Starting /dee2/code/volunteer_pipeline.sh SRR7030802 current disk space = 3051119349760 free memory = 1572395620 SRR7030802 SRAfilesize 3b8a119993060bd3b9b14d7f2fb4a863 SRR7030802.sra SRR7030802.sra file validated SRR7030802 is paired end SRR7030802 is conventional basespace SRR7030802 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030802_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.707 33.0 33.0 34.0 28.0 34.0 2 32.5275 33.0 33.0 34.0 28.0 34.0 3 32.82525 34.0 33.0 34.0 30.0 34.0 4 31.873 33.0 31.0 33.0 29.0 34.0 5 32.43475 33.0 33.0 33.0 31.0 34.0 6 36.64875 38.0 37.0 38.0 34.0 38.0 7 37.20175 38.0 38.0 38.0 36.0 38.0 8 37.308 38.0 38.0 38.0 37.0 38.0 9 37.55125 38.0 38.0 38.0 37.0 38.0 10-14 37.529349999999994 38.0 38.0 38.0 37.6 38.0 15-19 37.54560000000001 38.0 38.0 38.0 37.8 38.0 20-24 37.49865 38.0 38.0 38.0 37.0 38.0 25-29 37.50410000000001 38.0 38.0 38.0 37.2 38.0 30-34 37.41395 38.0 38.0 38.0 37.0 38.0 35-39 37.466950000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.43655 38.0 38.0 38.0 37.2 38.0 45-49 37.35455 38.0 38.0 38.0 37.0 38.0 50-54 37.36325 38.0 38.0 38.0 37.0 38.0 55-59 37.34865 38.0 38.0 38.0 37.0 38.0 60-64 37.30735 38.0 38.0 38.0 37.0 38.0 65-69 37.1711 38.0 38.0 38.0 36.4 38.0 70-74 37.15689999999999 38.0 38.0 38.0 36.0 38.0 75-79 37.150800000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.045249999999996 38.0 38.0 38.0 36.0 38.0 85-89 37.0256 38.0 38.0 38.0 36.0 38.0 90-94 36.825900000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.750800000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.68465 38.0 38.0 38.0 34.2 38.0 105-109 36.633849999999995 38.0 38.0 38.0 34.2 38.0 110-114 36.52505 38.0 38.0 38.0 34.0 38.0 115-119 36.42055 38.0 38.0 38.0 34.0 38.0 120-124 36.27955 38.0 37.6 38.0 33.8 38.0 125-129 36.074949999999994 38.0 37.0 38.0 33.0 38.0 130-134 35.7178 38.0 36.2 38.0 31.4 38.0 135-139 35.61685 38.0 36.0 38.0 31.0 38.0 140-144 35.25285 38.0 35.6 38.0 30.4 38.0 145-149 35.00415 38.0 35.6 38.0 30.4 38.0 150-151 31.7325 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 0.0 19 1.0 20 4.0 21 2.0 22 3.0 23 4.0 24 8.0 25 8.0 26 8.0 27 12.0 28 15.0 29 18.0 30 30.0 31 42.0 32 59.0 33 105.0 34 134.0 35 281.0 36 631.0 37 2631.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.0300590445518 11.594202898550725 8.695652173913043 41.680085882984436 2 21.9 14.149999999999999 33.425 30.525000000000002 3 18.975 18.675 25.35 37.0 4 21.325 27.025 22.85 28.799999999999997 5 22.36118059029515 30.940470235117555 23.611805902951478 23.08654327163582 6 20.3 34.55 24.05 21.099999999999998 7 15.299999999999999 28.4 37.8 18.5 8 17.1 25.575 31.025000000000002 26.3 9 17.925 25.05 32.35 24.675 10-14 20.119999999999997 28.970000000000002 26.674999999999997 24.235 15-19 19.744999999999997 27.650000000000002 27.98 24.625 20-24 19.134999999999998 28.199999999999996 28.485 24.18 25-29 20.205000000000002 28.02 27.47 24.305 30-34 19.845 28.255000000000003 27.779999999999998 24.12 35-39 19.895 28.610000000000003 27.474999999999998 24.02 40-44 20.175 28.105000000000004 27.560000000000002 24.16 45-49 20.68 27.71 27.310000000000002 24.3 50-54 20.115 28.139999999999997 27.575 24.169999999999998 55-59 19.63 27.775 27.944999999999997 24.65 60-64 20.285 27.37 27.825 24.52 65-69 20.215 28.365000000000002 27.334999999999997 24.085 70-74 20.75 27.725 27.334999999999997 24.19 75-79 20.150000000000002 28.084999999999997 27.665 24.099999999999998 80-84 20.615 27.944999999999997 27.189999999999998 24.25 85-89 20.415 27.284999999999997 28.055000000000003 24.245 90-94 20.7 27.384999999999998 27.384999999999998 24.529999999999998 95-99 20.419999999999998 27.485 27.37 24.725 100-104 20.474999999999998 27.785 27.165 24.575 105-109 20.36 28.275 27.195000000000004 24.169999999999998 110-114 20.53 27.650000000000002 27.63 24.19 115-119 20.815 27.339999999999996 27.889999999999997 23.955000000000002 120-124 20.715 27.189999999999998 27.439999999999998 24.654999999999998 125-129 20.695 27.625 27.639999999999997 24.04 130-134 21.044999999999998 27.005000000000003 27.860000000000003 24.09 135-139 20.96 26.575 27.955000000000002 24.51 140-144 21.12 27.805000000000003 26.865 24.21 145-149 21.255 27.85 27.425 23.47 150-151 20.91798344620015 27.66491096062202 27.928266867318786 23.488838725859043 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 2.0 26 5.0 27 6.5 28 6.0 29 11.5 30 18.5 31 19.0 32 22.5 33 32.5 34 49.0 35 56.0 36 62.5 37 88.0 38 114.0 39 130.5 40 150.5 41 208.5 42 245.0 43 242.0 44 251.0 45 275.0 46 291.0 47 269.0 48 248.5 49 233.0 50 195.0 51 174.0 52 140.5 53 109.5 54 92.0 55 60.0 56 43.5 57 31.0 58 29.0 59 27.0 60 17.0 61 11.0 62 8.5 63 5.0 64 3.5 65 2.5 66 1.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 1.0 73 2.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.8500000000000005 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.025 2 0.0 0.0 0.0 0.0 0.025 3 0.0 0.0 0.0 0.0 0.025 4 0.0 0.0 0.0 0.0 0.025 5 0.0 0.0 0.0 0.0 0.025 6 0.0 0.0 0.0 0.0 0.025 7 0.0 0.0 0.0 0.0 0.025 8 0.0 0.0 0.0 0.0 0.025 9 0.0 0.0 0.0 0.0 0.025 10-11 0.0 0.0 0.0 0.0 0.025 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0125 0.0 0.0 0.0 0.025 80-81 0.025 0.0 0.0 0.0 0.025 82-83 0.025 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.025 0.0 0.0 0.0 0.025 88-89 0.025 0.0 0.0 0.0 0.025 90-91 0.0625 0.0 0.0 0.0 0.025 92-93 0.075 0.0 0.0 0.0 0.025 94-95 0.1375 0.0 0.0 0.0 0.025 96-97 0.2125 0.0 0.0 0.0 0.025 98-99 0.25 0.0 0.0 0.0 0.025 100-101 0.3125 0.0 0.0 0.0 0.025 102-103 0.3625 0.0 0.0 0.0 0.025 104-105 0.4 0.0 0.0 0.0 0.025 106-107 0.4375 0.0 0.0 0.0 0.025 108-109 0.4875 0.0 0.0 0.0 0.025 110-111 0.55 0.0 0.0 0.0 0.025 112-113 0.75 0.0 0.0 0.0 0.025 114-115 0.8125 0.0 0.0 0.0 0.025 116-117 0.875 0.0 0.0 0.0 0.025 118-119 0.975 0.0 0.0 0.0 0.025 120-121 1.175 0.0 0.0 0.0 0.025 122-123 1.35 0.0 0.0 0.0 0.025 124-125 1.5125000000000002 0.0 0.0 0.0 0.025 126-127 1.675 0.0 0.0 0.0 0.025 128-129 1.875 0.0 0.0 0.0 0.025 130-131 2.1375 0.0 0.0 0.0 0.025 132-133 2.425 0.0 0.0 0.0 0.025 134-135 2.7625 0.0 0.0 0.0 0.025 136-137 3.0375 0.0 0.0 0.0 0.025 138-139 3.3375000000000004 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030802 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030802_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84725 33.0 33.0 34.0 32.0 34.0 2 32.93225 33.0 33.0 34.0 32.0 34.0 3 33.002 34.0 33.0 34.0 32.0 34.0 4 33.03525 34.0 33.0 34.0 32.0 34.0 5 32.9155 34.0 33.0 34.0 32.0 34.0 6 37.224 38.0 38.0 38.0 37.0 38.0 7 37.2305 38.0 38.0 38.0 37.0 38.0 8 37.26175 38.0 38.0 38.0 37.0 38.0 9 37.3225 38.0 38.0 38.0 37.0 38.0 10-14 37.2185 38.0 38.0 38.0 37.0 38.0 15-19 37.11445 38.0 38.0 38.0 36.8 38.0 20-24 37.1331 38.0 38.0 38.0 36.6 38.0 25-29 37.1225 38.0 38.0 38.0 36.6 38.0 30-34 37.086749999999995 38.0 38.0 38.0 36.6 38.0 35-39 37.00595 38.0 38.0 38.0 36.6 38.0 40-44 36.9784 38.0 38.0 38.0 36.0 38.0 45-49 36.88185 38.0 38.0 38.0 36.0 38.0 50-54 36.90915 38.0 38.0 38.0 35.8 38.0 55-59 36.85979999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.83194999999999 38.0 38.0 38.0 35.6 38.0 65-69 36.69045 38.0 38.0 38.0 35.0 38.0 70-74 36.76585 38.0 38.0 38.0 35.4 38.0 75-79 36.68465 38.0 38.0 38.0 35.0 38.0 80-84 36.68865000000001 38.0 38.0 38.0 35.0 38.0 85-89 36.559450000000005 38.0 38.0 38.0 34.6 38.0 90-94 36.416399999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.36885 38.0 38.0 38.0 34.0 38.0 100-104 36.02905 38.0 37.6 38.0 32.8 38.0 105-109 35.93175 38.0 37.0 38.0 33.0 38.0 110-114 35.7486 38.0 37.0 38.0 31.8 38.0 115-119 35.62714999999999 38.0 37.0 38.0 31.2 38.0 120-124 35.54295 38.0 36.4 38.0 31.8 38.0 125-129 35.24835 38.0 36.0 38.0 30.0 38.0 130-134 35.1185 38.0 35.6 38.0 29.0 38.0 135-139 34.7152 38.0 35.0 38.0 27.4 38.0 140-144 34.2885 38.0 35.0 38.0 25.2 38.0 145-149 33.79195 38.0 34.6 38.0 23.0 38.0 150-151 29.896250000000002 36.0 28.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 1.0 5 1.0 6 2.0 7 0.0 8 0.0 9 0.0 10 3.0 11 2.0 12 2.0 13 3.0 14 1.0 15 0.0 16 3.0 17 3.0 18 2.0 19 6.0 20 2.0 21 4.0 22 6.0 23 11.0 24 7.0 25 21.0 26 19.0 27 15.0 28 29.0 29 39.0 30 45.0 31 44.0 32 62.0 33 93.0 34 187.0 35 290.0 36 687.0 37 2399.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.48362090522631 20.630157539384847 13.028257064266066 31.857964491122782 2 26.556639159789945 25.381345336334082 30.15753938484621 17.90447611902976 3 21.380345086271568 27.881970492623154 30.407601900475118 20.330082520630157 4 21.880470117529384 34.63365841460365 23.78094523630908 19.70492623155789 5 24.224999999999998 35.75 22.95 17.075000000000003 6 19.3 40.075 22.55 18.075 7 19.825 22.75 36.775000000000006 20.65 8 22.425 26.05 26.375 25.15 9 21.675 24.95 30.099999999999998 23.275000000000002 10-14 22.595000000000002 29.035 26.224999999999998 22.145 15-19 22.994999999999997 28.720000000000002 26.69 21.595 20-24 22.884999999999998 28.79 26.38 21.945 25-29 23.52 28.07 27.145000000000003 21.265 30-34 23.285 28.595 26.905 21.215 35-39 23.095 28.32 27.169999999999998 21.415 40-44 23.474999999999998 28.144999999999996 27.235 21.145 45-49 23.35 27.575 27.685 21.39 50-54 23.845 27.77 27.57 20.815 55-59 23.794999999999998 26.889999999999997 27.889999999999997 21.425 60-64 23.0 28.27 27.325 21.404999999999998 65-69 23.785 27.935 27.115000000000002 21.165 70-74 23.51 28.13 26.87 21.490000000000002 75-79 23.435 28.000000000000004 27.21 21.355 80-84 24.13 28.134999999999998 26.935 20.8 85-89 23.86 27.665 27.435 21.04 90-94 24.02 27.560000000000002 27.43 20.990000000000002 95-99 24.08 28.000000000000004 27.22 20.7 100-104 24.165 27.485 27.189999999999998 21.16 105-109 23.61 27.825 27.315 21.25 110-114 24.285 27.88 26.77 21.065 115-119 24.529999999999998 27.63 27.125 20.715 120-124 24.29 27.705000000000002 27.01 20.995 125-129 24.795 28.43 26.235000000000003 20.54 130-134 24.36 27.495000000000005 27.29 20.855 135-139 24.235 28.335 27.04 20.39 140-144 25.180000000000003 28.09 26.534999999999997 20.195 145-149 24.62 27.584999999999997 26.96 20.835 150-151 25.381345336334082 27.24431107776944 26.469117279319832 20.905226306576644 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 2.0 27 3.5 28 4.0 29 5.5 30 7.0 31 13.0 32 18.5 33 21.0 34 28.5 35 41.5 36 69.0 37 101.0 38 129.5 39 168.0 40 191.5 41 210.0 42 243.5 43 252.5 44 264.0 45 295.5 46 289.0 47 275.0 48 261.5 49 224.5 50 184.0 51 156.5 52 133.0 53 98.0 54 71.0 55 51.5 56 42.0 57 41.0 58 30.0 59 19.5 60 15.0 61 9.0 62 8.0 63 7.5 64 4.0 65 1.5 66 0.5 67 1.0 68 1.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.6300403225806451 1.25 3 0.05040322580645161 0.15 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2125 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.2 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.7 0.0 0.0 0.0 0.0 128-129 1.925 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.475 0.0 0.0 0.0 0.0 134-135 2.775 0.0 0.0 0.0 0.0 136-137 3.0375 0.0 0.0 0.0 0.0 138-139 3.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114102 spots for SRR7030802.sra Written 1114102 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra Read 1114095 spots for SRR7030802.sra Written 1114095 spots for SRR7030802.sra SRR ids: ['SRR7030802.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g_yyj4bc SRR7030802.sra spots: 22281907 blocks: [[1, 1114095], [1114096, 2228190], [2228191, 3342285], [3342286, 4456380], [4456381, 5570475], [5570476, 6684570], [6684571, 7798665], [7798666, 8912760], [8912761, 10026855], [10026856, 11140950], [11140951, 12255045], [12255046, 13369140], [13369141, 14483235], [14483236, 15597330], [15597331, 16711425], [16711426, 17825520], [17825521, 18939615], [18939616, 20053710], [20053711, 21167805], [21167806, 22281907]] SRR7030802 file size 7528906 SRR7030802 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030802 SRR7030802_1.fastq SRR7030802_2.fastq Input file: SRR7030802_1.fastq Paired file: SRR7030802_2.fastq trimmed: SRR7030802-trimmed-pair1.fastq, SRR7030802-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:58:04 2025 >> started Wed Feb 12 18:58:38 2025 >> done (34.479s) 22281907 read pairs processed; of these: 15624 ( 0.07%) short read pairs filtered out after trimming by size control 14463 ( 0.06%) empty read pairs filtered out after trimming by size control 22251820 (99.86%) read pairs available; of these: 8429847 (37.88%) trimmed read pairs available after processing 13821973 (62.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 7 0.00% 21 8 0.00% 22 4 0.00% 23 5 0.00% 24 4 0.00% 25 8 0.00% 26 6 0.00% 27 6 0.00% 28 4 0.00% 29 5 0.00% 30 7 0.00% 31 5 0.00% 32 5 0.00% 33 10 0.00% 34 5 0.00% 35 3 0.00% 36 4 0.00% 37 4 0.00% 38 5 0.00% 39 6 0.00% 40 10 0.00% 41 6 0.00% 42 4 0.00% 43 9 0.00% 44 14 0.00% 45 10 0.00% 46 10 0.00% 47 8 0.00% 48 11 0.00% 49 16 0.00% 50 24 0.00% 51 19 0.00% 52 21 0.00% 53 28 0.00% 54 23 0.00% 55 22 0.00% 56 34 0.00% 57 36 0.00% 58 40 0.00% 59 40 0.00% 60 59 0.00% 61 65 0.00% 62 93 0.00% 63 90 0.00% 64 111 0.00% 65 105 0.00% 66 112 0.00% 67 143 0.00% 68 163 0.00% 69 173 0.00% 70 217 0.00% 71 223 0.00% 72 306 0.00% 73 313 0.00% 74 335 0.00% 75 429 0.00% 76 492 0.00% 77 510 0.00% 78 581 0.00% 79 726 0.00% 80 761 0.00% 81 885 0.00% 82 1066 0.00% 83 1314 0.01% 84 2070 0.01% 85 2751 0.01% 86 2918 0.01% 87 3058 0.01% 88 3396 0.02% 89 3656 0.02% 90 3759 0.02% 91 4150 0.02% 92 4559 0.02% 93 4775 0.02% 94 4971 0.02% 95 5458 0.02% 96 5802 0.03% 97 6108 0.03% 98 6617 0.03% 99 7163 0.03% 100 7640 0.03% 101 8090 0.04% 102 8792 0.04% 103 9820 0.04% 104 10426 0.05% 105 11200 0.05% 106 11816 0.05% 107 12601 0.06% 108 13314 0.06% 109 14147 0.06% 110 14812 0.07% 111 15771 0.07% 112 17130 0.08% 113 18277 0.08% 114 19463 0.09% 115 21093 0.09% 116 22228 0.10% 117 23772 0.11% 118 24493 0.11% 119 25702 0.12% 120 26703 0.12% 121 28445 0.13% 122 30124 0.14% 123 31655 0.14% 124 33911 0.15% 125 35765 0.16% 126 37911 0.17% 127 40108 0.18% 128 41893 0.19% 129 43839 0.20% 130 46650 0.21% 131 49034 0.22% 132 52479 0.24% 133 55524 0.25% 134 59616 0.27% 135 63610 0.29% 136 68871 0.31% 137 73669 0.33% 138 79701 0.36% 139 86496 0.39% 140 91527 0.41% 141 99567 0.45% 142 110160 0.50% 143 124254 0.56% 144 144332 0.65% 145 171168 0.77% 146 215916 0.97% 147 290581 1.31% 148 435490 1.96% 149 852745 3.83% 150 4516532 20.30% 151 13821973 62.12% 22251820 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=36 prefix-density=0.19 prefix-fanout=2.3 sequence=GTGGACTCCTTCTGGATGTTGTAGTCAGC criterion=fanout-score sequence-density=0.15 sequence-density-rank=3 fanout-score=302.81 fanout-score-rank=1 prefix-density=1.24 prefix-fanout=35.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=41 prefix-density=0.32 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=308.98 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=28.5 sequence=GAAGAAGAAGAAA SRR7030802 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:59:24 Started mapping on | Feb 12 18:59:25 Finished on | Feb 12 19:01:46 Mapping speed, Million of reads per hour | 568.13 Number of input reads | 22251820 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20931450 Uniquely mapped reads % | 94.07% Average mapped length | 296.74 Number of splices: Total | 22663776 Number of splices: Annotated (sjdb) | 22354160 Number of splices: GT/AG | 22298044 Number of splices: GC/AG | 300475 Number of splices: AT/AC | 17688 Number of splices: Non-canonical | 47569 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 697457 % of reads mapped to multiple loci | 3.13% Number of reads mapped to too many loci | 334572 % of reads mapped to too many loci | 1.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 639138 639138 639138 N_multimapping 697457 697457 697457 N_noFeature 318040 20737568 399588 N_ambiguous 222092 807 109286 UnstrandedReadsAssigned:20391318 PositiveStrandReadsAssigned:193075 NegativeStrandReadsAssigned:20422576 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030802 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030802-trimmed-pair1.fastq SRR7030802-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,251,820 reads, 20,665,731 reads pseudoaligned [quant] estimated average fragment length: 246.825 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 988 rounds 52401 SRR7030802.ke.tsv 34699 SRR7030802.se.tsv 87100 total ==> SRR7030802.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.17 913 17.7344 Potri.005G024800.1.v4.1 1035 789.175 217 9.46541 Potri.004G059700.1.v4.1 961 715.199 22 1.05888 Potri.007G009000.2.v4.1 1416 1170.17 1 0.0294173 Potri.003G141000.2.v4.1 2943 2697.17 591 7.54278 Potri.016G087400.1.v4.1 270 71.4189 2048.23 987.232 Potri.015G069301.1.v4.1 564 321.271 0 0 Potri.010G195200.1.v4.1 1773 1527.17 1 0.0225405 Potri.012G127500.1.v4.1 977 731.193 6446 303.467 ==> SRR7030802.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 384 Potri.001G212900.v4.1 73 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7030802 completed mapping pipeline successfully