Starting /dee2/code/volunteer_pipeline.sh SRR7030806 current disk space = 3051209609216 free memory = 1541669864 SRR7030806 SRAfilesize f60da425490cf4642d8103a0841b0fb9 SRR7030806.sra SRR7030806.sra file validated SRR7030806 is paired end SRR7030806 is conventional basespace SRR7030806 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030806_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.65825 33.0 32.0 33.0 30.0 34.0 2 32.23575 33.0 33.0 34.0 29.0 34.0 3 31.3285 33.0 31.0 33.0 28.0 34.0 4 32.10175 33.0 32.0 33.0 31.0 34.0 5 32.628 33.0 33.0 34.0 32.0 34.0 6 36.97875 38.0 37.0 38.0 36.0 38.0 7 37.46175 38.0 38.0 38.0 37.0 38.0 8 37.4465 38.0 38.0 38.0 37.0 38.0 9 37.55925 38.0 38.0 38.0 38.0 38.0 10-14 37.54815 38.0 38.0 38.0 38.0 38.0 15-19 37.5462 38.0 38.0 38.0 38.0 38.0 20-24 37.51465 38.0 38.0 38.0 38.0 38.0 25-29 37.4811 38.0 38.0 38.0 37.8 38.0 30-34 37.368700000000004 38.0 38.0 38.0 37.6 38.0 35-39 37.427099999999996 38.0 38.0 38.0 37.6 38.0 40-44 37.47835 38.0 38.0 38.0 38.0 38.0 45-49 37.37525000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.3574 38.0 38.0 38.0 37.4 38.0 55-59 37.28245 38.0 38.0 38.0 37.0 38.0 60-64 37.28175 38.0 38.0 38.0 36.8 38.0 65-69 37.203 38.0 38.0 38.0 36.8 38.0 70-74 37.253249999999994 38.0 38.0 38.0 37.0 38.0 75-79 37.1194 38.0 38.0 38.0 36.2 38.0 80-84 36.95290000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.7701 38.0 38.0 38.0 35.2 38.0 90-94 36.7874 38.0 38.0 38.0 35.0 38.0 95-99 36.81345 38.0 38.0 38.0 35.2 38.0 100-104 36.6535 38.0 38.0 38.0 34.8 38.0 105-109 36.50255 38.0 38.0 38.0 34.0 38.0 110-114 36.2256 38.0 38.0 38.0 33.6 38.0 115-119 36.17615000000001 38.0 37.8 38.0 33.8 38.0 120-124 35.99025 38.0 37.2 38.0 32.8 38.0 125-129 35.78725 38.0 37.0 38.0 31.6 38.0 130-134 35.5072 38.0 36.4 38.0 30.6 38.0 135-139 35.161150000000006 38.0 35.8 38.0 29.8 38.0 140-144 34.40310000000001 38.0 35.0 38.0 24.0 38.0 145-149 34.13645 38.0 34.6 38.0 24.2 38.0 150-151 30.042125 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 3.0 20 2.0 21 3.0 22 3.0 23 7.0 24 12.0 25 11.0 26 15.0 27 16.0 28 29.0 29 35.0 30 30.0 31 53.0 32 65.0 33 106.0 34 146.0 35 258.0 36 583.0 37 2617.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.68441064638783 11.913814955640051 8.44106463878327 38.960709759188845 2 22.125 14.075 35.35 28.449999999999996 3 20.65 16.900000000000002 27.775 34.675 4 23.075000000000003 24.725 23.65 28.549999999999997 5 23.39254440830623 30.222667000250187 24.69352014010508 21.691268451338505 6 19.325 35.125 24.7 20.849999999999998 7 14.674999999999999 27.125 40.150000000000006 18.05 8 16.875 26.05 31.5 25.575 9 16.900000000000002 24.45 34.25 24.4 10-14 19.325 30.025000000000002 27.400000000000002 23.25 15-19 19.56 28.98 27.33 24.13 20-24 19.88 28.389999999999997 27.689999999999998 24.04 25-29 19.42 28.720000000000002 27.48 24.38 30-34 20.419999999999998 28.27 27.49 23.82 35-39 20.064999999999998 27.6 28.37 23.965 40-44 19.435 28.575 27.744999999999997 24.245 45-49 19.84 27.865000000000002 28.255000000000003 24.04 50-54 19.869999999999997 28.194999999999997 27.700000000000003 24.235 55-59 20.82 27.41 27.775 23.995 60-64 20.05 27.61 28.13 24.21 65-69 20.285 27.915 27.37 24.43 70-74 19.885 27.625 28.04 24.45 75-79 19.99 27.93 27.834999999999997 24.245 80-84 19.935 27.955000000000002 27.465 24.645 85-89 20.415 28.1 27.815 23.669999999999998 90-94 20.395 27.765 27.485 24.355 95-99 20.05 27.66 28.134999999999998 24.154999999999998 100-104 20.7 28.444999999999997 27.015 23.84 105-109 21.099999999999998 27.295 27.544999999999998 24.060000000000002 110-114 20.69 27.555000000000003 27.99 23.765 115-119 20.72 28.035 27.425 23.82 120-124 21.015 27.565 27.075 24.345 125-129 20.979999999999997 27.07 28.095 23.855 130-134 21.154999999999998 27.295 27.865000000000002 23.685000000000002 135-139 20.935000000000002 27.365000000000002 27.750000000000004 23.95 140-144 21.349999999999998 27.485 27.084999999999997 24.08 145-149 20.845 27.575 27.52 24.060000000000002 150-151 20.525 27.725 27.900000000000002 23.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 4.0 25 4.5 26 5.0 27 7.0 28 7.5 29 10.0 30 13.0 31 19.0 32 30.0 33 43.0 34 57.5 35 66.5 36 81.0 37 98.5 38 126.0 39 149.0 40 169.0 41 204.5 42 246.0 43 252.5 44 248.5 45 254.0 46 261.0 47 263.5 48 246.5 49 213.5 50 183.5 51 166.0 52 126.0 53 105.0 54 86.5 55 59.5 56 44.0 57 35.5 58 34.0 59 23.0 60 10.0 61 7.5 62 7.0 63 6.0 64 5.0 65 3.5 66 3.0 67 2.0 68 2.0 69 2.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.2 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5125 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 1.8875 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.3875 0.0 0.0 0.0 0.0 136-137 2.6125 0.0 0.0 0.0 0.0 138-139 2.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAATA 10 0.006577216 146.82278 1 >>END_MODULE SRR7030806 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030806_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97125 34.0 33.0 34.0 32.0 34.0 2 33.07875 34.0 33.0 34.0 32.0 34.0 3 33.0165 34.0 33.0 34.0 32.0 34.0 4 33.0035 34.0 33.0 34.0 32.0 34.0 5 33.04125 34.0 33.0 34.0 33.0 34.0 6 37.2435 38.0 38.0 38.0 37.0 38.0 7 37.269 38.0 38.0 38.0 37.0 38.0 8 37.22025 38.0 38.0 38.0 37.0 38.0 9 37.20425 38.0 38.0 38.0 37.0 38.0 10-14 37.2639 38.0 38.0 38.0 37.4 38.0 15-19 37.210750000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.1375 38.0 38.0 38.0 37.0 38.0 25-29 37.0937 38.0 38.0 38.0 37.0 38.0 30-34 37.0726 38.0 38.0 38.0 37.0 38.0 35-39 37.0463 38.0 38.0 38.0 37.0 38.0 40-44 37.00125 38.0 38.0 38.0 36.8 38.0 45-49 36.87885000000001 38.0 38.0 38.0 36.4 38.0 50-54 36.86749999999999 38.0 38.0 38.0 36.2 38.0 55-59 36.874 38.0 38.0 38.0 36.0 38.0 60-64 36.81895 38.0 38.0 38.0 35.8 38.0 65-69 36.81705 38.0 38.0 38.0 36.0 38.0 70-74 36.566050000000004 38.0 38.0 38.0 34.6 38.0 75-79 36.4234 38.0 38.0 38.0 34.2 38.0 80-84 36.59165 38.0 38.0 38.0 35.0 38.0 85-89 36.551849999999995 38.0 38.0 38.0 34.8 38.0 90-94 36.53855 38.0 38.0 38.0 35.0 38.0 95-99 36.3536 38.0 38.0 38.0 34.0 38.0 100-104 36.0811 38.0 37.8 38.0 33.6 38.0 105-109 35.971799999999995 38.0 38.0 38.0 33.0 38.0 110-114 35.904399999999995 38.0 37.4 38.0 32.6 38.0 115-119 35.67755 38.0 37.2 38.0 32.2 38.0 120-124 35.28735 38.0 36.4 38.0 29.4 38.0 125-129 34.966750000000005 38.0 36.0 38.0 28.0 38.0 130-134 34.875150000000005 38.0 35.8 38.0 27.6 38.0 135-139 34.4359 38.0 34.8 38.0 25.2 38.0 140-144 33.75505 38.0 33.0 38.0 22.6 38.0 145-149 32.9174 38.0 33.2 38.0 14.8 38.0 150-151 28.647 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 6.0 4 2.0 5 1.0 6 1.0 7 2.0 8 1.0 9 1.0 10 2.0 11 0.0 12 1.0 13 1.0 14 0.0 15 4.0 16 2.0 17 4.0 18 4.0 19 5.0 20 11.0 21 8.0 22 11.0 23 5.0 24 7.0 25 23.0 26 19.0 27 18.0 28 28.0 29 43.0 30 51.0 31 71.0 32 65.0 33 110.0 34 152.0 35 269.0 36 585.0 37 2479.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.426639959939905 22.58387581372058 12.794191286930396 30.195292939409114 2 25.982478097622025 26.68335419274093 30.688360450563202 16.64580725907384 3 19.779669504256383 29.719579369053577 31.196795192789185 19.303955933900852 4 22.152690863579476 34.618272841051315 25.03128911138924 18.197747183979978 5 23.034551827741613 36.30445668502754 23.309964947421133 17.351026539809713 6 20.0 38.800000000000004 22.3 18.9 7 19.35967983991996 24.062031015507753 35.41770885442722 21.160580290145074 8 21.47147147147147 26.3013013013013 27.027027027027028 25.2002002002002 9 21.099999999999998 24.925 29.849999999999998 24.125 10-14 23.15578894723681 29.89247311827957 25.866466616654165 21.085271317829456 15-19 23.270817704426104 28.442110527631908 27.301825456364092 20.985246311577892 20-24 22.38290632506005 28.432746196957563 27.476981585268213 21.707365892714172 25-29 22.643775964763 28.62505630912458 27.333700385404676 21.397467340707742 30-34 22.84185255576673 28.303491047314193 27.13313994198259 21.72151645493648 35-39 23.091545772886445 28.3991995997999 27.088544272136065 21.42071035517759 40-44 22.847284728472847 28.83788378837884 27.562756275627564 20.75207520752075 45-49 22.78392311927524 28.194604334551276 27.423794984733966 21.597677561439514 50-54 22.89319513294277 28.651544739872815 26.979119723599222 21.476140403585198 55-59 23.110043055972763 27.410633823971164 28.06648643236207 21.412836687694004 60-64 23.026875531755167 28.30188679245283 27.105750462939792 21.56548721285221 65-69 23.222416812609456 28.006004503377536 27.335501626219667 21.436077057793344 70-74 23.20580145036259 28.052013003250813 27.746936734183546 20.99524881220305 75-79 23.155050783008956 27.687997198178817 27.662980937609444 21.49397108120278 80-84 23.90814948221522 27.995397468607734 27.219970984041225 20.876482065135825 85-89 23.445 28.305000000000003 27.065 21.185000000000002 90-94 24.121030257564392 27.861965491372843 27.486871717929485 20.530132533133283 95-99 23.188986232790988 27.043804755944933 28.355444305381727 21.41176470588235 100-104 23.87723426625945 27.712411755870427 27.406999449256496 21.00335452861363 105-109 23.691984178641164 28.147999799729632 27.26180343463676 20.89821258699244 110-114 23.952964723542657 27.865899424568426 27.060295221416062 21.120840630472852 115-119 23.980995248812203 28.097024256064017 27.376844211052763 20.545136284071017 120-124 23.982398239823983 27.77777777777778 27.2977297729773 20.94209420942094 125-129 24.127063531765884 28.299149574787393 27.378689344672335 20.19509754877439 130-134 24.985 28.165000000000003 26.565 20.285 135-139 23.965 27.915 27.765 20.355 140-144 24.912386101932512 27.701011314709124 26.99008711324722 20.396515470111147 145-149 24.671876565474403 27.77276825969342 27.22673078849815 20.328624386334035 150-151 24.48086064548411 28.246184638478862 26.832624468351263 20.440330247685765 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.5 25 1.5 26 2.0 27 3.0 28 4.0 29 7.5 30 12.0 31 21.0 32 30.0 33 38.0 34 46.0 35 54.0 36 76.0 37 107.5 38 132.0 39 165.5 40 209.5 41 242.0 42 245.5 43 256.0 44 270.0 45 275.5 46 276.5 47 246.0 48 224.5 49 214.0 50 173.5 51 139.5 52 120.5 53 94.0 54 69.0 55 50.0 56 41.5 57 35.0 58 31.0 59 24.5 60 16.0 61 9.0 62 8.5 63 8.5 64 5.0 65 3.0 66 1.0 67 0.0 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.125 3 0.15 4 0.125 5 0.15 6 0.0 7 0.05 8 0.1 9 0.0 10-14 0.025 15-19 0.025 20-24 0.08 25-29 0.105 30-34 0.03 35-39 0.05 40-44 0.01 45-49 0.105 50-54 0.145 55-59 0.13 60-64 0.095 65-69 0.075 70-74 0.025 75-79 0.065 80-84 0.055 85-89 0.0 90-94 0.025 95-99 0.125 100-104 0.135 105-109 0.135 110-114 0.075 115-119 0.025 120-124 0.01 125-129 0.05 130-134 0.0 135-139 0.0 140-144 0.13 145-149 0.19 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.7250000000000001 0.0 0.0 0.0 0.0 118-119 0.9125 0.0 0.0 0.0 0.0 120-121 1.05 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.7625000000000002 0.0 0.0 0.0 0.0 130-131 1.9375 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.6625 0.0 0.0 0.0 0.0 138-139 2.8499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTCA 10 0.006830828 145.0 4 >>END_MODULE Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782367 spots for SRR7030806.sra Written 782367 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra Read 782361 spots for SRR7030806.sra Written 782361 spots for SRR7030806.sra SRR ids: ['SRR7030806.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hom21dox SRR7030806.sra spots: 15647226 blocks: [[1, 782361], [782362, 1564722], [1564723, 2347083], [2347084, 3129444], [3129445, 3911805], [3911806, 4694166], [4694167, 5476527], [5476528, 6258888], [6258889, 7041249], [7041250, 7823610], [7823611, 8605971], [8605972, 9388332], [9388333, 10170693], [10170694, 10953054], [10953055, 11735415], [11735416, 12517776], [12517777, 13300137], [13300138, 14082498], [14082499, 14864859], [14864860, 15647226]] SRR7030806 file size 5280631 SRR7030806 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030806 SRR7030806_1.fastq SRR7030806_2.fastq Input file: SRR7030806_1.fastq Paired file: SRR7030806_2.fastq trimmed: SRR7030806-trimmed-pair1.fastq, SRR7030806-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:50:35 2025 >> started Wed Feb 12 18:50:53 2025 >> done (18.717s) 15647226 read pairs processed; of these: 39868 ( 0.25%) short read pairs filtered out after trimming by size control 30974 ( 0.20%) empty read pairs filtered out after trimming by size control 15576384 (99.55%) read pairs available; of these: 5889126 (37.81%) trimmed read pairs available after processing 9687258 (62.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 5 0.00% 21 1 0.00% 22 2 0.00% 23 9 0.00% 24 3 0.00% 25 2 0.00% 26 1 0.00% 27 1 0.00% 28 3 0.00% 29 2 0.00% 30 3 0.00% 31 4 0.00% 32 4 0.00% 33 1 0.00% 34 3 0.00% 35 2 0.00% 36 4 0.00% 37 5 0.00% 38 9 0.00% 39 5 0.00% 40 8 0.00% 41 4 0.00% 42 7 0.00% 43 8 0.00% 44 2 0.00% 45 6 0.00% 46 7 0.00% 47 7 0.00% 48 11 0.00% 49 9 0.00% 50 12 0.00% 51 21 0.00% 52 18 0.00% 53 17 0.00% 54 15 0.00% 55 19 0.00% 56 16 0.00% 57 20 0.00% 58 30 0.00% 59 42 0.00% 60 44 0.00% 61 55 0.00% 62 45 0.00% 63 48 0.00% 64 74 0.00% 65 73 0.00% 66 73 0.00% 67 84 0.00% 68 96 0.00% 69 111 0.00% 70 134 0.00% 71 169 0.00% 72 187 0.00% 73 208 0.00% 74 235 0.00% 75 268 0.00% 76 284 0.00% 77 320 0.00% 78 387 0.00% 79 415 0.00% 80 543 0.00% 81 644 0.00% 82 718 0.00% 83 1038 0.01% 84 2849 0.02% 85 3195 0.02% 86 2787 0.02% 87 2881 0.02% 88 2893 0.02% 89 2943 0.02% 90 3060 0.02% 91 3084 0.02% 92 3239 0.02% 93 3488 0.02% 94 3773 0.02% 95 4215 0.03% 96 4671 0.03% 97 6980 0.04% 98 6704 0.04% 99 4813 0.03% 100 4981 0.03% 101 5199 0.03% 102 5715 0.04% 103 5979 0.04% 104 6232 0.04% 105 6673 0.04% 106 7378 0.05% 107 7653 0.05% 108 8182 0.05% 109 8638 0.06% 110 9076 0.06% 111 9820 0.06% 112 10441 0.07% 113 10979 0.07% 114 11899 0.08% 115 12726 0.08% 116 13282 0.09% 117 14537 0.09% 118 14878 0.10% 119 15681 0.10% 120 16327 0.10% 121 17793 0.11% 122 18713 0.12% 123 19260 0.12% 124 20086 0.13% 125 20869 0.13% 126 22269 0.14% 127 23579 0.15% 128 24561 0.16% 129 25960 0.17% 130 27726 0.18% 131 28866 0.19% 132 30785 0.20% 133 33394 0.21% 134 35776 0.23% 135 37954 0.24% 136 41194 0.26% 137 44446 0.29% 138 48710 0.31% 139 53522 0.34% 140 58263 0.37% 141 65443 0.42% 142 75015 0.48% 143 88444 0.57% 144 109754 0.70% 145 136509 0.88% 146 171130 1.10% 147 219136 1.41% 148 306756 1.97% 149 559824 3.59% 150 3248929 20.86% 151 9687258 62.19% 15576384 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=37 prefix-density=0.18 prefix-fanout=2.2 sequence=GTGGACTCCTTCTGGATGTTGTAGTCAGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=429.28 fanout-score-rank=1 prefix-density=1.17 prefix-fanout=32.0 sequence=CTTCTTCTTGATTATATCAGCCGCCTCACGGTACCTTTGCCTGATAAGCTTTGCGGGTTCACCAGCGTTCCCACTTTCCAATTCTCCAGCACTCATCATGATTGGGTTAATTCCCATCTTGGCAAAGACAAGTTCACACTGGAAGGATTTTCCTTGGCCTTTGCCTCCCCAAACACCCAAGATGAGAGGAACCTTGATATTAGGCAGGCTCATGAAGTTCTTGGAGATGTGAACAACAAGCTTGTCCATGAAAGCAGGAGCAATGTAGAAACCATCCATGTTGTTGTCCAAGTTGTACGTACGAAGACCTTGACTGAGATACTCATAAGAATTCAAAACGGGGTTGTGAGTTCCAGTTCCCTGGGGGGCTTGGAAAAGAGAGTCCACCATACCCTTTCCTCTGCTGATATCTTGTTGGTCATCAGACATGTCTGTAACAAGGCCTCCCCATCTGTCCTTGTCGGTCTGCTTCTTCTCATCGTACTCTGCAACAACCTTGAAGCTCCCTGGT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=34 prefix-density=0.34 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=59.35 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.1 sequence=AACTCTCTTGCAACCTGAAACAGGGAAACCAGTTAGTCGGGAACCAAAATCAAGGCTATGGCATCACTAGCAACCTTTGCTGCAGTGCAACCGGCCACCATCAAAGGCCTTGGTGGTAGCTCCCTCAGTGGAACCAAGCTCCATGTTAAACCATCACGCCAGGGCTTAAGACCCAAAAGCTTGAGGAGTGGTGCTGTGGTGGCCAAGTATGGTGACAAGAGTGTCTACTTTGATTTGGAGGATTTGGGCAACACTACTGGGCAATGGGACTTGTATGGATCTGATGCACCTTCACCATACAACCCTCTCCAGAGCAAATTCTTTGAGACATTTG SRR7030806 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:51:35 Started mapping on | Feb 12 18:51:36 Finished on | Feb 12 18:54:54 Mapping speed, Million of reads per hour | 283.21 Number of input reads | 15576384 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14783172 Uniquely mapped reads % | 94.91% Average mapped length | 296.92 Number of splices: Total | 14909058 Number of splices: Annotated (sjdb) | 14659077 Number of splices: GT/AG | 14653996 Number of splices: GC/AG | 208635 Number of splices: AT/AC | 11182 Number of splices: Non-canonical | 35245 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463103 % of reads mapped to multiple loci | 2.97% Number of reads mapped to too many loci | 150829 % of reads mapped to too many loci | 0.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.00% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 352343 352343 352343 N_multimapping 463103 463103 463103 N_noFeature 335030 14630246 398119 N_ambiguous 172871 667 82655 UnstrandedReadsAssigned:14275271 PositiveStrandReadsAssigned:152259 NegativeStrandReadsAssigned:14302398 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030806 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030806-trimmed-pair1.fastq SRR7030806-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,576,384 reads, 14,381,387 reads pseudoaligned [quant] estimated average fragment length: 257.752 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52401 SRR7030806.ke.tsv 34699 SRR7030806.se.tsv 87100 total ==> SRR7030806.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.25 1555 43.4779 Potri.005G024800.1.v4.1 1035 778.248 940 59.4797 Potri.004G059700.1.v4.1 961 704.306 8 0.559355 Potri.007G009000.2.v4.1 1416 1159.25 0 0 Potri.003G141000.2.v4.1 2943 2686.25 446 8.17612 Potri.016G087400.1.v4.1 270 68.0349 952.679 689.563 Potri.015G069301.1.v4.1 564 311.714 0 0 Potri.010G195200.1.v4.1 1773 1516.25 23 0.746993 Potri.012G127500.1.v4.1 977 720.268 3775 258.096 ==> SRR7030806.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 229 Potri.001G212900.v4.1 48 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 41 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7030806 completed mapping pipeline successfully