Starting /dee2/code/volunteer_pipeline.sh SRR7030801 current disk space = 3051155271680 free memory = 1580404028 SRR7030801 SRAfilesize dd35f44ecfa3f5e6d6f82b9fe8d4a9e6 SRR7030801.sra SRR7030801.sra file validated SRR7030801 is paired end SRR7030801 is conventional basespace SRR7030801 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030801_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.82 33.0 32.0 33.0 28.0 33.0 2 28.0315 31.0 25.0 33.0 18.0 33.0 3 30.317 31.0 29.0 33.0 27.0 33.0 4 29.81675 32.0 30.0 33.0 25.0 33.0 5 31.8785 33.0 32.0 33.0 31.0 33.0 6 36.42175 38.0 36.0 38.0 34.0 38.0 7 36.918 38.0 37.0 38.0 35.0 38.0 8 37.34425 38.0 38.0 38.0 36.0 38.0 9 37.48325 38.0 38.0 38.0 37.0 38.0 10-14 37.6178 38.0 38.0 38.0 38.0 38.0 15-19 37.61805 38.0 38.0 38.0 38.0 38.0 20-24 37.60595 38.0 38.0 38.0 38.0 38.0 25-29 37.544700000000006 38.0 38.0 38.0 37.8 38.0 30-34 37.44645 38.0 38.0 38.0 37.0 38.0 35-39 37.5009 38.0 38.0 38.0 37.4 38.0 40-44 37.455349999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.42985 38.0 38.0 38.0 37.0 38.0 50-54 37.35855 38.0 38.0 38.0 37.0 38.0 55-59 37.36245 38.0 38.0 38.0 37.0 38.0 60-64 37.27815 38.0 38.0 38.0 36.8 38.0 65-69 37.20035 38.0 38.0 38.0 36.0 38.0 70-74 37.174850000000006 38.0 38.0 38.0 36.0 38.0 75-79 37.0518 38.0 38.0 38.0 36.0 38.0 80-84 37.009699999999995 38.0 38.0 38.0 35.8 38.0 85-89 36.91065 38.0 38.0 38.0 35.4 38.0 90-94 36.8514 38.0 38.0 38.0 35.4 38.0 95-99 36.8056 38.0 38.0 38.0 35.0 38.0 100-104 36.55345 38.0 38.0 38.0 34.0 38.0 105-109 36.5398 38.0 38.0 38.0 34.0 38.0 110-114 36.4755 38.0 38.0 38.0 34.0 38.0 115-119 36.2885 38.0 37.2 38.0 33.8 38.0 120-124 36.0652 38.0 37.0 38.0 33.2 38.0 125-129 35.802749999999996 38.0 36.8 38.0 32.2 38.0 130-134 35.5572 38.0 36.2 38.0 31.0 38.0 135-139 35.33455 38.0 36.0 38.0 31.0 38.0 140-144 35.2455 38.0 36.0 38.0 31.0 38.0 145-149 34.725199999999994 38.0 35.6 38.0 28.6 38.0 150-151 31.430749999999996 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 0.0 18 1.0 19 1.0 20 7.0 21 2.0 22 4.0 23 6.0 24 10.0 25 9.0 26 7.0 27 14.0 28 24.0 29 29.0 30 34.0 31 48.0 32 54.0 33 86.0 34 146.0 35 269.0 36 668.0 37 2578.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.488824612148306 11.596108335524585 7.941099132264003 32.97396792006311 2 24.025 13.8 32.550000000000004 29.625 3 18.925 20.225 29.125 31.724999999999998 4 22.55 28.725 24.525 24.2 5 23.125 31.45 24.025 21.4 6 19.950000000000003 35.175 24.2 20.674999999999997 7 14.399999999999999 24.875 42.725 18.0 8 18.625 24.85 31.525 25.0 9 16.975 24.2 34.35 24.474999999999998 10-14 20.205000000000002 29.085 26.985 23.724999999999998 15-19 20.305 28.499999999999996 27.415 23.78 20-24 20.095 29.085 27.42 23.400000000000002 25-29 20.145 28.54 27.73 23.585 30-34 20.06 27.439999999999998 29.080000000000002 23.419999999999998 35-39 20.265 27.955000000000002 27.765 24.015 40-44 20.435 28.794999999999998 27.310000000000002 23.46 45-49 20.695 28.449999999999996 27.18 23.674999999999997 50-54 20.21 28.125 27.76 23.905 55-59 20.275000000000002 28.005000000000003 27.62 24.099999999999998 60-64 20.14 28.43 27.725 23.705000000000002 65-69 20.565 28.005000000000003 27.825 23.605 70-74 20.055 28.88 27.54 23.525 75-79 19.875 28.225 27.715 24.185000000000002 80-84 20.424999999999997 27.865000000000002 28.005000000000003 23.705000000000002 85-89 20.115 28.27 28.09 23.525 90-94 20.43 27.785 27.700000000000003 24.085 95-99 21.32 27.655 27.860000000000003 23.165 100-104 21.27 27.565 27.46 23.705000000000002 105-109 20.935000000000002 28.244999999999997 27.415 23.405 110-114 20.580000000000002 28.115000000000002 28.055000000000003 23.25 115-119 20.895 27.435 28.475 23.195 120-124 20.424999999999997 27.560000000000002 28.235 23.78 125-129 20.979999999999997 27.675 27.505000000000003 23.84 130-134 21.345 27.400000000000002 27.375 23.880000000000003 135-139 20.724999999999998 28.115000000000002 27.439999999999998 23.72 140-144 20.979999999999997 27.705000000000002 27.265 24.05 145-149 21.33 27.575 27.855 23.24 150-151 20.815101887735967 27.703462932866607 27.21590198774847 24.265533191648956 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.5 24 1.5 25 3.5 26 3.5 27 6.5 28 9.5 29 10.5 30 13.5 31 20.0 32 31.5 33 48.5 34 53.0 35 55.0 36 74.5 37 90.0 38 116.0 39 161.5 40 198.5 41 213.5 42 236.0 43 262.0 44 273.0 45 272.0 46 277.0 47 260.5 48 240.5 49 225.5 50 174.0 51 140.5 52 124.0 53 92.5 54 70.5 55 64.0 56 48.0 57 32.5 58 25.0 59 16.5 60 13.5 61 12.0 62 8.5 63 6.0 64 3.0 65 1.5 66 1.0 67 1.5 68 1.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.7875 0.0 0.0 0.0 0.0 128-129 1.0625 0.0 0.0 0.0 0.0 130-131 1.2625000000000002 0.0 0.0 0.0 0.0 132-133 1.35 0.0 0.0 0.0 0.0 134-135 1.4625 0.0 0.0 0.0 0.0 136-137 1.65 0.0 0.0 0.0 0.0 138-139 1.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030801 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030801_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83275 33.0 33.0 34.0 32.0 34.0 2 32.90275 33.0 33.0 34.0 32.0 34.0 3 32.89325 34.0 33.0 34.0 32.0 34.0 4 32.87325 34.0 33.0 34.0 32.0 34.0 5 32.813 34.0 33.0 34.0 32.0 34.0 6 37.05775 38.0 38.0 38.0 37.0 38.0 7 37.12825 38.0 38.0 38.0 37.0 38.0 8 37.17325 38.0 38.0 38.0 37.0 38.0 9 37.15825 38.0 38.0 38.0 37.0 38.0 10-14 37.12015 38.0 38.0 38.0 36.8 38.0 15-19 37.072250000000004 38.0 38.0 38.0 36.2 38.0 20-24 37.09864999999999 38.0 38.0 38.0 36.8 38.0 25-29 37.0445 38.0 38.0 38.0 36.6 38.0 30-34 37.071299999999994 38.0 38.0 38.0 36.8 38.0 35-39 36.87325 38.0 38.0 38.0 36.0 38.0 40-44 36.79145 38.0 38.0 38.0 35.8 38.0 45-49 36.678999999999995 38.0 38.0 38.0 35.0 38.0 50-54 36.735150000000004 38.0 38.0 38.0 35.6 38.0 55-59 36.72670000000001 38.0 38.0 38.0 35.2 38.0 60-64 36.718 38.0 38.0 38.0 35.2 38.0 65-69 36.6529 38.0 38.0 38.0 35.0 38.0 70-74 36.631099999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.5678 38.0 38.0 38.0 34.8 38.0 80-84 36.4872 38.0 38.0 38.0 34.2 38.0 85-89 36.2325 38.0 38.0 38.0 33.4 38.0 90-94 36.28855 38.0 38.0 38.0 34.0 38.0 95-99 36.1043 38.0 38.0 38.0 33.2 38.0 100-104 35.80135 38.0 37.0 38.0 32.2 38.0 105-109 35.662 38.0 37.0 38.0 30.6 38.0 110-114 35.610400000000006 38.0 37.0 38.0 31.0 38.0 115-119 35.26305 38.0 36.4 38.0 29.2 38.0 120-124 35.209 38.0 36.0 38.0 29.2 38.0 125-129 34.9283 38.0 36.0 38.0 27.8 38.0 130-134 34.38955 38.0 35.0 38.0 25.0 38.0 135-139 34.213800000000006 38.0 35.0 38.0 23.6 38.0 140-144 33.6859 38.0 34.4 38.0 21.8 38.0 145-149 33.12185 38.0 33.8 38.0 18.0 38.0 150-151 29.491125 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 3.0 5 1.0 6 3.0 7 1.0 8 0.0 9 2.0 10 1.0 11 0.0 12 1.0 13 1.0 14 1.0 15 3.0 16 7.0 17 2.0 18 5.0 19 8.0 20 7.0 21 10.0 22 9.0 23 10.0 24 20.0 25 18.0 26 19.0 27 21.0 28 29.0 29 37.0 30 61.0 31 46.0 32 95.0 33 115.0 34 154.0 35 290.0 36 694.0 37 2315.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.785446361590395 21.655413853463365 11.552888222055515 25.006251562890725 2 28.72872872872873 24.6996996996997 29.37937937937938 17.192192192192195 3 20.801001251564454 26.633291614518146 32.3153942428035 20.250312891113893 4 22.52252252252252 34.30930930930931 24.124124124124123 19.044044044044046 5 24.656164041010253 36.384096024006 21.030257564391096 17.92948237059265 6 21.7 38.875 21.349999999999998 18.075 7 20.325 23.1 37.025000000000006 19.55 8 21.7 26.375 26.275 25.650000000000002 9 20.8 26.224999999999998 28.675 24.3 10-14 22.7 29.13 26.745 21.425 15-19 22.525000000000002 28.59 27.37 21.515 20-24 21.795 29.04 27.705000000000002 21.46 25-29 22.58 28.37 28.060000000000002 20.990000000000002 30-34 22.31 28.000000000000004 28.115000000000002 21.575 35-39 22.88 28.315 27.465 21.34 40-44 23.064999999999998 28.494999999999997 27.74 20.7 45-49 22.884999999999998 28.599999999999998 27.73 20.785 50-54 23.080000000000002 28.42 27.55 20.95 55-59 22.975 28.685 27.18 21.16 60-64 22.869999999999997 28.075 28.249999999999996 20.805 65-69 22.97 27.855 27.900000000000002 21.275 70-74 23.055 28.02 27.715 21.21 75-79 22.835 27.915 27.615000000000002 21.634999999999998 80-84 22.900000000000002 27.855 28.095 21.15 85-89 22.865 28.410000000000004 27.32 21.404999999999998 90-94 23.365 28.105000000000004 27.21 21.32 95-99 23.25 27.794999999999998 27.6 21.355 100-104 23.585 28.035 27.345000000000002 21.035 105-109 23.355 27.76 27.884999999999998 21.0 110-114 22.735 27.900000000000002 27.779999999999998 21.584999999999997 115-119 23.075000000000003 28.57 27.474999999999998 20.880000000000003 120-124 23.325000000000003 28.95 26.985 20.74 125-129 24.12 27.775 27.265 20.84 130-134 24.085 27.655 27.584999999999997 20.674999999999997 135-139 23.49 28.025 27.445000000000004 21.04 140-144 23.815 27.589999999999996 27.655 20.94 145-149 23.73 27.725 27.785 20.76 150-151 24.0 27.9375 27.375 20.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 0.5 23 1.0 24 2.0 25 3.0 26 4.5 27 4.0 28 4.5 29 8.0 30 14.0 31 17.5 32 21.0 33 31.0 34 42.5 35 50.0 36 80.0 37 108.5 38 137.0 39 165.5 40 197.0 41 235.0 42 254.0 43 289.0 44 298.0 45 288.5 46 281.0 47 254.5 48 235.5 49 203.5 50 163.5 51 137.5 52 104.0 53 82.5 54 70.5 55 53.5 56 38.0 57 31.5 58 27.0 59 19.5 60 12.5 61 8.5 62 7.0 63 3.0 64 2.5 65 1.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.1 3 0.125 4 0.1 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.7125 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.3125 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.5125000000000002 0.0 0.0 0.0 0.0 136-137 1.7125 0.0 0.0 0.0 0.0 138-139 1.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906907 spots for SRR7030801.sra Written 906907 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra Read 906903 spots for SRR7030801.sra Written 906903 spots for SRR7030801.sra SRR ids: ['SRR7030801.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ldr1rl9h SRR7030801.sra spots: 18138064 blocks: [[1, 906903], [906904, 1813806], [1813807, 2720709], [2720710, 3627612], [3627613, 4534515], [4534516, 5441418], [5441419, 6348321], [6348322, 7255224], [7255225, 8162127], [8162128, 9069030], [9069031, 9975933], [9975934, 10882836], [10882837, 11789739], [11789740, 12696642], [12696643, 13603545], [13603546, 14510448], [14510449, 15417351], [15417352, 16324254], [16324255, 17231157], [17231158, 18138064]] SRR7030801 file size 6124694 SRR7030801 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030801 SRR7030801_1.fastq SRR7030801_2.fastq Input file: SRR7030801_1.fastq Paired file: SRR7030801_2.fastq trimmed: SRR7030801-trimmed-pair1.fastq, SRR7030801-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:03:32 2025 >> started Wed Feb 12 19:03:53 2025 >> done (20.421s) 18138064 read pairs processed; of these: 17738 ( 0.10%) short read pairs filtered out after trimming by size control 14047 ( 0.08%) empty read pairs filtered out after trimming by size control 18106279 (99.82%) read pairs available; of these: 6662285 (36.80%) trimmed read pairs available after processing 11443994 (63.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 6 0.00% 21 4 0.00% 22 5 0.00% 23 6 0.00% 24 3 0.00% 25 3 0.00% 26 7 0.00% 27 4 0.00% 28 2 0.00% 29 8 0.00% 30 6 0.00% 31 7 0.00% 32 5 0.00% 33 5 0.00% 34 6 0.00% 35 7 0.00% 36 2 0.00% 37 5 0.00% 38 8 0.00% 39 12 0.00% 40 7 0.00% 41 5 0.00% 42 10 0.00% 43 9 0.00% 44 10 0.00% 45 4 0.00% 46 6 0.00% 47 7 0.00% 48 18 0.00% 49 11 0.00% 50 17 0.00% 51 20 0.00% 52 19 0.00% 53 15 0.00% 54 31 0.00% 55 22 0.00% 56 19 0.00% 57 40 0.00% 58 45 0.00% 59 41 0.00% 60 47 0.00% 61 51 0.00% 62 76 0.00% 63 65 0.00% 64 70 0.00% 65 78 0.00% 66 91 0.00% 67 94 0.00% 68 100 0.00% 69 144 0.00% 70 165 0.00% 71 166 0.00% 72 187 0.00% 73 179 0.00% 74 248 0.00% 75 256 0.00% 76 324 0.00% 77 328 0.00% 78 391 0.00% 79 467 0.00% 80 475 0.00% 81 608 0.00% 82 727 0.00% 83 792 0.00% 84 1778 0.01% 85 2313 0.01% 86 2489 0.01% 87 2561 0.01% 88 2800 0.02% 89 2787 0.02% 90 2978 0.02% 91 3055 0.02% 92 3273 0.02% 93 3421 0.02% 94 3596 0.02% 95 3831 0.02% 96 4116 0.02% 97 4169 0.02% 98 4463 0.02% 99 4574 0.03% 100 4979 0.03% 101 5212 0.03% 102 5755 0.03% 103 6184 0.03% 104 6598 0.04% 105 6985 0.04% 106 7598 0.04% 107 7716 0.04% 108 8270 0.05% 109 8808 0.05% 110 9307 0.05% 111 10009 0.06% 112 10867 0.06% 113 11628 0.06% 114 12406 0.07% 115 13205 0.07% 116 14179 0.08% 117 14793 0.08% 118 15461 0.09% 119 15871 0.09% 120 16906 0.09% 121 17807 0.10% 122 18993 0.10% 123 19690 0.11% 124 21342 0.12% 125 21941 0.12% 126 23578 0.13% 127 25031 0.14% 128 26588 0.15% 129 27941 0.15% 130 29528 0.16% 131 31095 0.17% 132 33301 0.18% 133 36258 0.20% 134 38506 0.21% 135 41570 0.23% 136 44585 0.25% 137 48230 0.27% 138 53239 0.29% 139 57483 0.32% 140 62070 0.34% 141 67746 0.37% 142 75259 0.42% 143 87258 0.48% 144 102478 0.57% 145 125354 0.69% 146 160108 0.88% 147 220621 1.22% 148 348057 1.92% 149 691625 3.82% 150 3833459 21.17% 151 11443994 63.20% 18106279 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=39 prefix-density=0.21 prefix-fanout=2.3 sequence=GTGGACTCCTTCTGGATGTTGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=125.43 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.7 sequence=TTCCAAACTTCGCACATCATCTAAAGCCTTGTACTCGTAAACCACAAAATCGAAAAAAAAGCGCCTCAATTCATCATCTCCATGCTTCAGCTTCAAGCTTGAGTTTTGGCCATGTGAGCTATCAAGTCAATCACGCGTGAACTGTAGCCCCATTCATTGTCATACCAAGAGACAAGTTTGACGAAGTTATCGTTCAAGGCAATTCCAGCCTTGGCATCGAATATGCTTGACCTGCTGTCACCAATGAAGTCAGTAGACACCACATCCTCTTCAACGTAACCCAGAATACCCTTGAGGTTATTCTCAGACTCCTCCTTGATAGCAGATTTGATAGCCTCGTATGTTGCCTTCTTCTCAAGCCTGACAGTGAGGTCAACAACAGAGACATCCACAGTAGGAACACGGAAGGACATTCCAGTCAATTTTCCATTAAGTGCTGGCAGAACCTTTCCAACAGCCTTGGCAGCCCCAGTGCTGCTAGGAATGATATTGAAGGA criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=29 prefix-density=0.54 prefix-fanout=1.8 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=233.49 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=24.7 sequence=CAAAGAAGAAAAACAGTTTCTCAAGAGCAGTATATATAGATCTTTCAGAAGAATTAAGGAGATGGCAGACGAGGGAACAGCTACTTGCATAGACATCTTGTTGGCCATCATCTTGCCTCCGCTTGGTGTCTTCCTCAAGTT SRR7030801 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:05:09 Started mapping on | Feb 12 19:05:09 Finished on | Feb 12 19:06:39 Mapping speed, Million of reads per hour | 724.25 Number of input reads | 18106279 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17237476 Uniquely mapped reads % | 95.20% Average mapped length | 297.33 Number of splices: Total | 16492073 Number of splices: Annotated (sjdb) | 16231744 Number of splices: GT/AG | 16219711 Number of splices: GC/AG | 218118 Number of splices: AT/AC | 10511 Number of splices: Non-canonical | 43733 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 509623 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 39144 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.73% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 378626 378626 378626 N_multimapping 509623 509623 509623 N_noFeature 305136 17059527 382458 N_ambiguous 190024 1221 88812 UnstrandedReadsAssigned:16742316 PositiveStrandReadsAssigned:176728 NegativeStrandReadsAssigned:16766206 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030801 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030801-trimmed-pair1.fastq SRR7030801-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,106,279 reads, 16,694,744 reads pseudoaligned [quant] estimated average fragment length: 268.981 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,113 rounds 52401 SRR7030801.ke.tsv 34699 SRR7030801.se.tsv 87100 total ==> SRR7030801.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.02 2533 67.1512 Potri.005G024800.1.v4.1 1035 767.019 1518 91.8179 Potri.004G059700.1.v4.1 961 693.041 21 1.40579 Potri.007G009000.2.v4.1 1416 1148.02 0 0 Potri.003G141000.2.v4.1 2943 2675.02 626 10.857 Potri.016G087400.1.v4.1 270 64.5835 1083.69 778.474 Potri.015G069301.1.v4.1 564 301.468 0 0 Potri.010G195200.1.v4.1 1773 1505.02 298 9.1862 Potri.012G127500.1.v4.1 977 709.024 10425 682.145 ==> SRR7030801.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 85 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 205 Potri.001G212900.v4.1 40 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 159 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7030801 completed mapping pipeline successfully