Starting /dee2/code/volunteer_pipeline.sh SRR7030807 current disk space = 3051041894400 free memory = 1580304336 SRR7030807 SRAfilesize 39d92d66d297de9fc3aee4d6dd77d832 SRR7030807.sra SRR7030807.sra file validated SRR7030807 is paired end SRR7030807 is conventional basespace SRR7030807 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030807_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.65825 33.0 25.0 33.0 18.0 34.0 2 31.88275 33.0 31.0 34.0 27.0 34.0 3 31.434 33.0 31.0 33.0 27.0 34.0 4 32.6705 33.0 33.0 33.0 32.0 34.0 5 32.9865 33.0 33.0 34.0 32.0 34.0 6 36.40825 38.0 37.0 38.0 33.0 38.0 7 36.87375 38.0 37.0 38.0 34.0 38.0 8 37.011 38.0 38.0 38.0 35.0 38.0 9 37.37225 38.0 38.0 38.0 37.0 38.0 10-14 37.472899999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.48885 38.0 38.0 38.0 37.0 38.0 20-24 37.435050000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.40865 38.0 38.0 38.0 37.0 38.0 30-34 37.309349999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.27175 38.0 38.0 38.0 36.8 38.0 40-44 37.21785 38.0 38.0 38.0 37.0 38.0 45-49 37.2475 38.0 38.0 38.0 36.6 38.0 50-54 37.20445 38.0 38.0 38.0 36.6 38.0 55-59 37.14515 38.0 38.0 38.0 36.2 38.0 60-64 37.1375 38.0 38.0 38.0 36.0 38.0 65-69 37.064699999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.97805 38.0 38.0 38.0 36.0 38.0 75-79 36.94975 38.0 38.0 38.0 35.6 38.0 80-84 36.79855 38.0 38.0 38.0 35.0 38.0 85-89 36.75165 38.0 38.0 38.0 35.0 38.0 90-94 36.6298 38.0 38.0 38.0 34.6 38.0 95-99 36.361200000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.42895 38.0 38.0 38.0 34.0 38.0 105-109 36.28305 38.0 38.0 38.0 34.0 38.0 110-114 36.09895 38.0 37.4 38.0 33.4 38.0 115-119 35.9802 38.0 37.0 38.0 33.0 38.0 120-124 35.74885 38.0 36.8 38.0 31.8 38.0 125-129 35.4088 38.0 36.0 38.0 30.2 38.0 130-134 35.030449999999995 38.0 35.8 38.0 28.0 38.0 135-139 34.733050000000006 38.0 35.2 38.0 27.2 38.0 140-144 34.511300000000006 38.0 35.0 38.0 26.4 38.0 145-149 33.97775 38.0 35.0 38.0 23.4 38.0 150-151 30.545125 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 0.0 16 1.0 17 4.0 18 0.0 19 3.0 20 3.0 21 7.0 22 7.0 23 9.0 24 13.0 25 13.0 26 19.0 27 27.0 28 26.0 29 33.0 30 35.0 31 54.0 32 66.0 33 101.0 34 184.0 35 276.0 36 673.0 37 2441.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.569880823401945 12.540628385698808 7.881906825568798 41.00758396533045 2 20.025000000000002 14.374999999999998 35.125 30.475 3 19.650000000000002 17.575 27.375 35.4 4 22.55 26.900000000000002 24.65 25.900000000000002 5 21.732598898347522 30.921382073109665 25.01251877816725 22.33350025037556 6 17.97949487371843 35.0587646911728 25.681420355088775 21.280320080020005 7 14.549999999999999 27.400000000000002 40.725 17.325 8 16.975 25.324999999999996 33.4 24.3 9 17.724999999999998 24.55 35.175 22.55 10-14 19.220000000000002 29.115000000000002 28.095 23.57 15-19 19.54 27.87 28.315 24.275 20-24 19.63 28.76 28.48 23.13 25-29 19.18 29.03 27.32 24.47 30-34 19.5 28.765 27.474999999999998 24.26 35-39 19.075 28.63 27.529999999999998 24.765 40-44 19.555 28.494999999999997 27.779999999999998 24.169999999999998 45-49 19.91 28.005000000000003 28.035 24.05 50-54 19.935 28.105000000000004 27.98 23.98 55-59 19.765 29.125 27.41 23.7 60-64 19.685 28.375 28.144999999999996 23.794999999999998 65-69 19.794999999999998 29.23 27.165 23.810000000000002 70-74 19.6 29.509999999999998 27.810000000000002 23.080000000000002 75-79 19.8 28.475 27.634999999999998 24.09 80-84 19.97 28.544999999999998 27.515 23.97 85-89 19.12 28.125 28.115000000000002 24.64 90-94 19.98 28.07 28.205000000000002 23.745 95-99 20.0 28.544999999999998 27.875 23.580000000000002 100-104 19.61 28.560000000000002 27.725 24.104999999999997 105-109 19.645000000000003 28.599999999999998 27.93 23.825 110-114 19.57 28.794999999999998 27.73 23.905 115-119 20.13 28.185 28.065 23.62 120-124 20.46 27.944999999999997 28.125 23.47 125-129 20.46 27.58 28.08 23.880000000000003 130-134 20.195 28.005000000000003 27.32 24.48 135-139 20.77 27.900000000000002 27.68 23.65 140-144 20.580000000000002 28.18 27.24 24.0 145-149 20.65 28.24 27.62 23.49 150-151 20.12523481527865 28.177833437695682 27.41390106449593 24.283030682529745 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 2.5 24 4.0 25 5.0 26 6.0 27 6.0 28 9.5 29 16.5 30 21.5 31 25.0 32 28.0 33 43.0 34 60.0 35 67.0 36 75.5 37 98.0 38 137.0 39 165.0 40 194.5 41 224.5 42 245.5 43 267.0 44 277.0 45 277.0 46 266.0 47 250.5 48 238.5 49 216.5 50 172.0 51 137.5 52 111.5 53 83.0 54 67.0 55 55.0 56 41.5 57 30.0 58 24.0 59 15.0 60 6.5 61 5.5 62 4.5 63 3.0 64 2.0 65 2.0 66 2.0 67 0.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.7 2 0.0 3 0.0 4 0.0 5 0.15 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2125 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 0.9375 0.0 0.0 0.0 0.0 124-125 0.9624999999999999 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.275 0.0 0.0 0.0 0.0 130-131 1.4625 0.0 0.0 0.0 0.0 132-133 1.725 0.0 0.0 0.0 0.0 134-135 2.0 0.0 0.0 0.0 0.0 136-137 2.2249999999999996 0.0 0.0 0.0 0.0 138-139 2.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030807 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030807_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.833 33.0 33.0 34.0 32.0 34.0 2 32.894 33.0 33.0 34.0 32.0 34.0 3 32.93875 34.0 33.0 34.0 32.0 34.0 4 32.90525 34.0 33.0 34.0 32.0 34.0 5 32.9445 34.0 33.0 34.0 32.0 34.0 6 37.13175 38.0 38.0 38.0 37.0 38.0 7 37.2105 38.0 38.0 38.0 37.0 38.0 8 37.1635 38.0 38.0 38.0 37.0 38.0 9 37.10125 38.0 38.0 38.0 37.0 38.0 10-14 37.129549999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.0813 38.0 38.0 38.0 37.0 38.0 20-24 37.064499999999995 38.0 38.0 38.0 36.6 38.0 25-29 37.05925 38.0 38.0 38.0 36.8 38.0 30-34 37.0209 38.0 38.0 38.0 36.2 38.0 35-39 36.92235000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.81425 38.0 38.0 38.0 36.0 38.0 45-49 36.6823 38.0 38.0 38.0 35.2 38.0 50-54 36.8702 38.0 38.0 38.0 36.0 38.0 55-59 36.7895 38.0 38.0 38.0 35.8 38.0 60-64 36.70215 38.0 38.0 38.0 35.0 38.0 65-69 36.661 38.0 38.0 38.0 34.8 38.0 70-74 36.55925 38.0 38.0 38.0 34.6 38.0 75-79 36.470150000000004 38.0 38.0 38.0 34.0 38.0 80-84 36.291199999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.307249999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.23795 38.0 38.0 38.0 34.0 38.0 95-99 36.0957 38.0 37.8 38.0 33.4 38.0 100-104 35.8625 38.0 37.0 38.0 32.8 38.0 105-109 35.7856 38.0 37.0 38.0 31.8 38.0 110-114 35.5286 38.0 36.8 38.0 30.6 38.0 115-119 35.42835 38.0 36.0 38.0 31.0 38.0 120-124 35.22685 38.0 36.2 38.0 29.6 38.0 125-129 34.8197 38.0 35.6 38.0 27.6 38.0 130-134 34.567750000000004 38.0 35.0 38.0 26.8 38.0 135-139 34.25175 38.0 35.0 38.0 23.6 38.0 140-144 33.94584999999999 38.0 34.8 38.0 22.8 38.0 145-149 33.2668 38.0 34.0 38.0 17.4 38.0 150-151 29.195999999999998 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 4.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 1.0 13 2.0 14 3.0 15 0.0 16 2.0 17 2.0 18 3.0 19 8.0 20 7.0 21 8.0 22 9.0 23 14.0 24 14.0 25 12.0 26 14.0 27 35.0 28 22.0 29 37.0 30 47.0 31 71.0 32 90.0 33 104.0 34 176.0 35 292.0 36 710.0 37 2292.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.375 22.775000000000002 12.55 27.3 2 26.69003505257887 25.763645468202302 32.12318477716575 15.42313470205308 3 20.85628442663996 27.891837756634953 32.248372558838255 19.00350525788683 4 22.759138708062093 34.777165748622934 23.760640961442164 18.70305458187281 5 24.18104526131533 35.708927231807955 22.605651412853213 17.504376094023506 6 20.886551465063864 38.01652892561984 22.940145254194842 18.156774355121463 7 20.28042063094642 22.358537806710068 37.73159739609414 19.629444166249375 8 22.25838758137206 26.589884827240862 28.16725087631447 22.984476715072606 9 23.034551827741613 24.661992989484226 29.669504256384577 22.633950926389584 10-14 23.13470205307962 29.28893340010015 26.299449173760642 21.27691537305959 15-19 22.679018527791687 28.312468703054584 28.12218327491237 20.886329494241362 20-24 22.8793189784677 29.06860290435653 27.566349524286434 20.485728592889334 25-29 23.25988983475213 28.647971957936907 27.210816224336504 20.881321982974463 30-34 22.904356534802204 28.377566349524287 28.082123184777164 20.635953930896346 35-39 22.950245269796778 28.105916508158973 28.37120832916208 20.572629892882173 40-44 22.997997997998 28.823823823823822 27.6976976976977 20.48048048048048 45-49 22.98718205487683 27.768876426997796 28.509913879431203 20.734027638694172 50-54 22.96214700580813 28.00420588824354 28.304626477067895 20.72902062888043 55-59 22.96945418127191 27.85177766649975 28.257386079118678 20.921382073109665 60-64 23.244867300951427 27.801702553830747 28.73309964947421 20.220330495743617 65-69 23.780671006509767 28.41261892839259 27.786680020030047 20.020030045067603 70-74 22.959439158738107 27.926890335503256 28.68803204807211 20.425638457686528 75-79 23.345017526289435 27.906860290435652 28.12218327491237 20.625938908362542 80-84 23.42513770655984 28.668002003004506 27.616424636955433 20.29043565348022 85-89 23.578009212898056 27.95914279991989 27.638694171840577 20.82415381534148 90-94 23.309964947421133 28.44266399599399 27.591387080620933 20.655983975963945 95-99 23.700550826239358 27.891837756634953 28.202303455182776 20.205307961942914 100-104 23.960941412118178 27.85177766649975 28.02704056084126 20.16024036054081 105-109 23.54531797696545 28.202303455182776 28.11717576364547 20.13520280420631 110-114 23.71056584877316 28.12218327491237 27.796695042563847 20.370555833750625 115-119 23.940911367050578 28.15222834251377 27.731597396094145 20.17526289434151 120-124 24.096144216324486 27.856785177766653 27.766649974962444 20.28042063094642 125-129 24.236354531797698 27.175763645468205 28.472709063595392 20.11517275913871 130-134 24.206309464196295 27.68652979469204 28.01702553830746 20.09013520280421 135-139 24.446670005007512 27.81672508763145 28.15222834251377 19.58437656484727 140-144 24.564390146204687 27.588624073703183 27.87402363308632 19.972962147005806 145-149 24.39659489233851 28.082123184777164 27.56134201301953 19.959939909864797 150-151 24.218163622717036 28.7215411558669 27.820865649236925 19.239429572179134 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 2.0 2 1.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 2.0 26 4.0 27 3.5 28 7.5 29 14.0 30 18.0 31 21.5 32 29.0 33 35.5 34 45.5 35 64.0 36 85.5 37 118.0 38 142.0 39 157.5 40 211.0 41 258.5 42 266.5 43 273.0 44 295.5 45 300.0 46 268.5 47 252.0 48 219.0 49 182.5 50 158.0 51 117.5 52 106.5 53 86.5 54 56.0 55 50.5 56 36.5 57 26.0 58 20.5 59 14.0 60 14.0 61 10.0 62 3.5 63 3.0 64 2.0 65 1.5 66 2.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.15 4 0.15 5 0.025 6 0.17500000000000002 7 0.15 8 0.15 9 0.15 10-14 0.15 15-19 0.15 20-24 0.15 25-29 0.15 30-34 0.15 35-39 0.11 40-44 0.1 45-49 0.13999999999999999 50-54 0.13999999999999999 55-59 0.15 60-64 0.15 65-69 0.15 70-74 0.15 75-79 0.15 80-84 0.15 85-89 0.13999999999999999 90-94 0.15 95-99 0.15 100-104 0.15 105-109 0.15 110-114 0.15 115-119 0.15 120-124 0.15 125-129 0.15 130-134 0.15 135-139 0.15 140-144 0.13999999999999999 145-149 0.15 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0642387455741 97.925 2 0.7840161861406171 1.55 3 0.07587253414264036 0.22499999999999998 4 0.07587253414264036 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.2125 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 0.9125000000000001 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.2374999999999998 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.675 0.0 0.0 0.0 0.0 134-135 1.9125 0.0 0.0 0.0 0.0 136-137 2.1125 0.0 0.0 0.0 0.0 138-139 2.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTTAC 10 0.006830828 145.0 3 GCCATCT 10 0.006830828 145.0 7 ACAAGCG 10 0.006830828 145.0 8 >>END_MODULE Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211602 spots for SRR7030807.sra Written 1211602 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra Read 1211598 spots for SRR7030807.sra Written 1211598 spots for SRR7030807.sra SRR ids: ['SRR7030807.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h3ko427n SRR7030807.sra spots: 24231964 blocks: [[1, 1211598], [1211599, 2423196], [2423197, 3634794], [3634795, 4846392], [4846393, 6057990], [6057991, 7269588], [7269589, 8481186], [8481187, 9692784], [9692785, 10904382], [10904383, 12115980], [12115981, 13327578], [13327579, 14539176], [14539177, 15750774], [15750775, 16962372], [16962373, 18173970], [18173971, 19385568], [19385569, 20597166], [20597167, 21808764], [21808765, 23020362], [23020363, 24231964]] SRR7030807 file size 8189717 SRR7030807 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030807 SRR7030807_1.fastq SRR7030807_2.fastq Input file: SRR7030807_1.fastq Paired file: SRR7030807_2.fastq trimmed: SRR7030807-trimmed-pair1.fastq, SRR7030807-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:30:22 2025 >> started Wed Feb 12 19:30:50 2025 >> done (27.611s) 24231964 read pairs processed; of these: 29574 ( 0.12%) short read pairs filtered out after trimming by size control 17231 ( 0.07%) empty read pairs filtered out after trimming by size control 24185159 (99.81%) read pairs available; of these: 9445900 (39.06%) trimmed read pairs available after processing 14739259 (60.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 6 0.00% 21 4 0.00% 22 6 0.00% 23 10 0.00% 24 7 0.00% 25 2 0.00% 26 6 0.00% 27 8 0.00% 28 12 0.00% 29 4 0.00% 30 5 0.00% 31 8 0.00% 32 5 0.00% 33 7 0.00% 34 6 0.00% 35 4 0.00% 36 4 0.00% 37 14 0.00% 38 3 0.00% 39 9 0.00% 40 3 0.00% 41 11 0.00% 42 11 0.00% 43 9 0.00% 44 6 0.00% 45 7 0.00% 46 10 0.00% 47 19 0.00% 48 15 0.00% 49 18 0.00% 50 21 0.00% 51 22 0.00% 52 22 0.00% 53 34 0.00% 54 33 0.00% 55 33 0.00% 56 45 0.00% 57 39 0.00% 58 48 0.00% 59 55 0.00% 60 75 0.00% 61 51 0.00% 62 77 0.00% 63 82 0.00% 64 94 0.00% 65 136 0.00% 66 115 0.00% 67 125 0.00% 68 143 0.00% 69 173 0.00% 70 197 0.00% 71 242 0.00% 72 265 0.00% 73 297 0.00% 74 334 0.00% 75 412 0.00% 76 483 0.00% 77 477 0.00% 78 543 0.00% 79 636 0.00% 80 730 0.00% 81 823 0.00% 82 1044 0.00% 83 1129 0.00% 84 1927 0.01% 85 2575 0.01% 86 2893 0.01% 87 3095 0.01% 88 3342 0.01% 89 3461 0.01% 90 3611 0.01% 91 3794 0.02% 92 4162 0.02% 93 4449 0.02% 94 4642 0.02% 95 5005 0.02% 96 5423 0.02% 97 5788 0.02% 98 6091 0.03% 99 7262 0.03% 100 6895 0.03% 101 7319 0.03% 102 7780 0.03% 103 8292 0.03% 104 9118 0.04% 105 9649 0.04% 106 10120 0.04% 107 10839 0.04% 108 11593 0.05% 109 12211 0.05% 110 12947 0.05% 111 14001 0.06% 112 15017 0.06% 113 15937 0.07% 114 17177 0.07% 115 18405 0.08% 116 19558 0.08% 117 20389 0.08% 118 21720 0.09% 119 22669 0.09% 120 23789 0.10% 121 25375 0.10% 122 26824 0.11% 123 28539 0.12% 124 30303 0.13% 125 31468 0.13% 126 33571 0.14% 127 35208 0.15% 128 38050 0.16% 129 40151 0.17% 130 42694 0.18% 131 45325 0.19% 132 48172 0.20% 133 51984 0.21% 134 55508 0.23% 135 59434 0.25% 136 64630 0.27% 137 70247 0.29% 138 77118 0.32% 139 84788 0.35% 140 91979 0.38% 141 100427 0.42% 142 112827 0.47% 143 128638 0.53% 144 152302 0.63% 145 185322 0.77% 146 238466 0.99% 147 328046 1.36% 148 507194 2.10% 149 1031657 4.27% 150 5307429 21.94% 151 14739259 60.94% 24185159 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=35 prefix-density=0.20 prefix-fanout=2.8 sequence=GTACAAACACAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=37 fanout-score=176.61 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=15.8 sequence=TCTCTTCTTCAGTCTTGGGGTGGTACCCAGGTAACTTCTCCTTGATCTTCTCGAGTAGTCCCTTCTTCTCCTTGGCATCTCCTTCATGGGAAACTGCAGCTTCAGGGGAAACATGTTCAGGAGCTGGAGGAGGGACCTCGTCAGCTTTCTTATGTCCTGGCAATTTCTCCTTGATTTTGTCAAGGAAACCCTTCTTATCCTCTGGTTCATGGGGTGTCTCTGTATGGACTACCTCGACAGGAACACTAGTATCCTCGTGTTCCTTCTCCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=36 prefix-density=0.42 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=106.65 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.5 sequence=AAGCAACAAACCTTAGCCTTCACAAACTTTCTCTATAACCTTGCCTATCCTTGATTCTTAACCCTCCGATCAAACTACTTACCCCCCC SRR7030807 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:31:34 Started mapping on | Feb 12 19:31:34 Finished on | Feb 12 19:33:47 Mapping speed, Million of reads per hour | 654.64 Number of input reads | 24185159 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 23196604 Uniquely mapped reads % | 95.91% Average mapped length | 297.14 Number of splices: Total | 21784766 Number of splices: Annotated (sjdb) | 21382459 Number of splices: GT/AG | 21468921 Number of splices: GC/AG | 239279 Number of splices: AT/AC | 14095 Number of splices: Non-canonical | 62471 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 693300 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 42227 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.02% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 314050 314050 314050 N_multimapping 693300 693300 693300 N_noFeature 484851 22939253 607391 N_ambiguous 243872 2054 108184 UnstrandedReadsAssigned:22467881 PositiveStrandReadsAssigned:255297 NegativeStrandReadsAssigned:22481029 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030807 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030807-trimmed-pair1.fastq SRR7030807-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,185,159 reads, 22,379,634 reads pseudoaligned [quant] estimated average fragment length: 265.439 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR7030807.ke.tsv 34699 SRR7030807.se.tsv 87100 total ==> SRR7030807.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.56 3329 62.8345 Potri.005G024800.1.v4.1 1035 770.561 1976 84.8761 Potri.004G059700.1.v4.1 961 696.615 39 1.85301 Potri.007G009000.2.v4.1 1416 1151.56 0 0 Potri.003G141000.2.v4.1 2943 2678.56 1166.26 14.4112 Potri.016G087400.1.v4.1 270 65.8007 1944.34 978.019 Potri.015G069301.1.v4.1 564 304.413 0 0 Potri.010G195200.1.v4.1 1773 1508.56 231 5.06821 Potri.012G127500.1.v4.1 977 712.585 7126 330.99 ==> SRR7030807.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 161 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 199 Potri.001G212900.v4.1 124 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 94 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR7030807 completed mapping pipeline successfully