Starting /dee2/code/volunteer_pipeline.sh SRR7030803 current disk space = 3051155968000 free memory = 1576158128 SRR7030803 SRAfilesize 232262bad5d9a3cf51c03c40953ce2ed SRR7030803.sra SRR7030803.sra file validated SRR7030803 is paired end SRR7030803 is conventional basespace SRR7030803 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030803_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.868 33.0 32.0 33.0 31.0 34.0 2 32.22375 33.0 33.0 34.0 29.0 34.0 3 32.5535 33.0 33.0 34.0 31.0 34.0 4 31.979 33.0 32.0 33.0 31.0 34.0 5 32.3895 33.0 33.0 34.0 31.0 34.0 6 37.086 38.0 37.0 38.0 36.0 38.0 7 37.366 38.0 38.0 38.0 37.0 38.0 8 37.4615 38.0 38.0 38.0 37.0 38.0 9 37.589 38.0 38.0 38.0 38.0 38.0 10-14 37.498599999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.52835 38.0 38.0 38.0 38.0 38.0 20-24 37.4377 38.0 38.0 38.0 37.6 38.0 25-29 37.4147 38.0 38.0 38.0 37.4 38.0 30-34 37.363800000000005 38.0 38.0 38.0 37.4 38.0 35-39 37.338499999999996 38.0 38.0 38.0 37.2 38.0 40-44 37.400549999999996 38.0 38.0 38.0 37.6 38.0 45-49 37.339200000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.331149999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.25945 38.0 38.0 38.0 37.0 38.0 60-64 37.17605 38.0 38.0 38.0 36.8 38.0 65-69 37.165350000000004 38.0 38.0 38.0 36.6 38.0 70-74 37.222449999999995 38.0 38.0 38.0 37.0 38.0 75-79 37.08985 38.0 38.0 38.0 36.2 38.0 80-84 36.92725 38.0 38.0 38.0 35.8 38.0 85-89 36.63195 38.0 38.0 38.0 34.8 38.0 90-94 36.70360000000001 38.0 38.0 38.0 34.8 38.0 95-99 36.66885 38.0 38.0 38.0 34.8 38.0 100-104 36.5892 38.0 38.0 38.0 34.4 38.0 105-109 36.440450000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.13955 38.0 37.6 38.0 33.4 38.0 115-119 36.08995 38.0 37.6 38.0 33.2 38.0 120-124 35.88595 38.0 37.0 38.0 32.2 38.0 125-129 35.726 38.0 36.4 38.0 31.6 38.0 130-134 35.45715 38.0 36.2 38.0 30.4 38.0 135-139 35.11735 38.0 35.8 38.0 29.0 38.0 140-144 34.3658 38.0 35.0 38.0 24.6 38.0 145-149 34.05495 38.0 34.6 38.0 23.8 38.0 150-151 29.711750000000002 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 5.0 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 2.0 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 6.0 22 6.0 23 3.0 24 4.0 25 5.0 26 18.0 27 21.0 28 27.0 29 35.0 30 41.0 31 41.0 32 77.0 33 103.0 34 156.0 35 271.0 36 574.0 37 2595.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.809065586224364 11.066092681691568 8.229931628260319 34.89491010382375 2 22.0 12.85 36.1 29.049999999999997 3 20.05 17.349999999999998 27.175 35.425000000000004 4 22.775000000000002 26.924999999999997 24.6 25.7 5 22.43365047571357 31.67250876314472 24.98748122183275 20.906359539308962 6 20.724999999999998 34.525 24.3 20.45 7 15.4 25.374999999999996 40.300000000000004 18.925 8 16.875 25.825 30.4 26.900000000000002 9 16.575 25.55 34.525 23.35 10-14 20.11 28.875 27.47 23.544999999999998 15-19 19.825 28.64 27.395000000000003 24.14 20-24 20.325 28.375 27.76 23.54 25-29 20.415 28.165000000000003 27.195000000000004 24.224999999999998 30-34 19.185 29.125 27.415 24.275 35-39 20.46 28.22 27.284999999999997 24.035 40-44 20.0 28.965000000000003 26.965 24.07 45-49 20.705000000000002 27.71 27.595 23.990000000000002 50-54 20.06 28.43 27.29 24.22 55-59 20.085 27.985 27.415 24.515 60-64 20.64 27.915 27.42 24.025 65-69 19.925 28.025 27.615000000000002 24.435000000000002 70-74 19.855 28.410000000000004 26.945000000000004 24.79 75-79 19.855 27.775 27.905 24.465 80-84 20.45 27.650000000000002 27.52 24.38 85-89 20.77 28.225 27.33 23.674999999999997 90-94 20.525 27.92 26.915 24.64 95-99 20.45 27.505000000000003 27.58 24.465 100-104 20.445 27.775 27.400000000000002 24.38 105-109 20.555 27.384999999999998 27.68 24.38 110-114 20.445 27.655 27.27 24.63 115-119 20.705000000000002 28.095 27.034999999999997 24.165 120-124 20.875 27.68 27.089999999999996 24.355 125-129 20.455000000000002 27.605 27.465 24.474999999999998 130-134 20.255000000000003 27.450000000000003 27.57 24.725 135-139 21.25 27.71 27.165 23.875 140-144 20.835 27.735 27.38 24.05 145-149 21.785 27.529999999999998 26.515 24.169999999999998 150-151 21.349999999999998 27.8625 27.0 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 3.0 23 2.0 24 2.0 25 2.0 26 3.5 27 6.5 28 8.0 29 9.5 30 17.5 31 25.5 32 30.5 33 39.5 34 51.0 35 66.5 36 87.0 37 104.0 38 125.5 39 145.5 40 166.0 41 185.0 42 203.5 43 241.0 44 262.5 45 251.0 46 245.0 47 246.0 48 239.5 49 233.5 50 195.5 51 162.5 52 137.5 53 108.0 54 96.0 55 65.5 56 44.5 57 42.5 58 34.5 59 30.0 60 23.5 61 18.0 62 14.5 63 5.5 64 1.0 65 3.0 66 3.5 67 1.5 68 1.0 69 1.5 70 1.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42109237352128 98.75 2 0.47822803926503904 0.95 3 0.10067958721369243 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 0.9874999999999999 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.175 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.4874999999999998 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 1.95 0.0 0.0 0.0 0.0 134-135 2.2249999999999996 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 3.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030803 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030803_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85425 34.0 33.0 34.0 32.0 34.0 2 32.91675 34.0 33.0 34.0 32.0 34.0 3 32.81325 34.0 33.0 34.0 32.0 34.0 4 32.82325 34.0 33.0 34.0 32.0 34.0 5 32.81925 34.0 33.0 34.0 32.0 34.0 6 37.04 38.0 38.0 38.0 37.0 38.0 7 37.04975 38.0 38.0 38.0 37.0 38.0 8 37.04025 38.0 38.0 38.0 37.0 38.0 9 37.101 38.0 38.0 38.0 37.0 38.0 10-14 37.025299999999994 38.0 38.0 38.0 37.0 38.0 15-19 36.959050000000005 38.0 38.0 38.0 36.8 38.0 20-24 36.87245 38.0 38.0 38.0 36.4 38.0 25-29 36.794200000000004 38.0 38.0 38.0 36.2 38.0 30-34 36.81315000000001 38.0 38.0 38.0 36.2 38.0 35-39 36.797 38.0 38.0 38.0 36.0 38.0 40-44 36.65835 38.0 38.0 38.0 35.8 38.0 45-49 36.61745 38.0 38.0 38.0 35.4 38.0 50-54 36.5008 38.0 38.0 38.0 35.2 38.0 55-59 36.51595 38.0 38.0 38.0 35.0 38.0 60-64 36.520500000000006 38.0 38.0 38.0 35.2 38.0 65-69 36.50095 38.0 38.0 38.0 35.0 38.0 70-74 36.354299999999995 38.0 38.0 38.0 34.2 38.0 75-79 36.109950000000005 38.0 38.0 38.0 33.6 38.0 80-84 36.218599999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.175650000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.12245 38.0 38.0 38.0 33.8 38.0 95-99 35.9733 38.0 38.0 38.0 33.4 38.0 100-104 35.6693 38.0 37.4 38.0 31.8 38.0 105-109 35.44985 38.0 37.0 38.0 30.2 38.0 110-114 35.39155 38.0 37.0 38.0 30.2 38.0 115-119 35.19405 38.0 36.8 38.0 28.6 38.0 120-124 34.85815 38.0 36.0 38.0 27.6 38.0 125-129 34.56510000000001 38.0 35.4 38.0 25.4 38.0 130-134 34.45445 38.0 35.2 38.0 24.6 38.0 135-139 34.02525 38.0 34.4 38.0 23.0 38.0 140-144 33.177 38.0 33.0 38.0 18.2 38.0 145-149 32.15585 38.0 33.0 38.0 11.0 38.0 150-151 27.664 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 9.0 4 4.0 5 2.0 6 6.0 7 2.0 8 0.0 9 2.0 10 0.0 11 0.0 12 3.0 13 3.0 14 7.0 15 4.0 16 5.0 17 7.0 18 4.0 19 5.0 20 7.0 21 7.0 22 9.0 23 8.0 24 17.0 25 19.0 26 18.0 27 33.0 28 44.0 29 40.0 30 42.0 31 89.0 32 103.0 33 112.0 34 174.0 35 250.0 36 598.0 37 2352.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.52705410821643 22.895791583166332 12.249498997995993 26.327655310621246 2 26.91537305958938 27.491236855282924 27.86680020030045 17.72658988482724 3 21.017034068136272 27.930861723446892 30.98697394789579 20.06513026052104 4 23.140495867768596 33.558727773603806 23.441021788129227 19.85975457049837 5 23.408521303258144 37.393483709273184 22.05513784461153 17.142857142857142 6 20.974999999999998 37.3 23.724999999999998 18.0 7 21.025 22.25 37.175000000000004 19.55 8 21.725 25.7 29.299999999999997 23.275000000000002 9 22.275 25.5 27.925 24.3 10-14 23.89 29.035 25.130000000000003 21.945 15-19 23.615 28.015 27.045 21.325 20-24 22.634999999999998 28.365000000000002 27.07 21.93 25-29 23.400000000000002 27.889999999999997 27.029999999999998 21.68 30-34 22.755 28.12 27.395000000000003 21.73 35-39 23.115 27.93 27.18 21.775 40-44 23.09 27.815 27.384999999999998 21.709999999999997 45-49 23.32699809942983 27.993398019405824 28.15844753426028 20.52115634690407 50-54 23.264201983769162 28.624386334034668 27.161607053401465 20.94980462879471 55-59 23.23100806249687 27.432520406630278 28.113576042866445 21.22289548800641 60-64 24.060000000000002 27.505000000000003 27.72 20.715 65-69 23.65 27.465 27.465 21.42 70-74 23.895 27.415 27.49 21.2 75-79 23.821191059552977 27.28636431821591 27.226361318065905 21.66608330416521 80-84 22.605 28.875 27.065 21.455 85-89 23.435 27.355 27.925 21.285 90-94 24.3 27.435 27.1 21.165 95-99 23.50735073507351 28.04280428042804 27.562756275627564 20.887088708870888 100-104 24.177475086383897 27.3523962141319 27.39746607241224 21.07266262707196 105-109 23.612431810219707 27.636254441719633 27.581202142034932 21.170111606025724 110-114 24.44 27.515 27.450000000000003 20.595 115-119 24.23 27.62 26.845000000000002 21.305 120-124 24.099999999999998 27.139999999999997 27.465 21.295 125-129 24.65 27.084999999999997 27.339999999999996 20.925 130-134 24.12 27.72 27.015 21.145 135-139 24.335 27.24 27.250000000000004 21.175 140-144 25.203902927195397 27.51563672754566 26.69001751313485 20.590442832124094 145-149 25.20056157240273 27.51704773365423 26.795026073004415 20.487364620938628 150-151 25.47252472149205 27.51283014144449 26.84941794968081 20.16522718738265 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.5 24 3.5 25 4.5 26 2.0 27 2.5 28 4.5 29 10.0 30 14.0 31 16.0 32 21.5 33 33.0 34 44.5 35 46.0 36 70.0 37 103.5 38 129.5 39 157.5 40 187.0 41 217.5 42 229.0 43 244.0 44 270.5 45 279.0 46 285.5 47 274.5 48 234.5 49 207.5 50 170.5 51 126.0 52 114.5 53 108.5 54 79.0 55 53.0 56 49.0 57 44.0 58 35.0 59 31.0 60 23.5 61 16.5 62 15.5 63 14.0 64 9.5 65 3.5 66 0.5 67 1.5 68 1.5 69 1.0 70 2.0 71 1.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.15 3 0.2 4 0.17500000000000002 5 0.25 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.03 50-54 0.19 55-59 0.155 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.155 105-109 0.095 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.075 145-149 0.27999999999999997 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3195564516129 98.52499999999999 2 0.5796370967741935 1.15 3 0.07560483870967742 0.22499999999999998 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.8500000000000001 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.4625 0.0 0.0 0.0 0.0 128-129 1.5375 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.925 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.55 0.0 0.0 0.0 0.0 138-139 2.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGACCAG 10 0.006830828 145.0 6 >>END_MODULE Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685788 spots for SRR7030803.sra Written 685788 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra Read 685770 spots for SRR7030803.sra Written 685770 spots for SRR7030803.sra SRR ids: ['SRR7030803.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tly45_g3 SRR7030803.sra spots: 13715418 blocks: [[1, 685770], [685771, 1371540], [1371541, 2057310], [2057311, 2743080], [2743081, 3428850], [3428851, 4114620], [4114621, 4800390], [4800391, 5486160], [5486161, 6171930], [6171931, 6857700], [6857701, 7543470], [7543471, 8229240], [8229241, 8915010], [8915011, 9600780], [9600781, 10286550], [10286551, 10972320], [10972321, 11658090], [11658091, 12343860], [12343861, 13029630], [13029631, 13715418]] SRR7030803 file size 4626004 SRR7030803 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030803 SRR7030803_1.fastq SRR7030803_2.fastq Input file: SRR7030803_1.fastq Paired file: SRR7030803_2.fastq trimmed: SRR7030803-trimmed-pair1.fastq, SRR7030803-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:18:23 2025 >> started Wed Feb 12 19:18:37 2025 >> done (14.309s) 13715418 read pairs processed; of these: 54071 ( 0.39%) short read pairs filtered out after trimming by size control 45225 ( 0.33%) empty read pairs filtered out after trimming by size control 13616122 (99.28%) read pairs available; of these: 5343768 (39.25%) trimmed read pairs available after processing 8272354 (60.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 4 0.00% 22 7 0.00% 23 9 0.00% 24 6 0.00% 25 5 0.00% 26 9 0.00% 27 7 0.00% 28 8 0.00% 29 10 0.00% 30 6 0.00% 31 2 0.00% 32 5 0.00% 33 3 0.00% 34 6 0.00% 35 8 0.00% 36 10 0.00% 37 5 0.00% 38 9 0.00% 39 6 0.00% 40 5 0.00% 41 10 0.00% 42 13 0.00% 43 8 0.00% 44 9 0.00% 45 8 0.00% 46 8 0.00% 47 13 0.00% 48 13 0.00% 49 14 0.00% 50 19 0.00% 51 19 0.00% 52 35 0.00% 53 23 0.00% 54 34 0.00% 55 27 0.00% 56 36 0.00% 57 21 0.00% 58 37 0.00% 59 38 0.00% 60 51 0.00% 61 49 0.00% 62 67 0.00% 63 65 0.00% 64 72 0.00% 65 96 0.00% 66 91 0.00% 67 107 0.00% 68 119 0.00% 69 113 0.00% 70 151 0.00% 71 170 0.00% 72 172 0.00% 73 221 0.00% 74 276 0.00% 75 306 0.00% 76 339 0.00% 77 385 0.00% 78 430 0.00% 79 476 0.00% 80 546 0.00% 81 652 0.00% 82 825 0.01% 83 1049 0.01% 84 3423 0.03% 85 3885 0.03% 86 3549 0.03% 87 3636 0.03% 88 3598 0.03% 89 3423 0.03% 90 3569 0.03% 91 3618 0.03% 92 3728 0.03% 93 3877 0.03% 94 4221 0.03% 95 4388 0.03% 96 4873 0.04% 97 7109 0.05% 98 6754 0.05% 99 4877 0.04% 100 5067 0.04% 101 5490 0.04% 102 5725 0.04% 103 6179 0.05% 104 6581 0.05% 105 7214 0.05% 106 7543 0.06% 107 7805 0.06% 108 8323 0.06% 109 8675 0.06% 110 9251 0.07% 111 10031 0.07% 112 10449 0.08% 113 11184 0.08% 114 12094 0.09% 115 13063 0.10% 116 13443 0.10% 117 14387 0.11% 118 15119 0.11% 119 15492 0.11% 120 16728 0.12% 121 17611 0.13% 122 19088 0.14% 123 19600 0.14% 124 20095 0.15% 125 20958 0.15% 126 22556 0.17% 127 23630 0.17% 128 24455 0.18% 129 26208 0.19% 130 27825 0.20% 131 28903 0.21% 132 30677 0.23% 133 33334 0.24% 134 35259 0.26% 135 38146 0.28% 136 41315 0.30% 137 44329 0.33% 138 48241 0.35% 139 52574 0.39% 140 56793 0.42% 141 63984 0.47% 142 72333 0.53% 143 84570 0.62% 144 103842 0.76% 145 127672 0.94% 146 159655 1.17% 147 202956 1.49% 148 280251 2.06% 149 503987 3.70% 150 2827200 20.76% 151 8272354 60.75% 13616122 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=32 prefix-density=0.20 prefix-fanout=2.2 sequence=GTGGACTCCTTCTGGATGTTGTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=310.41 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=30.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=39 prefix-density=0.54 prefix-fanout=2.0 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=106.73 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=1.9 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCAGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTCCAGGTGGGCCATGCTTGGAGCTCTTGGATGCGTCTTCCCCGAGCTCTTGTCCCGCAACGGTGTCAAGTTCGGCGAGGCTGTATGGTTCAAGGCTGGAGCCCAGA SRR7030803 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:19:20 Started mapping on | Feb 12 19:19:20 Finished on | Feb 12 19:20:44 Mapping speed, Million of reads per hour | 583.55 Number of input reads | 13616122 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12760321 Uniquely mapped reads % | 93.71% Average mapped length | 296.36 Number of splices: Total | 12708778 Number of splices: Annotated (sjdb) | 12517331 Number of splices: GT/AG | 12491736 Number of splices: GC/AG | 177603 Number of splices: AT/AC | 9364 Number of splices: Non-canonical | 30075 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 413506 % of reads mapped to multiple loci | 3.04% Number of reads mapped to too many loci | 235176 % of reads mapped to too many loci | 1.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.23% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 474007 474007 474007 N_multimapping 413506 413506 413506 N_noFeature 266772 12618735 319120 N_ambiguous 163070 562 73558 UnstrandedReadsAssigned:12330479 PositiveStrandReadsAssigned:141024 NegativeStrandReadsAssigned:12367643 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030803 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030803-trimmed-pair1.fastq SRR7030803-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,616,122 reads, 12,580,075 reads pseudoaligned [quant] estimated average fragment length: 254.327 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR7030803.ke.tsv 34699 SRR7030803.se.tsv 87100 total ==> SRR7030803.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.67 762 25.3484 Potri.005G024800.1.v4.1 1035 781.673 443 33.2689 Potri.004G059700.1.v4.1 961 707.706 5 0.41474 Potri.007G009000.2.v4.1 1416 1162.67 2 0.100979 Potri.003G141000.2.v4.1 2943 2689.67 306 6.67854 Potri.016G087400.1.v4.1 270 68.9133 902.673 768.93 Potri.015G069301.1.v4.1 564 315.714 0 0 Potri.010G195200.1.v4.1 1773 1519.67 35 1.352 Potri.012G127500.1.v4.1 977 723.686 4270 346.367 ==> SRR7030803.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 242 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7030803 completed mapping pipeline successfully