Starting /dee2/code/volunteer_pipeline.sh SRR7030805 current disk space = 3051153203200 free memory = 1579484292 SRR7030805 SRAfilesize f0307fd8de4ae018b1649d4f8673c405 SRR7030805.sra SRR7030805.sra file validated SRR7030805 is paired end SRR7030805 is conventional basespace SRR7030805 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030805_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.31425 33.0 33.0 34.0 25.0 34.0 2 32.29275 33.0 33.0 34.0 28.0 34.0 3 32.652 33.0 33.0 34.0 29.0 34.0 4 31.19925 33.0 31.0 33.0 28.0 34.0 5 32.53925 33.0 33.0 33.0 32.0 34.0 6 35.80025 38.0 36.0 38.0 31.0 38.0 7 36.63025 38.0 37.0 38.0 34.0 38.0 8 37.2245 38.0 38.0 38.0 36.0 38.0 9 37.41275 38.0 38.0 38.0 37.0 38.0 10-14 37.45615 38.0 38.0 38.0 37.0 38.0 15-19 37.48735 38.0 38.0 38.0 37.0 38.0 20-24 37.42285 38.0 38.0 38.0 37.0 38.0 25-29 37.47325 38.0 38.0 38.0 37.2 38.0 30-34 37.3776 38.0 38.0 38.0 37.0 38.0 35-39 37.36755 38.0 38.0 38.0 37.0 38.0 40-44 37.380849999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.3369 38.0 38.0 38.0 37.0 38.0 50-54 37.3214 38.0 38.0 38.0 37.0 38.0 55-59 37.24325 38.0 38.0 38.0 37.0 38.0 60-64 37.21345 38.0 38.0 38.0 36.6 38.0 65-69 37.071 38.0 38.0 38.0 36.0 38.0 70-74 37.08995 38.0 38.0 38.0 36.0 38.0 75-79 37.02284999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.9769 38.0 38.0 38.0 35.8 38.0 85-89 36.91265 38.0 38.0 38.0 35.4 38.0 90-94 36.70775 38.0 38.0 38.0 35.0 38.0 95-99 36.58695 38.0 38.0 38.0 34.2 38.0 100-104 36.565200000000004 38.0 38.0 38.0 34.2 38.0 105-109 36.43815 38.0 38.0 38.0 34.0 38.0 110-114 36.40235 38.0 38.0 38.0 34.0 38.0 115-119 36.1637 38.0 37.0 38.0 33.6 38.0 120-124 36.0523 38.0 37.0 38.0 33.0 38.0 125-129 35.86905 38.0 36.8 38.0 32.6 38.0 130-134 35.45399999999999 38.0 36.0 38.0 30.2 38.0 135-139 35.2845 38.0 36.0 38.0 30.6 38.0 140-144 34.95969999999999 38.0 35.6 38.0 28.4 38.0 145-149 34.6635 38.0 35.2 38.0 28.2 38.0 150-151 31.280375 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 4.0 20 2.0 21 5.0 22 3.0 23 4.0 24 6.0 25 10.0 26 21.0 27 19.0 28 21.0 29 21.0 30 40.0 31 44.0 32 74.0 33 98.0 34 165.0 35 245.0 36 647.0 37 2566.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.75283937263386 13.304488912925905 7.057869118442402 36.88480259599783 2 21.555388847211805 14.278569642410602 33.58339584896224 30.582645661415352 3 17.1 17.849999999999998 27.650000000000002 37.4 4 20.424999999999997 27.3 23.474999999999998 28.799999999999997 5 22.42242242242242 29.554554554554553 25.400400400400404 22.62262262262262 6 18.625 34.5 26.275 20.599999999999998 7 15.625 26.200000000000003 40.925 17.25 8 17.25 26.5 30.7 25.55 9 16.900000000000002 25.174999999999997 34.575 23.35 10-14 20.095 29.909999999999997 27.150000000000002 22.845 15-19 19.85 29.18 27.79 23.18 20-24 20.080000000000002 29.145 27.325 23.45 25-29 19.445 28.79 27.889999999999997 23.875 30-34 19.855 28.410000000000004 27.950000000000003 23.785 35-39 19.74 28.575 27.560000000000002 24.125 40-44 19.865 28.535 27.555000000000003 24.044999999999998 45-49 20.59 28.28 27.065 24.065 50-54 20.035 28.275 27.810000000000002 23.880000000000003 55-59 20.200000000000003 28.65 27.744999999999997 23.405 60-64 19.61 28.305000000000003 27.755000000000003 24.33 65-69 20.095 27.74 28.285 23.880000000000003 70-74 20.474999999999998 28.645 27.605 23.275000000000002 75-79 20.47 28.299999999999997 27.155 24.075 80-84 20.335 28.025 28.189999999999998 23.45 85-89 20.115 28.115000000000002 27.74 24.03 90-94 20.560000000000002 27.42 27.544999999999998 24.474999999999998 95-99 20.465 27.57 27.51 24.455 100-104 20.645 27.68 27.495000000000005 24.18 105-109 20.705000000000002 27.715 27.584999999999997 23.995 110-114 20.68 27.615000000000002 27.55 24.154999999999998 115-119 21.18 28.165000000000003 27.279999999999998 23.375 120-124 20.485 28.18 27.650000000000002 23.685000000000002 125-129 21.060000000000002 27.435 27.544999999999998 23.96 130-134 21.095 27.425 27.91 23.57 135-139 21.044999999999998 27.889999999999997 27.305 23.76 140-144 20.885 27.805000000000003 27.245 24.065 145-149 21.085 27.865000000000002 27.27 23.78 150-151 20.524072216649948 27.520060180541623 27.820962888665996 24.134904714142426 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 2.5 25 4.0 26 5.5 27 7.5 28 9.5 29 9.5 30 13.0 31 20.0 32 28.5 33 35.5 34 48.5 35 72.0 36 85.0 37 103.5 38 134.0 39 166.5 40 199.5 41 221.5 42 233.5 43 247.0 44 276.0 45 283.5 46 261.0 47 249.5 48 228.5 49 200.0 50 178.5 51 148.0 52 121.0 53 103.5 54 79.5 55 52.5 56 31.5 57 26.5 58 29.0 59 25.0 60 18.0 61 9.5 62 6.5 63 6.0 64 5.0 65 4.0 66 2.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.55 2 0.025 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.9125000000000001 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.1125 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.6125 0.0 0.0 0.0 0.0 124-125 1.8624999999999998 0.0 0.0 0.0 0.0 126-127 2.125 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.5625 0.0 0.0 0.0 0.0 132-133 2.925 0.0 0.0 0.0 0.0 134-135 3.1625 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGACT 10 0.0056249425 154.6 1 CTGACTC 10 0.0068396386 144.9375 2 GTGAGAT 10 0.0068396386 144.9375 2 ACATAAG 10 0.0068396386 144.9375 8 >>END_MODULE SRR7030805 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030805_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6425 33.0 33.0 34.0 32.0 34.0 2 32.6525 33.0 33.0 34.0 32.0 34.0 3 32.742 33.0 33.0 34.0 32.0 34.0 4 32.732 33.0 33.0 34.0 32.0 34.0 5 32.65225 33.0 33.0 34.0 32.0 34.0 6 36.96475 38.0 38.0 38.0 36.0 38.0 7 37.0085 38.0 38.0 38.0 36.0 38.0 8 36.93025 38.0 38.0 38.0 36.0 38.0 9 36.961 38.0 38.0 38.0 36.0 38.0 10-14 36.9034 38.0 38.0 38.0 36.0 38.0 15-19 36.761 38.0 38.0 38.0 35.2 38.0 20-24 36.78895000000001 38.0 38.0 38.0 35.8 38.0 25-29 36.71335 38.0 38.0 38.0 35.8 38.0 30-34 36.771 38.0 38.0 38.0 35.4 38.0 35-39 36.6456 38.0 38.0 38.0 35.2 38.0 40-44 36.50750000000001 38.0 38.0 38.0 34.8 38.0 45-49 36.4534 38.0 38.0 38.0 34.2 38.0 50-54 36.48595 38.0 38.0 38.0 34.4 38.0 55-59 36.4317 38.0 38.0 38.0 34.0 38.0 60-64 36.397000000000006 38.0 38.0 38.0 34.0 38.0 65-69 36.280150000000006 38.0 38.0 38.0 34.0 38.0 70-74 36.288650000000004 38.0 38.0 38.0 33.8 38.0 75-79 36.260149999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.186049999999994 38.0 38.0 38.0 33.6 38.0 85-89 36.11155 38.0 37.8 38.0 33.4 38.0 90-94 35.9553 38.0 37.2 38.0 33.2 38.0 95-99 35.85825 38.0 37.0 38.0 32.4 38.0 100-104 35.45725 38.0 36.8 38.0 30.2 38.0 105-109 35.36245 38.0 36.2 38.0 29.4 38.0 110-114 35.0587 38.0 36.0 38.0 27.8 38.0 115-119 34.8889 38.0 36.0 38.0 27.4 38.0 120-124 34.777249999999995 38.0 35.6 38.0 27.2 38.0 125-129 34.4907 38.0 35.2 38.0 25.6 38.0 130-134 34.32235 38.0 35.0 38.0 24.6 38.0 135-139 33.88699999999999 38.0 34.8 38.0 22.6 38.0 140-144 33.21755 38.0 34.0 38.0 15.8 38.0 145-149 32.69575 38.0 33.8 38.0 13.8 38.0 150-151 28.72175 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 4.0 5 2.0 6 1.0 7 0.0 8 2.0 9 2.0 10 2.0 11 0.0 12 1.0 13 4.0 14 2.0 15 1.0 16 3.0 17 6.0 18 6.0 19 8.0 20 4.0 21 11.0 22 11.0 23 17.0 24 22.0 25 26.0 26 32.0 27 24.0 28 32.0 29 47.0 30 59.0 31 69.0 32 107.0 33 122.0 34 198.0 35 309.0 36 714.0 37 2135.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.09637046307885 24.030037546933666 11.414267834793492 27.459324155193993 2 26.608260325406757 28.010012515644554 29.13642052565707 16.245306633291616 3 19.64956195244055 29.311639549436798 31.53942428035044 19.499374217772214 4 23.2540675844806 33.892365456821025 24.25531914893617 18.598247809762203 5 23.992994746059544 36.15211408556417 21.56617463097323 18.28871653740305 6 20.724999999999998 37.675 23.375 18.224999999999998 7 20.349999999999998 23.200000000000003 36.9 19.55 8 21.8 26.875 26.950000000000003 24.375 9 20.95 26.0 29.4 23.65 10-14 23.794999999999998 28.994999999999997 25.765 21.445 15-19 23.115 28.65 27.075 21.16 20-24 22.759999999999998 29.04 26.790000000000003 21.41 25-29 23.380000000000003 28.365000000000002 26.979999999999997 21.275 30-34 23.419999999999998 28.294999999999998 27.169999999999998 21.115000000000002 35-39 23.31 28.689999999999998 27.195000000000004 20.805 40-44 23.195 28.43 27.445000000000004 20.93 45-49 23.150000000000002 27.76 27.865000000000002 21.224999999999998 50-54 23.57 28.060000000000002 27.375 20.995 55-59 23.195 27.625 27.834999999999997 21.345 60-64 23.34 28.165000000000003 27.325 21.17 65-69 23.365 27.52 27.950000000000003 21.165 70-74 23.75 27.639999999999997 27.095000000000002 21.515 75-79 23.52 27.765 27.389999999999997 21.325 80-84 23.61 28.12 27.195000000000004 21.075 85-89 24.08 27.565 27.485 20.87 90-94 23.549999999999997 28.1 27.295 21.055 95-99 23.585 28.125 27.439999999999998 20.849999999999998 100-104 24.595 27.800000000000004 26.955000000000002 20.65 105-109 24.12 27.47 27.689999999999998 20.72 110-114 23.395 28.384999999999998 27.24 20.979999999999997 115-119 23.87 28.165000000000003 26.8 21.165 120-124 24.0 28.1 27.875 20.025000000000002 125-129 24.09 28.115000000000002 27.265 20.53 130-134 23.695 28.16 27.334999999999997 20.810000000000002 135-139 24.23 27.555000000000003 27.435 20.78 140-144 24.884999999999998 28.02 26.75 20.345 145-149 23.955000000000002 28.325 26.965 20.755000000000003 150-151 24.821808178066775 27.522821057896714 27.49781167937977 20.157559084656747 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.5 27 2.5 28 2.5 29 7.0 30 10.5 31 10.5 32 13.0 33 22.0 34 38.0 35 57.0 36 80.5 37 103.5 38 131.0 39 170.0 40 211.5 41 234.5 42 234.0 43 247.0 44 281.5 45 291.5 46 279.0 47 265.0 48 242.0 49 220.0 50 194.0 51 148.5 52 109.0 53 91.0 54 71.0 55 54.0 56 44.5 57 36.5 58 26.0 59 15.5 60 13.5 61 10.5 62 6.0 63 4.5 64 3.5 65 1.5 66 1.5 67 1.5 68 0.5 69 0.5 70 1.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.125 3 0.125 4 0.125 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.9125000000000001 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.4 0.0 0.0 0.0 0.0 130-131 2.6375 0.0 0.0 0.0 0.0 132-133 3.0125 0.0 0.0 0.0 0.0 134-135 3.2375 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 3.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGGT 10 0.006830828 145.0 8 >>END_MODULE Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra Read 1174360 spots for SRR7030805.sra Written 1174360 spots for SRR7030805.sra SRR ids: ['SRR7030805.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pxc9wny2 SRR7030805.sra spots: 23487200 blocks: [[1, 1174360], [1174361, 2348720], [2348721, 3523080], [3523081, 4697440], [4697441, 5871800], [5871801, 7046160], [7046161, 8220520], [8220521, 9394880], [9394881, 10569240], [10569241, 11743600], [11743601, 12917960], [12917961, 14092320], [14092321, 15266680], [15266681, 16441040], [16441041, 17615400], [17615401, 18789760], [18789761, 19964120], [19964121, 21138480], [21138481, 22312840], [22312841, 23487200]] SRR7030805 file size 7937341 SRR7030805 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030805 SRR7030805_1.fastq SRR7030805_2.fastq Input file: SRR7030805_1.fastq Paired file: SRR7030805_2.fastq trimmed: SRR7030805-trimmed-pair1.fastq, SRR7030805-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:17:16 2025 >> started Wed Feb 12 19:17:42 2025 >> done (25.961s) 23487200 read pairs processed; of these: 20581 ( 0.09%) short read pairs filtered out after trimming by size control 17965 ( 0.08%) empty read pairs filtered out after trimming by size control 23448654 (99.84%) read pairs available; of these: 9236740 (39.39%) trimmed read pairs available after processing 14211914 (60.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 4 0.00% 21 6 0.00% 22 11 0.00% 23 9 0.00% 24 8 0.00% 25 11 0.00% 26 7 0.00% 27 9 0.00% 28 10 0.00% 29 13 0.00% 30 13 0.00% 31 6 0.00% 32 10 0.00% 33 6 0.00% 34 11 0.00% 35 7 0.00% 36 12 0.00% 37 14 0.00% 38 12 0.00% 39 7 0.00% 40 20 0.00% 41 15 0.00% 42 19 0.00% 43 17 0.00% 44 12 0.00% 45 31 0.00% 46 27 0.00% 47 24 0.00% 48 28 0.00% 49 38 0.00% 50 32 0.00% 51 46 0.00% 52 54 0.00% 53 42 0.00% 54 66 0.00% 55 62 0.00% 56 67 0.00% 57 80 0.00% 58 97 0.00% 59 106 0.00% 60 140 0.00% 61 161 0.00% 62 148 0.00% 63 169 0.00% 64 235 0.00% 65 214 0.00% 66 274 0.00% 67 273 0.00% 68 346 0.00% 69 387 0.00% 70 435 0.00% 71 459 0.00% 72 564 0.00% 73 553 0.00% 74 660 0.00% 75 750 0.00% 76 912 0.00% 77 1004 0.00% 78 1090 0.00% 79 1297 0.01% 80 1456 0.01% 81 1596 0.01% 82 1833 0.01% 83 2140 0.01% 84 3387 0.01% 85 4324 0.02% 86 4625 0.02% 87 5069 0.02% 88 5519 0.02% 89 5631 0.02% 90 5910 0.03% 91 6269 0.03% 92 6768 0.03% 93 7168 0.03% 94 7573 0.03% 95 8115 0.03% 96 8734 0.04% 97 9312 0.04% 98 9721 0.04% 99 10580 0.05% 100 11025 0.05% 101 11550 0.05% 102 12538 0.05% 103 13575 0.06% 104 14346 0.06% 105 15262 0.07% 106 16614 0.07% 107 17049 0.07% 108 18089 0.08% 109 19087 0.08% 110 20157 0.09% 111 21350 0.09% 112 22533 0.10% 113 23956 0.10% 114 25158 0.11% 115 27070 0.12% 116 28672 0.12% 117 30196 0.13% 118 31444 0.13% 119 32531 0.14% 120 33661 0.14% 121 35427 0.15% 122 36804 0.16% 123 38806 0.17% 124 40926 0.17% 125 42371 0.18% 126 45220 0.19% 127 47449 0.20% 128 50251 0.21% 129 52245 0.22% 130 56038 0.24% 131 57249 0.24% 132 61034 0.26% 133 64228 0.27% 134 68063 0.29% 135 72898 0.31% 136 78000 0.33% 137 83544 0.36% 138 90213 0.38% 139 98690 0.42% 140 104091 0.44% 141 112469 0.48% 142 123226 0.53% 143 138469 0.59% 144 159455 0.68% 145 189050 0.81% 146 235797 1.01% 147 317493 1.35% 148 473488 2.02% 149 921124 3.93% 150 4769878 20.34% 151 14211914 60.61% 23448654 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=40 prefix-density=0.25 prefix-fanout=1.9 sequence=ACTGATTCCTTTGCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=135.02 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=23.4 sequence=CCTTCTTCTTGA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=34 prefix-density=0.30 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=285.23 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=24.3 sequence=AAGAAGAAAAACAGTTTCTCAAGAGCAGTATATATAGATCTTTCAGAAGAATTAAGGAGATGGCAGACGAGGGAACAGCTACTTGCATAGACATCTTGTTGGCCATCATCTTGCCTCCGCTTGGTGTCTTCCTCAAGTT SRR7030805 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:18:27 Started mapping on | Feb 12 19:18:28 Finished on | Feb 12 19:20:30 Mapping speed, Million of reads per hour | 691.93 Number of input reads | 23448654 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 22219547 Uniquely mapped reads % | 94.76% Average mapped length | 295.89 Number of splices: Total | 21330592 Number of splices: Annotated (sjdb) | 20988484 Number of splices: GT/AG | 20960715 Number of splices: GC/AG | 302887 Number of splices: AT/AC | 17055 Number of splices: Non-canonical | 49935 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 710498 % of reads mapped to multiple loci | 3.03% Number of reads mapped to too many loci | 209486 % of reads mapped to too many loci | 0.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.19% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 543144 543144 543144 N_multimapping 710498 710498 710498 N_noFeature 391180 21977641 501469 N_ambiguous 249564 1278 117155 UnstrandedReadsAssigned:21578803 PositiveStrandReadsAssigned:240628 NegativeStrandReadsAssigned:21600923 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030805 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030805-trimmed-pair1.fastq SRR7030805-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,448,654 reads, 21,756,773 reads pseudoaligned [quant] estimated average fragment length: 245.649 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52401 SRR7030805.ke.tsv 34699 SRR7030805.se.tsv 87100 total ==> SRR7030805.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.35 2936 53.5479 Potri.005G024800.1.v4.1 1035 790.351 1490 60.9744 Potri.004G059700.1.v4.1 961 716.376 41 1.85108 Potri.007G009000.2.v4.1 1416 1171.35 1 0.0276118 Potri.003G141000.2.v4.1 2943 2698.35 661 7.9229 Potri.016G087400.1.v4.1 270 73.384 1408.89 620.952 Potri.015G069301.1.v4.1 564 322.512 0 0 Potri.010G195200.1.v4.1 1773 1528.35 109 2.30667 Potri.012G127500.1.v4.1 977 732.366 8423 371.98 ==> SRR7030805.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 445 Potri.001G212900.v4.1 52 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 107 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR7030805 completed mapping pipeline successfully