Starting /dee2/code/volunteer_pipeline.sh SRR7030804 current disk space = 3051189649408 free memory = 1461779548 SRR7030804 SRAfilesize 38d8e5734cf6382a4a7f71ae079a320f SRR7030804.sra SRR7030804.sra file validated SRR7030804 is paired end SRR7030804 is conventional basespace SRR7030804 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030804_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.62025 33.0 33.0 34.0 27.0 34.0 2 32.49325 33.0 33.0 34.0 28.0 34.0 3 32.7725 34.0 33.0 34.0 30.0 34.0 4 33.0245 34.0 33.0 34.0 31.0 34.0 5 32.9705 33.0 33.0 34.0 32.0 34.0 6 36.372 38.0 36.0 38.0 33.0 38.0 7 36.423 38.0 37.0 38.0 34.0 38.0 8 37.192 38.0 38.0 38.0 36.0 38.0 9 37.46 38.0 38.0 38.0 37.0 38.0 10-14 37.49425 38.0 38.0 38.0 37.0 38.0 15-19 37.51754999999999 38.0 38.0 38.0 37.2 38.0 20-24 37.476 38.0 38.0 38.0 37.0 38.0 25-29 37.49040000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.3769 38.0 38.0 38.0 37.0 38.0 35-39 37.36450000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.34295 38.0 38.0 38.0 37.0 38.0 45-49 37.3249 38.0 38.0 38.0 37.0 38.0 50-54 37.334050000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.2482 38.0 38.0 38.0 36.8 38.0 60-64 37.227250000000005 38.0 38.0 38.0 36.2 38.0 65-69 37.0601 38.0 38.0 38.0 36.0 38.0 70-74 37.02995 38.0 38.0 38.0 36.0 38.0 75-79 37.01875 38.0 38.0 38.0 36.0 38.0 80-84 36.93274999999999 38.0 38.0 38.0 35.2 38.0 85-89 36.871050000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.6511 38.0 38.0 38.0 34.6 38.0 95-99 36.5372 38.0 38.0 38.0 34.0 38.0 100-104 36.44879999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.36345 38.0 38.0 38.0 34.0 38.0 110-114 36.32135 38.0 38.0 38.0 33.8 38.0 115-119 36.126050000000006 38.0 37.2 38.0 33.4 38.0 120-124 36.002599999999994 38.0 37.0 38.0 33.0 38.0 125-129 35.887150000000005 38.0 36.6 38.0 32.4 38.0 130-134 35.47279999999999 38.0 36.0 38.0 30.6 38.0 135-139 35.3006 38.0 36.0 38.0 30.6 38.0 140-144 34.92530000000001 38.0 35.4 38.0 28.2 38.0 145-149 34.6255 38.0 35.0 38.0 28.4 38.0 150-151 31.114250000000002 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 1.0 19 2.0 20 2.0 21 4.0 22 3.0 23 5.0 24 5.0 25 8.0 26 19.0 27 15.0 28 21.0 29 24.0 30 33.0 31 58.0 32 65.0 33 91.0 34 175.0 35 260.0 36 716.0 37 2487.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.53042541733979 13.193322563274098 6.758212170166936 34.51803984921917 2 22.6 14.774999999999999 32.425 30.2 3 17.9 19.650000000000002 27.525 34.925 4 22.675 26.150000000000002 24.2 26.974999999999998 5 23.75 31.900000000000002 22.675 21.675 6 19.950000000000003 34.9 24.275 20.875 7 16.975 25.25 39.175 18.6 8 17.474999999999998 26.75 29.125 26.650000000000002 9 16.825000000000003 25.900000000000002 33.35 23.925 10-14 20.65 29.145 26.75 23.455000000000002 15-19 20.02 28.475 27.169999999999998 24.335 20-24 20.32 28.37 27.189999999999998 24.12 25-29 20.645 28.249999999999996 26.68 24.425 30-34 19.919999999999998 28.044999999999998 27.215 24.82 35-39 20.66 28.23 26.784999999999997 24.325 40-44 20.595 28.060000000000002 27.52 23.825 45-49 20.465 28.194999999999997 26.515 24.825 50-54 20.69 27.52 26.905 24.884999999999998 55-59 20.544999999999998 28.27 26.625 24.560000000000002 60-64 20.580000000000002 27.91 27.084999999999997 24.425 65-69 20.655 27.3 27.355 24.69 70-74 20.755000000000003 28.23 26.77 24.245 75-79 21.029999999999998 27.334999999999997 26.974999999999998 24.66 80-84 20.995 27.994999999999997 26.61 24.4 85-89 20.575 27.52 27.195000000000004 24.709999999999997 90-94 21.085 27.43 27.305 24.18 95-99 21.12 27.150000000000002 26.69 25.040000000000003 100-104 20.849999999999998 27.634999999999998 27.224999999999998 24.29 105-109 21.16 27.445000000000004 27.36 24.035 110-114 20.695 27.33 27.534999999999997 24.44 115-119 21.04 27.525 27.145000000000003 24.29 120-124 21.224999999999998 27.46 26.93 24.385 125-129 21.33 27.665 26.490000000000002 24.515 130-134 21.404999999999998 27.3 27.0 24.295 135-139 21.385 27.37 27.265 23.98 140-144 21.785 27.435 26.584999999999997 24.195 145-149 21.47 27.515 26.66 24.355 150-151 22.04260651629073 26.94235588972431 27.25563909774436 23.759398496240603 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.5 22 0.5 23 0.5 24 3.0 25 3.0 26 2.0 27 3.5 28 7.5 29 9.5 30 11.0 31 22.5 32 32.0 33 39.5 34 49.0 35 59.5 36 73.0 37 89.0 38 105.5 39 130.0 40 158.0 41 186.5 42 202.0 43 209.5 44 236.0 45 266.0 46 271.5 47 240.0 48 221.0 49 218.5 50 206.5 51 178.0 52 146.0 53 129.5 54 109.0 55 84.5 56 67.0 57 55.5 58 40.0 59 33.5 60 29.5 61 17.5 62 9.0 63 5.0 64 5.0 65 4.0 66 2.5 67 4.5 68 6.0 69 3.0 70 1.0 71 1.0 72 2.0 73 3.5 74 2.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.1499999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21855306276784 98.4 2 0.7310310057978321 1.4500000000000002 3 0.050415931434333254 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.7125 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.075 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.4500000000000002 0.0 0.0 0.0 0.0 124-125 1.6749999999999998 0.0 0.0 0.0 0.0 126-127 1.8250000000000002 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.6875 0.0 0.0 0.0 0.0 134-135 2.875 0.0 0.0 0.0 0.0 136-137 3.2375 0.0 0.0 0.0 0.0 138-139 3.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030804 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030804_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78975 33.0 33.0 34.0 32.0 34.0 2 32.86 33.0 33.0 34.0 32.0 34.0 3 32.90075 34.0 33.0 34.0 32.0 34.0 4 32.925 34.0 33.0 34.0 32.0 34.0 5 32.8305 34.0 33.0 34.0 32.0 34.0 6 37.12325 38.0 38.0 38.0 36.0 38.0 7 37.1925 38.0 38.0 38.0 37.0 38.0 8 37.168 38.0 38.0 38.0 37.0 38.0 9 37.2455 38.0 38.0 38.0 37.0 38.0 10-14 37.1471 38.0 38.0 38.0 36.6 38.0 15-19 37.049 38.0 38.0 38.0 36.6 38.0 20-24 37.06855 38.0 38.0 38.0 36.6 38.0 25-29 37.04285 38.0 38.0 38.0 36.2 38.0 30-34 37.0225 38.0 38.0 38.0 36.4 38.0 35-39 36.924400000000006 38.0 38.0 38.0 35.8 38.0 40-44 36.8115 38.0 38.0 38.0 35.8 38.0 45-49 36.8066 38.0 38.0 38.0 35.6 38.0 50-54 36.885450000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.769999999999996 38.0 38.0 38.0 35.4 38.0 60-64 36.75 38.0 38.0 38.0 35.6 38.0 65-69 36.5894 38.0 38.0 38.0 34.8 38.0 70-74 36.616550000000004 38.0 38.0 38.0 34.8 38.0 75-79 36.48975 38.0 38.0 38.0 34.2 38.0 80-84 36.5189 38.0 38.0 38.0 34.2 38.0 85-89 36.4204 38.0 38.0 38.0 34.0 38.0 90-94 36.30200000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.2606 38.0 38.0 38.0 34.0 38.0 100-104 35.895799999999994 38.0 37.2 38.0 32.4 38.0 105-109 35.78525 38.0 37.0 38.0 31.4 38.0 110-114 35.64765 38.0 36.8 38.0 31.4 38.0 115-119 35.44895 38.0 36.0 38.0 31.0 38.0 120-124 35.2674 38.0 36.0 38.0 29.8 38.0 125-129 35.0772 38.0 35.8 38.0 28.6 38.0 130-134 34.92115 38.0 35.6 38.0 27.8 38.0 135-139 34.4902 38.0 35.0 38.0 26.0 38.0 140-144 33.9445 38.0 35.0 38.0 23.0 38.0 145-149 33.467349999999996 38.0 34.4 38.0 20.2 38.0 150-151 29.624875 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 6.0 4 3.0 5 2.0 6 0.0 7 1.0 8 1.0 9 1.0 10 2.0 11 1.0 12 3.0 13 1.0 14 2.0 15 2.0 16 2.0 17 2.0 18 3.0 19 4.0 20 3.0 21 9.0 22 7.0 23 9.0 24 13.0 25 16.0 26 19.0 27 24.0 28 36.0 29 27.0 30 43.0 31 43.0 32 109.0 33 109.0 34 183.0 35 290.0 36 724.0 37 2294.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.96496496496496 23.723723723723726 10.51051051051051 25.8008008008008 2 26.82011508631474 28.396297222917187 28.171128346259692 16.61245934450838 3 20.17017017017017 28.77877877877878 30.930930930930934 20.12012012012012 4 22.241681260945708 34.10057543157368 24.59344508381286 19.06429822366775 5 25.344008006004504 35.95196397297973 20.715536652489366 17.988491368526393 6 21.6 37.775 20.925 19.7 7 21.175 22.425 36.025 20.375 8 21.125 26.375 26.325 26.174999999999997 9 22.6 25.174999999999997 28.675 23.549999999999997 10-14 23.44 28.875 25.695 21.990000000000002 15-19 23.7 27.950000000000003 26.6 21.75 20-24 23.385 28.134999999999998 26.955000000000002 21.525 25-29 23.369999999999997 28.560000000000002 26.75 21.32 30-34 23.195 28.12 26.56 22.125 35-39 23.73 28.465 26.33 21.475 40-44 23.5 28.04 26.724999999999998 21.735 45-49 23.805 28.395 26.634999999999998 21.165 50-54 22.96 27.85 27.26 21.93 55-59 23.7 27.24 26.72 22.34 60-64 23.75 26.915 27.12 22.215 65-69 23.28 27.195000000000004 27.51 22.015 70-74 24.2 27.18 26.825 21.795 75-79 24.355 27.425 26.724999999999998 21.495 80-84 23.785 27.439999999999998 26.695 22.08 85-89 24.224999999999998 27.694999999999997 26.06 22.02 90-94 24.19 28.1 26.69 21.02 95-99 24.18 27.92 26.405 21.495 100-104 24.404999999999998 27.169999999999998 26.740000000000002 21.685 105-109 24.455 26.534999999999997 27.67 21.34 110-114 23.919999999999998 27.79 26.640000000000004 21.65 115-119 24.3 27.765 26.525 21.41 120-124 24.43 28.000000000000004 26.474999999999998 21.095 125-129 24.555 27.54 26.66 21.245 130-134 24.07 27.065 26.985 21.88 135-139 24.525 27.295 26.825 21.355 140-144 24.97 27.425 26.745 20.86 145-149 25.135 26.450000000000003 27.279999999999998 21.135 150-151 25.2375 28.050000000000004 25.3 21.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 1.5 25 2.0 26 2.0 27 2.5 28 1.5 29 4.5 30 9.5 31 12.5 32 16.5 33 20.5 34 33.0 35 53.5 36 65.0 37 82.5 38 117.0 39 152.0 40 174.0 41 198.5 42 219.0 43 240.5 44 260.5 45 267.5 46 266.0 47 262.0 48 243.5 49 219.5 50 192.5 51 147.5 52 132.0 53 125.0 54 106.5 55 84.0 56 65.5 57 52.0 58 37.0 59 27.0 60 20.5 61 17.0 62 16.0 63 15.0 64 10.0 65 5.5 66 2.5 67 2.5 68 2.5 69 1.0 70 1.5 71 1.5 72 1.0 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.075 3 0.1 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.86018237082067 97.575 2 0.9878419452887538 1.95 3 0.12664640324214793 0.375 4 0.025329280648429587 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 1.05 0.0 0.0 0.0 0.0 120-121 1.25 0.0 0.0 0.0 0.0 122-123 1.4249999999999998 0.0 0.0 0.0 0.0 124-125 1.6375000000000002 0.0 0.0 0.0 0.0 126-127 1.7625 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.3 0.0 0.0 0.0 0.0 132-133 2.6375 0.0 0.0 0.0 0.0 134-135 2.8499999999999996 0.0 0.0 0.0 0.0 136-137 3.1875 0.0 0.0 0.0 0.0 138-139 3.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra Read 1176258 spots for SRR7030804.sra Written 1176258 spots for SRR7030804.sra Read 1176240 spots for SRR7030804.sra Written 1176240 spots for SRR7030804.sra SRR ids: ['SRR7030804.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5awz6hwj SRR7030804.sra spots: 23524818 blocks: [[1, 1176240], [1176241, 2352480], [2352481, 3528720], [3528721, 4704960], [4704961, 5881200], [5881201, 7057440], [7057441, 8233680], [8233681, 9409920], [9409921, 10586160], [10586161, 11762400], [11762401, 12938640], [12938641, 14114880], [14114881, 15291120], [15291121, 16467360], [16467361, 17643600], [17643601, 18819840], [18819841, 19996080], [19996081, 21172320], [21172321, 22348560], [22348561, 23524818]] SRR7030804 file size 7950088 SRR7030804 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030804 SRR7030804_1.fastq SRR7030804_2.fastq Input file: SRR7030804_1.fastq Paired file: SRR7030804_2.fastq trimmed: SRR7030804-trimmed-pair1.fastq, SRR7030804-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:42:37 2025 >> started Wed Feb 12 18:43:04 2025 >> done (26.331s) 23524818 read pairs processed; of these: 27599 ( 0.12%) short read pairs filtered out after trimming by size control 23415 ( 0.10%) empty read pairs filtered out after trimming by size control 23473804 (99.78%) read pairs available; of these: 9094397 (38.74%) trimmed read pairs available after processing 14379407 (61.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 3 0.00% 21 4 0.00% 22 10 0.00% 23 7 0.00% 24 11 0.00% 25 10 0.00% 26 6 0.00% 27 11 0.00% 28 13 0.00% 29 9 0.00% 30 6 0.00% 31 9 0.00% 32 12 0.00% 33 9 0.00% 34 9 0.00% 35 5 0.00% 36 4 0.00% 37 7 0.00% 38 9 0.00% 39 8 0.00% 40 11 0.00% 41 13 0.00% 42 12 0.00% 43 13 0.00% 44 13 0.00% 45 20 0.00% 46 14 0.00% 47 17 0.00% 48 18 0.00% 49 26 0.00% 50 25 0.00% 51 35 0.00% 52 31 0.00% 53 31 0.00% 54 38 0.00% 55 36 0.00% 56 50 0.00% 57 48 0.00% 58 49 0.00% 59 77 0.00% 60 71 0.00% 61 94 0.00% 62 83 0.00% 63 88 0.00% 64 103 0.00% 65 123 0.00% 66 147 0.00% 67 153 0.00% 68 156 0.00% 69 220 0.00% 70 277 0.00% 71 252 0.00% 72 347 0.00% 73 371 0.00% 74 392 0.00% 75 478 0.00% 76 534 0.00% 77 666 0.00% 78 642 0.00% 79 800 0.00% 80 863 0.00% 81 1028 0.00% 82 1110 0.00% 83 1466 0.01% 84 2778 0.01% 85 3793 0.02% 86 4032 0.02% 87 4369 0.02% 88 4767 0.02% 89 4756 0.02% 90 4953 0.02% 91 5135 0.02% 92 5497 0.02% 93 5683 0.02% 94 6134 0.03% 95 6270 0.03% 96 6694 0.03% 97 6956 0.03% 98 7563 0.03% 99 7946 0.03% 100 8571 0.04% 101 9069 0.04% 102 9714 0.04% 103 10558 0.04% 104 11269 0.05% 105 12269 0.05% 106 12790 0.05% 107 13804 0.06% 108 14660 0.06% 109 15191 0.06% 110 16037 0.07% 111 17672 0.08% 112 18873 0.08% 113 19860 0.08% 114 21499 0.09% 115 22926 0.10% 116 24188 0.10% 117 26044 0.11% 118 27169 0.12% 119 27915 0.12% 120 29723 0.13% 121 30954 0.13% 122 32729 0.14% 123 34576 0.15% 124 36962 0.16% 125 39216 0.17% 126 41476 0.18% 127 43317 0.18% 128 45766 0.19% 129 47983 0.20% 130 50315 0.21% 131 52972 0.23% 132 56687 0.24% 133 60311 0.26% 134 64557 0.28% 135 68833 0.29% 136 74115 0.32% 137 80115 0.34% 138 86343 0.37% 139 94224 0.40% 140 98348 0.42% 141 107130 0.46% 142 118520 0.50% 143 133512 0.57% 144 154704 0.66% 145 184526 0.79% 146 230878 0.98% 147 313150 1.33% 148 469858 2.00% 149 929668 3.96% 150 4844310 20.64% 151 14379407 61.26% 23473804 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=36 prefix-density=0.27 prefix-fanout=2.3 sequence=GTGGACTCCTTCTGGATGTTGTAGTCAGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=291.53 fanout-score-rank=1 prefix-density=1.23 prefix-fanout=29.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=40 prefix-density=0.68 prefix-fanout=2.0 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=81.69 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=7.3 sequence=AACTCTCTTGCAACCTGAAACAGGGAAACCAGTTAGTCGGGAACCAAAATCAAGGCTATGGCATCACTAGCAACCTTTGCTGCAGTGCAACCGGCCACCATCAAAGGCCTTGGTGGTAGCTCCCTCAGTGGAACCAAGCTCCATGTTAAACCATCACGCCAGGGCTTAAGACCCAAAAGCTTGAGGAGTGGTGCTGTGGTGGCCAAGTATGGTGACAAGAGTGTCTACTTTGATTTGGAGGATTTGGGCAACACTACTGGGCAATGGGACTTGTATGGATCTGATGCACCTTCACCATACAACCCTCTCCAGAGCAAATTCTTTGAGACATTTG SRR7030804 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:43:51 Started mapping on | Feb 12 18:43:51 Finished on | Feb 12 18:46:21 Mapping speed, Million of reads per hour | 563.37 Number of input reads | 23473804 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 21490988 Uniquely mapped reads % | 91.55% Average mapped length | 296.51 Number of splices: Total | 22356007 Number of splices: Annotated (sjdb) | 22017087 Number of splices: GT/AG | 21967450 Number of splices: GC/AG | 318673 Number of splices: AT/AC | 19167 Number of splices: Non-canonical | 50717 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 704153 % of reads mapped to multiple loci | 3.00% Number of reads mapped to too many loci | 858088 % of reads mapped to too many loci | 3.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.34% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1308228 1308228 1308228 N_multimapping 704153 704153 704153 N_noFeature 467736 21247862 549384 N_ambiguous 301648 999 139521 UnstrandedReadsAssigned:20721604 PositiveStrandReadsAssigned:242127 NegativeStrandReadsAssigned:20802083 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030804 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030804-trimmed-pair1.fastq SRR7030804-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,473,804 reads, 21,436,949 reads pseudoaligned [quant] estimated average fragment length: 245.986 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR7030804.ke.tsv 34699 SRR7030804.se.tsv 87100 total ==> SRR7030804.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.01 871 14.6382 Potri.005G024800.1.v4.1 1035 790.014 252 9.50488 Potri.004G059700.1.v4.1 961 716.021 16 0.665849 Potri.007G009000.2.v4.1 1416 1171.01 0 0 Potri.003G141000.2.v4.1 2943 2698.01 352 3.88758 Potri.016G087400.1.v4.1 270 72.3195 2144.5 883.591 Potri.015G069301.1.v4.1 564 322.468 0 0 Potri.010G195200.1.v4.1 1773 1528.01 3 0.0585026 Potri.012G127500.1.v4.1 977 732.021 6609 269.026 ==> SRR7030804.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 512 Potri.001G212900.v4.1 76 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7030804 completed mapping pipeline successfully