% 90 3707 0.02% 91 3981 0.02% 92 4129 0.02% 93 4317 0.02% 94 4505 0.02% 95 4889 0.02% 96 5203 0.02% 97 5490 0.02% 98 5871 0.03% 99 6442 0.03% 100 6350 0.03% 101 6726 0.03% 102 7132 0.03% 103 7783 0.03% 104 8211 0.04% 105 9001 0.04% 106 9563 0.04% 107 10087 0.04% 108 10740 0.05% 109 11473 0.05% 110 12504 0.06% 111 13639 0.06% 112 14418 0.06% 113 15488 0.07% 114 16490 0.07% 115 17891 0.08% 116 19063 0.08% 117 20335 0.09% 118 21414 0.09% 119 22536 0.10% 120 23683 0.10% 121 25046 0.11% 122 26844 0.12% 123 28801 0.13% 124 30300 0.13% 125 32251 0.14% 126 34062 0.15% 127 35804 0.16% 128 38577 0.17% 129 41253 0.18% 130 44079 0.20% 131 46519 0.21% 132 50233 0.22% 133 53957 0.24% 134 57625 0.26% 135 62236 0.28% 136 67562 0.30% 137 73305 0.32% 138 80230 0.36% 139 88478 0.39% 140 96786 0.43% 141 106011 0.47% 142 118636 0.53% 143 135731 0.60% 144 160763 0.71% 145 195548 0.87% 146 252267 1.12% 147 335090 1.48% 148 501897 2.22% 149 998798 4.43% 150 4914676 21.77% 151 13476911 59.71% 22571692 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=9.03 fanout-score-rank=17 prefix-density=0.29 prefix-fanout=4.6 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=91.01 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=9.8 sequence=AAACAAGAATTTTATTGTTTCCTGTCACACCAAGGCAAACCAAACCAGTCTTCTTTTATGCACCCATACGGATAATACACCTCAGGCCAGCTCCACTAAGCATGTACTCGAAAGCCTTGTTGATTTCTGAGAAAGGGACTTCATGGGTGATGAATTTCTCTAGCTCCAGCTCCTTGTTCATGTACTTCTCGACAACTGAAGGAAGGTCGGAGCGCGGTTTGTAGTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=7.83 fanout-score-rank=21 prefix-density=0.33 prefix-fanout=4.9 sequence=CAAGCAAAGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=288.44 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=10.9 sequence=AGAGAAAAGATAAGCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGGCAAGCTTAGAAAGATCAGCACCAGACCACTTAACATCAAAGATATTGACGTCGGAGAGGGGAGCAGTCCTGTTAATAAGTTTCAGAGGTCCATGACTATGCCAGGAACTCCAGGGACACCGACGACACCAGTGACCCCTACAACCCCAGTGTCGGCGCGTAGCAATGTTTGGAGGAGCGTGTTCCACCCTGGTAGCAACCTTGCTACTAAGAATATTGGTGCTCATGTTTTTGACAAGCCACAGCCTAACACACCCACTGTCTATGACTGGATGTACAGTGGAGAGACGAAGAGCGAGCATCGTTGATGAGGTTGCCTTCAACCAAGGTTGCCCATGTAAATACGTACTGTGTTTTGTTTTTCAGTACTCATCTGCAATATGTCTCTTGTTGTTATGGTTCTACGGTTCTACCGTGCCTGGAA SRR7030798 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:42:41 Started mapping on | Feb 12 18:42:41 Finished on | Feb 12 18:45:03 Mapping speed, Million of reads per hour | 572.24 Number of input reads | 22571692 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 21215028 Uniquely mapped reads % | 93.99% Average mapped length | 296.78 Number of splices: Total | 19547971 Number of splices: Annotated (sjdb) | 19150176 Number of splices: GT/AG | 19201707 Number of splices: GC/AG | 264906 Number of splices: AT/AC | 18195 Number of splices: Non-canonical | 63163 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 654293 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 331126 % of reads mapped to too many loci | 1.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.43% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 727739 727739 727739 N_multimapping 654293 654293 654293 N_noFeature 608878 20985081 721171 N_ambiguous 236182 1431 117762 UnstrandedReadsAssigned:20369968 PositiveStrandReadsAssigned:228516 NegativeStrandReadsAssigned:20376095 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030798 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030798-trimmed-pair1.fastq SRR7030798-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,571,692 reads, 20,578,570 reads pseudoaligned [quant] estimated average fragment length: 260.357 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7030798.ke.tsv 34699 SRR7030798.se.tsv 87100 total ==> SRR7030798.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.64 2440 51.2157 Potri.005G024800.1.v4.1 1035 775.643 1595 75.9083 Potri.004G059700.1.v4.1 961 701.664 32 1.68349 Potri.007G009000.2.v4.1 1416 1156.64 0 0 Potri.003G141000.2.v4.1 2943 2683.64 649.647 8.93601 Potri.016G087400.1.v4.1 270 66.6472 1158.2 641.495 Potri.015G069301.1.v4.1 564 309.306 0 0 Potri.010G195200.1.v4.1 1773 1513.64 124 3.02405 Potri.012G127500.1.v4.1 977 717.657 15431 793.721 ==> SRR7030798.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 341 Potri.001G212900.v4.1 192 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 23 SRR7030798 completed mapping pipeline successfully