Starting /dee2/code/volunteer_pipeline.sh SRR7030799 current disk space = 3051467755520 free memory = 1464938604 SRR7030799 SRAfilesize 9d399d4ed9edff9c171ed5d38a780973 SRR7030799.sra SRR7030799.sra file validated SRR7030799 is paired end SRR7030799 is conventional basespace SRR7030799 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030799_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.603 25.0 18.0 33.0 18.0 33.0 2 27.07575 29.0 25.0 33.0 18.0 33.0 3 30.0355 31.0 28.0 33.0 27.0 33.0 4 31.12975 33.0 31.0 33.0 29.0 33.0 5 32.34725 33.0 33.0 33.0 32.0 33.0 6 36.12525 38.0 36.0 38.0 33.0 38.0 7 36.70675 38.0 37.0 38.0 34.0 38.0 8 37.06875 38.0 38.0 38.0 35.0 38.0 9 37.37975 38.0 38.0 38.0 37.0 38.0 10-14 37.36655 38.0 38.0 38.0 37.0 38.0 15-19 37.44845 38.0 38.0 38.0 37.0 38.0 20-24 37.45525 38.0 38.0 38.0 37.0 38.0 25-29 37.383500000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.32165 38.0 38.0 38.0 37.0 38.0 35-39 37.346050000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.25045 38.0 38.0 38.0 37.0 38.0 45-49 37.2131 38.0 38.0 38.0 36.6 38.0 50-54 37.21995 38.0 38.0 38.0 37.0 38.0 55-59 37.1813 38.0 38.0 38.0 36.4 38.0 60-64 37.09755 38.0 38.0 38.0 36.0 38.0 65-69 36.98365 38.0 38.0 38.0 35.8 38.0 70-74 36.9185 38.0 38.0 38.0 35.8 38.0 75-79 36.9105 38.0 38.0 38.0 35.6 38.0 80-84 36.811400000000006 38.0 38.0 38.0 35.0 38.0 85-89 36.75975 38.0 38.0 38.0 34.8 38.0 90-94 36.637750000000004 38.0 38.0 38.0 34.4 38.0 95-99 36.2919 38.0 37.6 38.0 33.4 38.0 100-104 36.43975 38.0 38.0 38.0 34.0 38.0 105-109 36.1579 38.0 37.4 38.0 33.4 38.0 110-114 36.15255 38.0 37.0 38.0 33.2 38.0 115-119 35.99895 38.0 37.0 38.0 33.0 38.0 120-124 35.76369999999999 38.0 36.8 38.0 31.2 38.0 125-129 35.5572 38.0 36.2 38.0 30.6 38.0 130-134 35.197199999999995 38.0 36.0 38.0 28.2 38.0 135-139 34.86595 38.0 35.0 38.0 27.8 38.0 140-144 34.631449999999994 38.0 35.0 38.0 27.4 38.0 145-149 34.00655 38.0 34.8 38.0 24.6 38.0 150-151 30.480125 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 0.0 16 2.0 17 0.0 18 2.0 19 4.0 20 1.0 21 2.0 22 3.0 23 3.0 24 10.0 25 16.0 26 22.0 27 20.0 28 26.0 29 28.0 30 53.0 31 61.0 32 87.0 33 128.0 34 177.0 35 311.0 36 785.0 37 2256.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.25664677156809 14.839934888768314 10.44492674986435 35.45849158979924 2 20.65 13.625000000000002 33.15 32.574999999999996 3 17.575 18.9 29.825000000000003 33.7 4 22.175 26.400000000000002 25.8 25.624999999999996 5 22.55 34.449999999999996 22.825 20.175 6 18.975 35.075 25.324999999999996 20.625 7 14.149999999999999 25.825 41.575 18.45 8 17.125 25.35 31.900000000000002 25.624999999999996 9 17.875 24.224999999999998 33.475 24.425 10-14 19.285 29.085 27.515 24.115000000000002 15-19 19.945 27.455000000000002 28.32 24.279999999999998 20-24 19.675 28.62 28.205000000000002 23.5 25-29 19.564999999999998 28.37 27.675 24.39 30-34 20.345 28.215 27.67 23.77 35-39 19.82 28.005000000000003 28.16 24.015 40-44 19.88 28.605000000000004 27.384999999999998 24.13 45-49 20.13 28.360000000000003 27.63 23.880000000000003 50-54 19.35 28.595 27.935 24.12 55-59 19.75 28.375 27.845 24.03 60-64 20.135 27.55 28.305000000000003 24.01 65-69 19.939999999999998 28.854999999999997 27.325 23.880000000000003 70-74 20.11 28.610000000000003 27.32 23.96 75-79 20.169999999999998 28.21 27.400000000000002 24.22 80-84 20.775 28.07 27.88 23.275000000000002 85-89 20.765 28.215 27.6 23.419999999999998 90-94 20.919999999999998 28.044999999999998 27.48 23.555 95-99 20.445 28.475 27.560000000000002 23.52 100-104 20.39 28.255000000000003 27.505000000000003 23.849999999999998 105-109 19.8 28.494999999999997 27.705000000000002 24.0 110-114 20.22 28.07 27.85 23.86 115-119 20.64 28.98 26.805 23.575 120-124 20.474999999999998 27.93 27.76 23.835 125-129 20.169999999999998 28.095 27.855 23.880000000000003 130-134 20.66 28.194999999999997 27.345000000000002 23.799999999999997 135-139 20.580000000000002 28.18 27.405 23.835 140-144 20.385 28.23 27.200000000000003 24.185000000000002 145-149 20.265 27.71 28.01 24.015 150-151 20.69784892446223 27.763881940970485 27.226113056528263 24.312156078039017 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.5 19 1.0 20 0.5 21 1.0 22 1.5 23 1.5 24 1.0 25 2.5 26 4.0 27 6.0 28 8.5 29 8.5 30 18.0 31 28.0 32 35.5 33 47.0 34 54.5 35 63.0 36 69.0 37 87.5 38 128.0 39 158.5 40 182.5 41 223.0 42 249.0 43 247.5 44 269.5 45 288.0 46 276.0 47 260.5 48 236.5 49 211.5 50 183.5 51 148.5 52 116.5 53 92.0 54 67.0 55 54.5 56 46.0 57 34.5 58 28.5 59 22.0 60 13.5 61 4.0 62 3.5 63 4.5 64 2.5 65 2.0 66 2.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.7250000000000001 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.1625 0.0 0.0 0.0 0.0 128-129 1.3 0.0 0.0 0.0 0.0 130-131 1.3875 0.0 0.0 0.0 0.0 132-133 1.5499999999999998 0.0 0.0 0.0 0.0 134-135 1.7 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138-139 2.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAACAG 20 0.005952643 28.9825 105-109 >>END_MODULE SRR7030799 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030799_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.604 33.0 33.0 34.0 32.0 34.0 2 32.7385 33.0 33.0 34.0 32.0 34.0 3 32.7295 33.0 33.0 34.0 32.0 34.0 4 32.6375 33.0 33.0 34.0 32.0 34.0 5 32.6445 33.0 33.0 34.0 32.0 34.0 6 36.9775 38.0 38.0 38.0 36.0 38.0 7 37.00225 38.0 38.0 38.0 36.0 38.0 8 37.083 38.0 38.0 38.0 36.0 38.0 9 36.86875 38.0 38.0 38.0 36.0 38.0 10-14 36.93305 38.0 38.0 38.0 35.8 38.0 15-19 36.8201 38.0 38.0 38.0 35.6 38.0 20-24 36.832 38.0 38.0 38.0 35.8 38.0 25-29 36.7941 38.0 38.0 38.0 35.8 38.0 30-34 36.74765 38.0 38.0 38.0 35.4 38.0 35-39 36.7093 38.0 38.0 38.0 35.2 38.0 40-44 36.599349999999994 38.0 38.0 38.0 34.6 38.0 45-49 36.43055 38.0 38.0 38.0 34.0 38.0 50-54 36.5767 38.0 38.0 38.0 34.6 38.0 55-59 36.50655 38.0 38.0 38.0 34.0 38.0 60-64 36.4344 38.0 38.0 38.0 34.2 38.0 65-69 36.2038 38.0 38.0 38.0 33.6 38.0 70-74 36.19245 38.0 38.0 38.0 33.6 38.0 75-79 36.12325 38.0 37.8 38.0 33.0 38.0 80-84 36.11175 38.0 37.8 38.0 33.0 38.0 85-89 36.02475 38.0 37.0 38.0 33.0 38.0 90-94 35.7703 38.0 37.0 38.0 31.0 38.0 95-99 35.6215 38.0 37.0 38.0 30.6 38.0 100-104 35.39115 38.0 36.8 38.0 29.6 38.0 105-109 35.15955 38.0 36.4 38.0 28.8 38.0 110-114 34.97065 38.0 36.0 38.0 27.6 38.0 115-119 34.79825000000001 38.0 35.6 38.0 27.0 38.0 120-124 34.64675 38.0 35.2 38.0 26.6 38.0 125-129 34.15375 38.0 35.0 38.0 23.4 38.0 130-134 33.994150000000005 38.0 35.0 38.0 23.0 38.0 135-139 33.5751 38.0 34.4 38.0 20.6 38.0 140-144 32.370050000000006 37.4 31.6 38.0 16.4 38.0 145-149 31.389400000000002 36.8 31.4 38.0 11.2 38.0 150-151 27.577125000000002 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 4.0 5 3.0 6 1.0 7 2.0 8 4.0 9 1.0 10 2.0 11 2.0 12 3.0 13 3.0 14 3.0 15 3.0 16 2.0 17 7.0 18 6.0 19 9.0 20 11.0 21 12.0 22 13.0 23 15.0 24 16.0 25 24.0 26 29.0 27 32.0 28 42.0 29 48.0 30 66.0 31 89.0 32 112.0 33 113.0 34 200.0 35 369.0 36 817.0 37 1928.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.04502251125563 22.086043021510758 12.88144072036018 24.987493746873437 2 28.853853853853856 25.875875875875877 27.152152152152155 18.11811811811812 3 20.30037546933667 29.236545682102626 32.015018773466835 18.448060075093867 4 23.52941176470588 34.34292866082603 23.92991239048811 18.197747183979978 5 23.492619464598448 36.952714535901926 21.36602451838879 18.188641481110835 6 21.371371371371374 38.713713713713716 22.94794794794795 16.966966966966968 7 20.28514257128564 23.06153076538269 37.693846923461734 18.959479739869938 8 21.935967983991997 25.387693846923458 27.613806903451728 25.062531265632813 9 22.125 25.174999999999997 29.599999999999998 23.1 10-14 23.2973297329733 29.68296829682968 26.062606260626065 20.957095709570957 15-19 22.814999999999998 28.355000000000004 28.175 20.655 20-24 22.525000000000002 29.015 27.544999999999998 20.915 25-29 22.526126306315316 28.901445072253612 27.91639581979099 20.65603280164008 30-34 22.81 27.884999999999998 28.315 20.990000000000002 35-39 22.62 28.345 28.435 20.599999999999998 40-44 22.814999999999998 27.62 28.23 21.335 45-49 22.826141307065352 28.34141707085354 27.971398569928496 20.86104305215261 50-54 22.593389008351252 28.22423363504526 27.94919237885683 21.23318497774666 55-59 23.86477295459092 28.440688137627525 27.4004800960192 20.29405881176235 60-64 22.895723930982744 27.66191547886972 27.89197299324831 21.550387596899228 65-69 23.198479771965793 27.86918037705656 28.234235135270293 20.698104715707355 70-74 23.602080624187256 27.54326297889367 27.798339501850556 21.05631689506852 75-79 23.718557783667553 27.76916537480622 27.474121118167727 21.038155723358503 80-84 23.420855213803453 28.052013003250813 27.60190047511878 20.92523130782696 85-89 23.476173808690433 27.726386319315964 27.731386569328464 21.066053302665132 90-94 23.871193559677984 27.42137106855343 28.046402320116005 20.661033051652584 95-99 23.621181059052955 28.10140507025351 28.096404820241013 20.181009050452523 100-104 23.4343737494998 27.761104441776713 27.85614245698279 20.948379351740694 105-109 23.552065619685905 27.17815344603381 28.443533059917975 20.82624787436231 110-114 23.600900225056265 28.00200050012503 27.746936734183546 20.650162540635158 115-119 23.528234882208775 28.16985945080778 27.339568849097184 20.96233681788626 120-124 23.884553821528613 27.671068427370948 28.016206482593038 20.428171268507402 125-129 23.812381238123812 27.157715771577156 27.85778577857786 21.172117211721172 130-134 23.472347234723472 28.252825282528253 27.26772677267727 21.007100710071008 135-139 24.432443244324435 27.337733773377337 27.527752775277527 20.7020702070207 140-144 23.682104631389418 28.16845053516055 27.328198459537862 20.821246373912174 145-149 24.511127781945486 27.41185296324081 27.866966741685424 20.210052513128282 150-151 24.60615153788447 27.51937984496124 27.056764191047762 20.817704426106527 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 2.0 25 3.5 26 4.0 27 3.0 28 4.0 29 8.0 30 11.0 31 17.5 32 28.0 33 34.0 34 40.5 35 60.0 36 87.5 37 104.5 38 127.5 39 174.0 40 219.5 41 234.0 42 255.0 43 293.0 44 292.5 45 267.0 46 262.5 47 251.0 48 233.5 49 206.0 50 169.5 51 147.0 52 117.0 53 89.0 54 65.0 55 45.5 56 34.0 57 25.5 58 19.0 59 16.5 60 10.5 61 7.5 62 8.0 63 4.5 64 2.5 65 2.5 66 1.0 67 0.0 68 0.0 69 0.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.1 3 0.125 4 0.125 5 0.075 6 0.1 7 0.05 8 0.05 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.015 55-59 0.02 60-64 0.025 65-69 0.015 70-74 0.03 75-79 0.015 80-84 0.025 85-89 0.005 90-94 0.005 95-99 0.005 100-104 0.04 105-109 0.03 110-114 0.025 115-119 0.034999999999999996 120-124 0.04 125-129 0.01 130-134 0.01 135-139 0.01 140-144 0.03 145-149 0.025 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29328621908127 98.35000000000001 2 0.5805148914689551 1.15 3 0.0757193336698637 0.22499999999999998 4 0.0 0.0 5 0.025239777889954566 0.125 6 0.025239777889954566 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATCAATCTACTTATTTCAAAAATGTCTCCAGCCATTTCTGGTGCACCAT 6 0.15 No Hit AGCAGATCAAGCAAAGCTTAAACACTAATTAATCATGGCAACCAGCTCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.7875 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.0499999999999998 0.0 0.0 0.0 0.0 126-127 1.2625 0.0 0.0 0.0 0.0 128-129 1.425 0.0 0.0 0.0 0.0 130-131 1.5125 0.0 0.0 0.0 0.0 132-133 1.6749999999999998 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 2.075 0.0 0.0 0.0 0.0 138-139 2.2249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra Read 1167956 spots for SRR7030799.sra Written 1167956 spots for SRR7030799.sra Read 1167939 spots for SRR7030799.sra Written 1167939 spots for SRR7030799.sra SRR ids: ['SRR7030799.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bh3ctljw SRR7030799.sra spots: 23358797 blocks: [[1, 1167939], [1167940, 2335878], [2335879, 3503817], [3503818, 4671756], [4671757, 5839695], [5839696, 7007634], [7007635, 8175573], [8175574, 9343512], [9343513, 10511451], [10511452, 11679390], [11679391, 12847329], [12847330, 14015268], [14015269, 15183207], [15183208, 16351146], [16351147, 17519085], [17519086, 18687024], [18687025, 19854963], [19854964, 21022902], [21022903, 22190841], [22190842, 23358797]] SRR7030799 file size 7893829 SRR7030799 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030799 SRR7030799_1.fastq SRR7030799_2.fastq Input file: SRR7030799_1.fastq Paired file: SRR7030799_2.fastq trimmed: SRR7030799-trimmed-pair1.fastq, SRR7030799-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:12:31 2025 >> started Wed Feb 12 18:12:59 2025 >> done (28.385s) 23358797 read pairs processed; of these: 31280 ( 0.13%) short read pairs filtered out after trimming by size control 35718 ( 0.15%) empty read pairs filtered out after trimming by size control 23291799 (99.71%) read pairs available; of these: 9393325 (40.33%) trimmed read pairs available after processing 13898474 (59.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 8 0.00% 20 7 0.00% 21 2 0.00% 22 8 0.00% 23 7 0.00% 24 7 0.00% 25 4 0.00% 26 7 0.00% 27 4 0.00% 28 9 0.00% 29 10 0.00% 30 7 0.00% 31 7 0.00% 32 7 0.00% 33 9 0.00% 34 9 0.00% 35 8 0.00% 36 7 0.00% 37 10 0.00% 38 7 0.00% 39 5 0.00% 40 12 0.00% 41 12 0.00% 42 13 0.00% 43 17 0.00% 44 11 0.00% 45 19 0.00% 46 16 0.00% 47 19 0.00% 48 23 0.00% 49 23 0.00% 50 30 0.00% 51 21 0.00% 52 36 0.00% 53 41 0.00% 54 37 0.00% 55 33 0.00% 56 33 0.00% 57 51 0.00% 58 52 0.00% 59 76 0.00% 60 71 0.00% 61 73 0.00% 62 104 0.00% 63 87 0.00% 64 122 0.00% 65 131 0.00% 66 149 0.00% 67 150 0.00% 68 177 0.00% 69 200 0.00% 70 229 0.00% 71 250 0.00% 72 349 0.00% 73 330 0.00% 74 402 0.00% 75 432 0.00% 76 498 0.00% 77 561 0.00% 78 625 0.00% 79 692 0.00% 80 801 0.00% 81 982 0.00% 82 1105 0.00% 83 1312 0.01% 84 2829 0.01% 85 3634 0.02% 86 3696 0.02% 87 3998 0.02% 88 4247 0.02% 89 4308 0.02% 90 4419 0.02% 91 4502 0.02% 92 4779 0.02% 93 5248 0.02% 94 5444 0.02% 95 5888 0.03% 96 6229 0.03% 97 6369 0.03% 98 6968 0.03% 99 7642 0.03% 100 7400 0.03% 101 7760 0.03% 102 8509 0.04% 103 9136 0.04% 104 9667 0.04% 105 10440 0.04% 106 11088 0.05% 107 11482 0.05% 108 12415 0.05% 109 12932 0.06% 110 13894 0.06% 111 14923 0.06% 112 15986 0.07% 113 17389 0.07% 114 18909 0.08% 115 20141 0.09% 116 21183 0.09% 117 22195 0.10% 118 23332 0.10% 119 23989 0.10% 120 25546 0.11% 121 27581 0.12% 122 29128 0.13% 123 31193 0.13% 124 33811 0.15% 125 35529 0.15% 126 37371 0.16% 127 39175 0.17% 128 41660 0.18% 129 43627 0.19% 130 46783 0.20% 131 49859 0.21% 132 53751 0.23% 133 57849 0.25% 134 62392 0.27% 135 67710 0.29% 136 72969 0.31% 137 78509 0.34% 138 86141 0.37% 139 93948 0.40% 140 102202 0.44% 141 112026 0.48% 142 124549 0.53% 143 143212 0.61% 144 169182 0.73% 145 205805 0.88% 146 264294 1.13% 147 349912 1.50% 148 514644 2.21% 149 1014616 4.36% 150 4994824 21.44% 151 13898474 59.67% 23291799 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=14.76 fanout-score-rank=8 prefix-density=0.34 prefix-fanout=6.9 sequence=TTTCTCAATTTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=106.09 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.0 sequence=AAACAAGAATTTTATTGTTTCCTGTCACACCAAGGCAAACCAAACCAGTCTTCTTTTATGCACCCATACGGATAATACACCTCAGGCCAGCTCCACTAAGCATGTACTCGAAAGCCTTGTTGATTTCTGAGAAAGGGACTTCATGGGTGATGAATTTCTCTAGCTCCAGCTCCTTGTTCATGTACTTCTCGACAACTGAAGGAAGGTCGGAGCGCGGTTTGTAGTT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=31 prefix-density=0.39 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=238.72 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=8.0 sequence=AGAAAAGATAAGCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGGCAAGCTTAGAAAGATCAGCACCAGACCACTTAACATCAAAGATATTGACGTCGGAGAGGGGAGCAGTCCTGTTAATAAGTTTCAGAGGTCCATGACTATGCCAGGAACTCCAGGGACACCGACGACACCAGTGACCCCTACAACCCCAGTGTCGGCGCGTAGCAATGTTTGGAGGAGCGTGTTCCACCCTGGTAGCAACCTTGCTACTAAGAATATTGGTGCTCATGTTTTTGACAAGCCACAGCCTAACACACCCACTGTCTATGACTGGATGTACAGTGGAGAGACGAAGAGCGAGCATCGTTGATGAGGTTGCCTTCAACCAAGGTTGCCC SRR7030799 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:13:43 Started mapping on | Feb 12 18:13:43 Finished on | Feb 12 18:15:54 Mapping speed, Million of reads per hour | 640.08 Number of input reads | 23291799 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 22104415 Uniquely mapped reads % | 94.90% Average mapped length | 296.54 Number of splices: Total | 20323171 Number of splices: Annotated (sjdb) | 19942730 Number of splices: GT/AG | 20009591 Number of splices: GC/AG | 231472 Number of splices: AT/AC | 14031 Number of splices: Non-canonical | 68077 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 650987 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 131006 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.66% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 566798 566798 566798 N_multimapping 650987 650987 650987 N_noFeature 461913 21852184 586149 N_ambiguous 246008 1957 117258 UnstrandedReadsAssigned:21396494 PositiveStrandReadsAssigned:250274 NegativeStrandReadsAssigned:21401008 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030799 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030799-trimmed-pair1.fastq SRR7030799-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,291,799 reads, 21,401,421 reads pseudoaligned [quant] estimated average fragment length: 265.979 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR7030799.ke.tsv 34699 SRR7030799.se.tsv 87100 total ==> SRR7030799.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.02 2031 41.4243 Potri.005G024800.1.v4.1 1035 770.021 1348 62.5921 Potri.004G059700.1.v4.1 961 696.08 24 1.23278 Potri.007G009000.2.v4.1 1416 1151.02 0 0 Potri.003G141000.2.v4.1 2943 2678.02 935 12.4833 Potri.016G087400.1.v4.1 270 66.5241 1538.03 826.643 Potri.015G069301.1.v4.1 564 305.36 0 0 Potri.010G195200.1.v4.1 1773 1508.02 254 6.02225 Potri.012G127500.1.v4.1 977 712.048 27198 1365.72 ==> SRR7030799.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 72 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 30 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 20 SRR7030799 completed mapping pipeline successfully