Starting /dee2/code/volunteer_pipeline.sh SRR7030800 current disk space = 3051390312448 free memory = 1450096232 SRR7030800 SRAfilesize bd051e0b9ad52363fa8825eade82bb2a SRR7030800.sra SRR7030800.sra file validated SRR7030800 is paired end SRR7030800 is conventional basespace SRR7030800 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030800_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.50875 32.0 18.0 33.0 18.0 34.0 2 31.66375 33.0 30.0 34.0 27.0 34.0 3 32.1235 33.0 31.0 34.0 28.0 34.0 4 32.7235 33.0 33.0 34.0 32.0 34.0 5 32.69325 33.0 33.0 34.0 32.0 34.0 6 36.77375 38.0 37.0 38.0 34.0 38.0 7 37.0445 38.0 38.0 38.0 35.0 38.0 8 37.2985 38.0 38.0 38.0 36.0 38.0 9 37.48075 38.0 38.0 38.0 37.0 38.0 10-14 37.519450000000006 38.0 38.0 38.0 37.6 38.0 15-19 37.545100000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.51709999999999 38.0 38.0 38.0 37.4 38.0 25-29 37.49225 38.0 38.0 38.0 37.4 38.0 30-34 37.4309 38.0 38.0 38.0 37.0 38.0 35-39 37.38855 38.0 38.0 38.0 37.0 38.0 40-44 37.2912 38.0 38.0 38.0 37.0 38.0 45-49 37.34955 38.0 38.0 38.0 37.0 38.0 50-54 37.370050000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.29275 38.0 38.0 38.0 36.8 38.0 60-64 37.28475 38.0 38.0 38.0 36.8 38.0 65-69 37.1999 38.0 38.0 38.0 36.4 38.0 70-74 37.14245 38.0 38.0 38.0 36.0 38.0 75-79 37.1056 38.0 38.0 38.0 36.0 38.0 80-84 36.91930000000001 38.0 38.0 38.0 35.6 38.0 85-89 36.898649999999996 38.0 38.0 38.0 35.6 38.0 90-94 36.86055 38.0 38.0 38.0 35.2 38.0 95-99 36.58965 38.0 38.0 38.0 34.4 38.0 100-104 36.619749999999996 38.0 38.0 38.0 34.2 38.0 105-109 36.4928 38.0 38.0 38.0 34.0 38.0 110-114 36.42945 38.0 38.0 38.0 34.0 38.0 115-119 36.224000000000004 38.0 38.0 38.0 33.8 38.0 120-124 36.0407 38.0 37.2 38.0 33.0 38.0 125-129 35.778999999999996 38.0 36.8 38.0 32.2 38.0 130-134 35.38145 38.0 36.0 38.0 31.0 38.0 135-139 35.148250000000004 38.0 35.8 38.0 29.0 38.0 140-144 35.001850000000005 38.0 35.8 38.0 29.4 38.0 145-149 34.4834 38.0 35.0 38.0 27.6 38.0 150-151 31.3425 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 2.0 20 2.0 21 5.0 22 10.0 23 3.0 24 10.0 25 16.0 26 17.0 27 19.0 28 24.0 29 25.0 30 32.0 31 45.0 32 58.0 33 89.0 34 154.0 35 244.0 36 648.0 37 2592.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.258855585831064 13.188010899182562 10.326975476839237 41.22615803814714 2 20.075000000000003 14.099999999999998 35.35 30.475 3 17.45 18.675 27.474999999999998 36.4 4 22.975 25.900000000000002 23.35 27.775 5 22.95369211514393 30.863579474342927 23.979974968710888 22.202753441802255 6 17.9 35.775 25.224999999999998 21.099999999999998 7 15.225 26.35 39.75 18.675 8 18.025 27.725 30.7 23.549999999999997 9 17.0 24.725 34.25 24.025 10-14 20.41 28.77 26.939999999999998 23.880000000000003 15-19 20.015 28.1 27.735 24.15 20-24 19.67 28.465 28.115000000000002 23.75 25-29 19.689999999999998 28.83 27.389999999999997 24.09 30-34 19.59 28.955 27.605 23.849999999999998 35-39 20.244999999999997 28.285 27.365000000000002 24.104999999999997 40-44 20.015 28.134999999999998 27.97 23.880000000000003 45-49 20.36 27.975 27.35 24.315 50-54 20.415 28.410000000000004 27.02 24.154999999999998 55-59 20.345 28.205000000000002 27.305 24.145 60-64 19.91 27.889999999999997 27.515 24.685000000000002 65-69 20.515 28.425 27.08 23.98 70-74 20.895 28.055000000000003 27.284999999999997 23.765 75-79 19.875 28.205000000000002 27.534999999999997 24.385 80-84 20.82 28.560000000000002 26.889999999999997 23.73 85-89 20.54 27.834999999999997 27.415 24.21 90-94 20.465 28.335 27.13 24.07 95-99 20.549999999999997 27.68 27.46 24.310000000000002 100-104 19.98 28.485 27.625 23.91 105-109 20.74 27.87 27.345000000000002 24.044999999999998 110-114 20.41 28.294999999999998 27.315 23.98 115-119 20.815 28.59 26.965 23.630000000000003 120-124 20.880000000000003 28.044999999999998 27.229999999999997 23.845 125-129 21.035 27.61 27.41 23.945 130-134 20.54 28.22 27.200000000000003 24.04 135-139 21.18 28.37 26.919999999999998 23.53 140-144 20.785 28.02 27.029999999999998 24.165 145-149 21.349999999999998 28.34 26.69 23.62 150-151 20.648635111445028 28.312046080641124 26.67167543200601 24.36764337590784 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 1.5 26 4.0 27 6.5 28 10.5 29 15.0 30 17.0 31 24.5 32 35.0 33 41.0 34 46.5 35 69.5 36 85.0 37 88.5 38 117.5 39 152.0 40 165.5 41 189.5 42 216.0 43 232.5 44 253.0 45 277.5 46 284.5 47 263.0 48 246.5 49 226.5 50 198.5 51 155.5 52 127.5 53 115.0 54 86.5 55 64.5 56 53.5 57 41.5 58 26.0 59 16.0 60 12.5 61 8.0 62 7.0 63 5.0 64 1.0 65 3.5 66 3.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.25 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.7875000000000001 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.3250000000000002 0.0 0.0 0.0 0.0 122-123 1.6124999999999998 0.0 0.0 0.0 0.0 124-125 1.7999999999999998 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.275 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.8499999999999996 0.0 0.0 0.0 0.0 134-135 3.15 0.0 0.0 0.0 0.0 136-137 3.5125 0.0 0.0 0.0 0.0 138-139 3.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 0.0035472352 22.382238 1 >>END_MODULE SRR7030800 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030800_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9085 33.0 33.0 34.0 32.0 34.0 2 32.983 33.0 33.0 34.0 32.0 34.0 3 32.99325 34.0 33.0 34.0 32.0 34.0 4 32.97625 34.0 33.0 34.0 32.0 34.0 5 32.99425 34.0 33.0 34.0 32.0 34.0 6 37.233 38.0 38.0 38.0 37.0 38.0 7 37.2975 38.0 38.0 38.0 37.0 38.0 8 37.24225 38.0 38.0 38.0 37.0 38.0 9 37.25825 38.0 38.0 38.0 37.0 38.0 10-14 37.233 38.0 38.0 38.0 37.0 38.0 15-19 37.1958 38.0 38.0 38.0 37.0 38.0 20-24 37.202200000000005 38.0 38.0 38.0 36.8 38.0 25-29 37.14104999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.1114 38.0 38.0 38.0 36.8 38.0 35-39 37.0812 38.0 38.0 38.0 36.4 38.0 40-44 36.9559 38.0 38.0 38.0 36.2 38.0 45-49 36.753 38.0 38.0 38.0 35.4 38.0 50-54 36.96795 38.0 38.0 38.0 36.0 38.0 55-59 36.89705 38.0 38.0 38.0 36.0 38.0 60-64 36.8295 38.0 38.0 38.0 35.8 38.0 65-69 36.75975 38.0 38.0 38.0 35.2 38.0 70-74 36.713 38.0 38.0 38.0 35.2 38.0 75-79 36.6554 38.0 38.0 38.0 35.0 38.0 80-84 36.54195 38.0 38.0 38.0 34.4 38.0 85-89 36.50005 38.0 38.0 38.0 34.4 38.0 90-94 36.361549999999994 38.0 38.0 38.0 34.0 38.0 95-99 36.295100000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.147149999999996 38.0 37.6 38.0 33.6 38.0 105-109 35.919149999999995 38.0 37.2 38.0 32.6 38.0 110-114 35.7315 38.0 37.0 38.0 31.6 38.0 115-119 35.523300000000006 38.0 36.8 38.0 30.4 38.0 120-124 35.463699999999996 38.0 36.6 38.0 31.0 38.0 125-129 35.07415 38.0 36.0 38.0 28.6 38.0 130-134 34.7893 38.0 35.0 38.0 27.8 38.0 135-139 34.61175 38.0 35.2 38.0 27.4 38.0 140-144 34.17575 38.0 35.0 38.0 24.8 38.0 145-149 33.5179 38.0 34.6 38.0 20.2 38.0 150-151 29.550375000000003 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 2.0 6 1.0 7 2.0 8 3.0 9 2.0 10 3.0 11 0.0 12 1.0 13 2.0 14 1.0 15 1.0 16 1.0 17 2.0 18 3.0 19 9.0 20 5.0 21 10.0 22 10.0 23 5.0 24 12.0 25 21.0 26 25.0 27 36.0 28 21.0 29 27.0 30 48.0 31 49.0 32 79.0 33 94.0 34 159.0 35 279.0 36 627.0 37 2454.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.849999999999994 20.225 14.099999999999998 30.825000000000003 2 25.04378283712785 26.169627220415308 31.523642732049034 17.262947210407805 3 19.809904952476238 28.264132066033014 31.44072036018009 20.485242621310658 4 24.062031015507753 33.74187093546773 23.06153076538269 19.13456728364182 5 24.675 34.8 22.2 18.325 6 19.344344344344343 39.56456456456456 22.347347347347345 18.743743743743742 7 19.594594594594593 22.67267267267267 37.73773773773774 19.994994994994993 8 22.692019014260694 25.21891418563923 27.970978233675257 24.11808856642482 9 21.56617463097323 24.91868901676257 30.92319239429572 22.59194395796848 10-14 23.186593296648326 28.76438219109555 26.91345672836418 21.135567783891947 15-19 22.98189456837051 28.14344303290987 27.70831249374812 21.16634990497149 20-24 22.685671417854465 28.60715178794699 27.49187296824206 21.21530382595649 25-29 23.131939581874562 28.088426527958386 27.72331699509853 21.05631689506852 30-34 22.689537907581517 28.360672134426885 27.785557111422282 21.164232846569313 35-39 22.79 28.294999999999998 27.474999999999998 21.44 40-44 23.405 28.384999999999998 27.665 20.544999999999998 45-49 23.03 28.025 28.07 20.875 50-54 23.243486522978447 28.32924938740811 27.32409861479222 21.10316547482122 55-59 23.732119635890765 27.87336200860258 27.648294488346504 20.74622386716015 60-64 23.195798949737434 27.746936734183546 28.037009252313077 21.02025506376594 65-69 23.82572157470862 27.357310789855433 28.257715972187487 20.559251663248464 70-74 23.406703351675837 27.813906953476735 27.583791895947975 21.19559779889945 75-79 23.54795137325529 27.36004802641453 28.015408474661065 21.07659212566912 80-84 23.927178153446032 28.008402520756228 27.29818945683705 20.76622986896069 85-89 23.762376237623762 27.567756775677566 28.082808280828083 20.587058705870586 90-94 23.838575786367954 28.10921638245737 27.754163124468672 20.298044706706005 95-99 23.83834342019707 27.9697894262992 27.25453908868104 20.937328064822687 100-104 24.057028514257127 27.85892946473237 27.658829414707352 20.425212606303152 105-109 23.664465786314526 27.78111244497799 27.571028411364544 20.983393357342937 110-114 24.24484896979396 27.58551710342068 27.285457091418287 20.884176835367075 115-119 24.816167275273873 27.682457105697566 27.42234005302386 20.079035566004702 120-124 24.314725890356144 27.82112845138055 27.66106442577031 20.203081232493 125-129 24.67987194877951 27.886154461784713 26.98579431772709 20.448179271708682 130-134 24.24484896979396 27.950590118023605 27.425485097019404 20.379075815163034 135-139 24.645 27.54 27.51 20.305 140-144 24.959999999999997 28.310000000000002 27.05 19.68 145-149 25.132513251325133 28.05780578057806 27.04270427042704 19.766976697669765 150-151 24.9 27.9375 27.1625 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 3.0 26 3.0 27 3.5 28 5.0 29 6.5 30 8.5 31 15.5 32 23.0 33 31.5 34 47.5 35 68.0 36 88.5 37 103.5 38 121.5 39 150.5 40 197.0 41 241.0 42 259.5 43 264.0 44 275.5 45 280.5 46 263.5 47 260.5 48 242.5 49 217.5 50 185.5 51 141.0 52 121.5 53 88.5 54 65.0 55 59.5 56 44.5 57 34.0 58 22.0 59 13.0 60 15.5 61 11.5 62 6.0 63 3.5 64 1.5 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.05 4 0.05 5 0.0 6 0.1 7 0.1 8 0.075 9 0.075 10-14 0.05 15-19 0.03 20-24 0.025 25-29 0.03 30-34 0.02 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.015 55-59 0.03 60-64 0.025 65-69 0.045 70-74 0.05 75-79 0.055 80-84 0.03 85-89 0.01 90-94 0.015 95-99 0.034999999999999996 100-104 0.05 105-109 0.04 110-114 0.02 115-119 0.045 120-124 0.04 125-129 0.04 130-134 0.02 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34525308486528 98.625 2 0.6043817678166709 1.2 3 0.02518257365902795 0.075 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.7875000000000001 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.6375000000000002 0.0 0.0 0.0 0.0 124-125 1.8250000000000002 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.275 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.8375 0.0 0.0 0.0 0.0 134-135 3.15 0.0 0.0 0.0 0.0 136-137 3.5125 0.0 0.0 0.0 0.0 138-139 3.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAAGC 10 0.006830828 145.0 5 >>END_MODULE Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra Read 1117135 spots for SRR7030800.sra Written 1117135 spots for SRR7030800.sra SRR ids: ['SRR7030800.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6w3e61ij SRR7030800.sra spots: 22342700 blocks: [[1, 1117135], [1117136, 2234270], [2234271, 3351405], [3351406, 4468540], [4468541, 5585675], [5585676, 6702810], [6702811, 7819945], [7819946, 8937080], [8937081, 10054215], [10054216, 11171350], [11171351, 12288485], [12288486, 13405620], [13405621, 14522755], [14522756, 15639890], [15639891, 16757025], [16757026, 17874160], [17874161, 18991295], [18991296, 20108430], [20108431, 21225565], [21225566, 22342700]] SRR7030800 file size 7549507 SRR7030800 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030800 SRR7030800_1.fastq SRR7030800_2.fastq Input file: SRR7030800_1.fastq Paired file: SRR7030800_2.fastq trimmed: SRR7030800-trimmed-pair1.fastq, SRR7030800-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:22:29 2025 >> started Wed Feb 12 18:22:55 2025 >> done (26.098s) 22342700 read pairs processed; of these: 24137 ( 0.11%) short read pairs filtered out after trimming by size control 14564 ( 0.07%) empty read pairs filtered out after trimming by size control 22303999 (99.83%) read pairs available; of these: 8823729 (39.56%) trimmed read pairs available after processing 13480270 (60.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 5 0.00% 21 4 0.00% 22 4 0.00% 23 3 0.00% 24 3 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 2 0.00% 29 3 0.00% 30 2 0.00% 31 5 0.00% 32 2 0.00% 33 5 0.00% 34 1 0.00% 35 11 0.00% 36 6 0.00% 37 3 0.00% 38 2 0.00% 39 7 0.00% 40 7 0.00% 41 11 0.00% 42 8 0.00% 43 10 0.00% 44 4 0.00% 45 9 0.00% 46 15 0.00% 47 13 0.00% 48 11 0.00% 49 11 0.00% 50 23 0.00% 51 22 0.00% 52 35 0.00% 53 26 0.00% 54 29 0.00% 55 25 0.00% 56 27 0.00% 57 43 0.00% 58 40 0.00% 59 61 0.00% 60 74 0.00% 61 60 0.00% 62 80 0.00% 63 97 0.00% 64 100 0.00% 65 115 0.00% 66 130 0.00% 67 148 0.00% 68 170 0.00% 69 217 0.00% 70 247 0.00% 71 262 0.00% 72 319 0.00% 73 356 0.00% 74 423 0.00% 75 485 0.00% 76 535 0.00% 77 634 0.00% 78 664 0.00% 79 750 0.00% 80 910 0.00% 81 984 0.00% 82 1239 0.01% 83 1475 0.01% 84 2172 0.01% 85 2727 0.01% 86 2948 0.01% 87 3341 0.01% 88 3526 0.02% 89 3763 0.02% 90 4094 0.02% 91 4352 0.02% 92 4727 0.02% 93 5126 0.02% 94 5645 0.03% 95 6003 0.03% 96 6693 0.03% 97 6851 0.03% 98 7562 0.03% 99 8510 0.04% 100 8706 0.04% 101 9000 0.04% 102 9812 0.04% 103 10754 0.05% 104 11396 0.05% 105 12269 0.06% 106 13262 0.06% 107 13860 0.06% 108 14389 0.06% 109 15706 0.07% 110 16258 0.07% 111 17549 0.08% 112 19189 0.09% 113 20388 0.09% 114 21553 0.10% 115 23182 0.10% 116 24657 0.11% 117 25854 0.12% 118 26999 0.12% 119 28140 0.13% 120 28873 0.13% 121 30734 0.14% 122 32550 0.15% 123 34399 0.15% 124 36938 0.17% 125 38387 0.17% 126 40778 0.18% 127 42473 0.19% 128 45203 0.20% 129 47370 0.21% 130 49596 0.22% 131 52053 0.23% 132 55015 0.25% 133 58311 0.26% 134 62361 0.28% 135 66058 0.30% 136 71424 0.32% 137 76260 0.34% 138 82443 0.37% 139 89329 0.40% 140 94699 0.42% 141 100939 0.45% 142 111824 0.50% 143 125600 0.56% 144 145417 0.65% 145 173955 0.78% 146 216891 0.97% 147 292914 1.31% 148 441627 1.98% 149 889860 3.99% 150 4757495 21.33% 151 13480270 60.44% 22303999 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=21 prefix-density=0.41 prefix-fanout=2.7 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=76.71 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=2.6 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGA criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=36 prefix-density=0.55 prefix-fanout=2.0 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=30 fanout-score=167.82 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=24.0 sequence=CAAAGAAGAAAAACAGTTTCTCAAGAGCAGTATATATAGATCTTTCAGAAGAATTAAGGAGATGGCAGACGAGGGAACAGCTACTTGCATAGACATCTTGTTGGCCATCATCTTGCCTCCGCTTGGTGTCTTCCTCAAGTT SRR7030800 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:23:40 Started mapping on | Feb 12 18:23:40 Finished on | Feb 12 18:25:41 Mapping speed, Million of reads per hour | 663.59 Number of input reads | 22303999 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 21346462 Uniquely mapped reads % | 95.71% Average mapped length | 296.41 Number of splices: Total | 19404690 Number of splices: Annotated (sjdb) | 19099894 Number of splices: GT/AG | 19098218 Number of splices: GC/AG | 240999 Number of splices: AT/AC | 14314 Number of splices: Non-canonical | 51159 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 680657 % of reads mapped to multiple loci | 3.05% Number of reads mapped to too many loci | 67640 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.89% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 291216 291216 291216 N_multimapping 680657 680657 680657 N_noFeature 301191 21117554 403726 N_ambiguous 220342 1174 93366 UnstrandedReadsAssigned:20824929 PositiveStrandReadsAssigned:227734 NegativeStrandReadsAssigned:20849370 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030800 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030800-trimmed-pair1.fastq SRR7030800-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,303,999 reads, 20,902,395 reads pseudoaligned [quant] estimated average fragment length: 243.502 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR7030800.ke.tsv 34699 SRR7030800.se.tsv 87100 total ==> SRR7030800.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.5 1897 32.8808 Potri.005G024800.1.v4.1 1035 792.498 3552 137.934 Potri.004G059700.1.v4.1 961 718.52 25 1.07077 Potri.007G009000.2.v4.1 1416 1173.5 0 0 Potri.003G141000.2.v4.1 2943 2700.5 849 9.67519 Potri.016G087400.1.v4.1 270 73.0041 2129.16 897.547 Potri.015G069301.1.v4.1 564 324.747 0 0 Potri.010G195200.1.v4.1 1773 1530.5 106 2.13142 Potri.012G127500.1.v4.1 977 734.515 6232 261.109 ==> SRR7030800.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 333 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 31 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 44 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7030800 completed mapping pipeline successfully