Starting /dee2/code/volunteer_pipeline.sh SRR7030808 current disk space = 3051062325248 free memory = 1568754752 SRR7030808 SRAfilesize b3b32b1608a52f9d40331f30ca114003 SRR7030808.sra SRR7030808.sra file validated SRR7030808 is paired end SRR7030808 is conventional basespace SRR7030808 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030808_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.4525 32.0 25.0 33.0 18.0 34.0 2 31.73275 33.0 31.0 34.0 27.0 34.0 3 31.429 33.0 31.0 33.0 27.0 34.0 4 30.93 32.0 31.0 33.0 27.0 33.0 5 32.14875 33.0 32.0 33.0 31.0 33.0 6 36.574 38.0 37.0 38.0 34.0 38.0 7 37.1055 38.0 38.0 38.0 36.0 38.0 8 37.197 38.0 38.0 38.0 36.0 38.0 9 37.442 38.0 38.0 38.0 37.0 38.0 10-14 37.48585 38.0 38.0 38.0 37.0 38.0 15-19 37.486000000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.45485 38.0 38.0 38.0 37.0 38.0 25-29 37.3981 38.0 38.0 38.0 37.0 38.0 30-34 37.35185 38.0 38.0 38.0 37.0 38.0 35-39 37.324650000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.2265 38.0 38.0 38.0 36.8 38.0 45-49 37.27825 38.0 38.0 38.0 37.0 38.0 50-54 37.203599999999994 38.0 38.0 38.0 36.6 38.0 55-59 37.151 38.0 38.0 38.0 36.4 38.0 60-64 37.18465 38.0 38.0 38.0 36.6 38.0 65-69 37.15875 38.0 38.0 38.0 36.0 38.0 70-74 36.98485 38.0 38.0 38.0 36.0 38.0 75-79 36.97429999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.84245 38.0 38.0 38.0 35.2 38.0 85-89 36.7932 38.0 38.0 38.0 35.0 38.0 90-94 36.738800000000005 38.0 38.0 38.0 34.8 38.0 95-99 36.4334 38.0 38.0 38.0 34.2 38.0 100-104 36.450300000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.314800000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.17935 38.0 37.8 38.0 33.8 38.0 115-119 36.04305 38.0 37.2 38.0 33.2 38.0 120-124 35.8371 38.0 37.0 38.0 32.4 38.0 125-129 35.494150000000005 38.0 36.4 38.0 30.6 38.0 130-134 35.103300000000004 38.0 36.0 38.0 28.4 38.0 135-139 34.95015 38.0 35.8 38.0 28.0 38.0 140-144 34.8093 38.0 35.6 38.0 28.0 38.0 145-149 34.226150000000004 38.0 35.0 38.0 26.6 38.0 150-151 30.901 36.5 30.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 0.0 19 3.0 20 5.0 21 7.0 22 5.0 23 9.0 24 12.0 25 12.0 26 15.0 27 21.0 28 29.0 29 33.0 30 36.0 31 50.0 32 63.0 33 115.0 34 163.0 35 265.0 36 656.0 37 2492.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.92761394101877 12.466487935656836 8.847184986595174 39.75871313672922 2 22.8 14.274999999999999 31.7 31.225 3 20.575 18.075 25.75 35.6 4 24.5 25.374999999999996 22.35 27.775 5 23.54854854854855 29.52952952952953 23.523523523523522 23.3983983983984 6 19.909954977488745 34.04202101050525 24.937468734367183 21.11055527763882 7 15.55 28.025 38.6 17.825 8 17.95 26.174999999999997 30.5 25.374999999999996 9 17.4 25.275 33.275 24.05 10-14 20.66 29.34 26.905 23.095 15-19 20.22 28.64 26.895000000000003 24.245 20-24 20.585 28.134999999999998 27.305 23.974999999999998 25-29 20.36 28.084999999999997 27.284999999999997 24.27 30-34 20.075000000000003 28.560000000000002 26.974999999999998 24.39 35-39 20.44 28.199999999999996 27.46 23.9 40-44 20.599999999999998 28.08 27.04 24.279999999999998 45-49 20.544999999999998 28.255000000000003 26.415 24.785 50-54 20.5 28.144999999999996 27.060000000000002 24.295 55-59 21.055 28.575 26.75 23.62 60-64 21.085 28.38 26.650000000000002 23.885 65-69 20.665 27.905 27.325 24.104999999999997 70-74 20.86 28.075 27.01 24.055 75-79 20.585 27.634999999999998 27.045 24.735 80-84 21.099999999999998 27.555000000000003 27.165 24.18 85-89 21.490000000000002 27.27 27.1 24.14 90-94 20.865000000000002 28.24 26.75 24.145 95-99 21.115000000000002 28.155 26.44 24.29 100-104 20.919999999999998 27.915 27.015 24.15 105-109 21.035 27.66 27.474999999999998 23.830000000000002 110-114 21.215 27.384999999999998 27.279999999999998 24.12 115-119 21.154999999999998 27.465 27.339999999999996 24.04 120-124 21.73 27.625 27.015 23.630000000000003 125-129 21.67 27.665 26.245 24.42 130-134 21.46 28.084999999999997 26.619999999999997 23.835 135-139 21.385 26.93 27.029999999999998 24.654999999999998 140-144 21.32 27.62 26.52 24.54 145-149 22.035 27.900000000000002 26.135 23.93 150-151 21.36505948653726 27.326236693800876 26.36192861615529 24.946775203506576 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 2.0 24 1.5 25 1.0 26 1.5 27 4.0 28 10.0 29 10.5 30 16.0 31 22.0 32 24.5 33 27.5 34 38.0 35 53.5 36 67.5 37 91.5 38 107.5 39 131.0 40 156.0 41 184.0 42 219.5 43 231.0 44 243.5 45 255.0 46 265.5 47 268.5 48 247.0 49 246.0 50 216.0 51 163.5 52 144.5 53 125.5 54 97.0 55 75.5 56 64.5 57 47.0 58 38.0 59 35.0 60 24.5 61 15.0 62 7.5 63 4.5 64 4.0 65 2.0 66 1.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.75 2 0.0 3 0.0 4 0.0 5 0.1 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.554016620498615 1.0999999999999999 3 0.0503651473180559 0.15 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.225 0.0 0.0 0.0 0.0 122-123 1.45 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 2.0 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.4000000000000004 0.0 0.0 0.0 0.0 132-133 2.5999999999999996 0.0 0.0 0.0 0.0 134-135 2.7625 0.0 0.0 0.0 0.0 136-137 3.0875000000000004 0.0 0.0 0.0 0.0 138-139 3.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGTA 10 0.006841402 144.925 5 GGTTTGT 10 0.006841402 144.925 4 TGCTTCG 10 0.006841402 144.925 145 GTAAATG 10 0.006841402 144.925 6 >>END_MODULE SRR7030808 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030808_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8145 33.0 33.0 34.0 32.0 34.0 2 32.866 33.0 33.0 34.0 32.0 34.0 3 32.86725 34.0 33.0 34.0 32.0 34.0 4 32.884 34.0 33.0 34.0 32.0 34.0 5 32.89425 34.0 33.0 34.0 32.0 34.0 6 37.09025 38.0 38.0 38.0 36.0 38.0 7 37.21075 38.0 38.0 38.0 37.0 38.0 8 37.0545 38.0 38.0 38.0 36.0 38.0 9 37.15175 38.0 38.0 38.0 37.0 38.0 10-14 37.15075 38.0 38.0 38.0 36.8 38.0 15-19 37.08605 38.0 38.0 38.0 36.6 38.0 20-24 37.08935 38.0 38.0 38.0 36.4 38.0 25-29 37.0523 38.0 38.0 38.0 36.2 38.0 30-34 37.010949999999994 38.0 38.0 38.0 36.0 38.0 35-39 36.9185 38.0 38.0 38.0 36.0 38.0 40-44 36.82285 38.0 38.0 38.0 35.6 38.0 45-49 36.679500000000004 38.0 38.0 38.0 35.0 38.0 50-54 36.9293 38.0 38.0 38.0 36.0 38.0 55-59 36.80415 38.0 38.0 38.0 35.4 38.0 60-64 36.71835 38.0 38.0 38.0 35.0 38.0 65-69 36.61905 38.0 38.0 38.0 34.6 38.0 70-74 36.576899999999995 38.0 38.0 38.0 34.4 38.0 75-79 36.5269 38.0 38.0 38.0 34.0 38.0 80-84 36.352 38.0 38.0 38.0 33.8 38.0 85-89 36.32695 38.0 38.0 38.0 34.0 38.0 90-94 36.23630000000001 38.0 38.0 38.0 33.8 38.0 95-99 36.02034999999999 38.0 37.2 38.0 33.0 38.0 100-104 35.846849999999996 38.0 37.0 38.0 32.2 38.0 105-109 35.78425 38.0 37.0 38.0 31.8 38.0 110-114 35.46465 38.0 36.6 38.0 30.2 38.0 115-119 35.30845 38.0 36.4 38.0 29.8 38.0 120-124 35.1783 38.0 36.0 38.0 28.6 38.0 125-129 34.92360000000001 38.0 35.6 38.0 27.8 38.0 130-134 34.542449999999995 38.0 35.0 38.0 26.2 38.0 135-139 34.26325 38.0 35.0 38.0 24.2 38.0 140-144 33.87215 38.0 34.8 38.0 22.2 38.0 145-149 33.303200000000004 38.0 34.2 38.0 18.6 38.0 150-151 29.30925 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 2.0 9 0.0 10 1.0 11 2.0 12 1.0 13 1.0 14 1.0 15 5.0 16 4.0 17 5.0 18 1.0 19 1.0 20 4.0 21 9.0 22 13.0 23 9.0 24 17.0 25 18.0 26 24.0 27 28.0 28 39.0 29 45.0 30 62.0 31 73.0 32 80.0 33 95.0 34 157.0 35 317.0 36 667.0 37 2307.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.05 20.974999999999998 13.825000000000001 30.15 2 26.464697045568354 25.237856785177765 29.769654481722586 18.5277916875313 3 21.67709637046308 27.63454317897372 29.61201501877347 21.076345431789736 4 22.934401602403607 33.29994992488733 23.785678517776667 19.979969954932397 5 25.974999999999998 35.375 20.7 17.95 6 20.791583166332668 38.57715430861723 22.62024048096192 18.011022044088175 7 20.45568352528793 22.33350025037556 36.10415623435153 21.106659989984976 8 21.13169754631948 26.664997496244368 27.99198798197296 24.211316975463195 9 22.55883825738608 23.985978968452677 29.218828242363543 24.236354531797698 10-14 23.54178140489661 28.79387172683122 25.554498573073648 22.109848295198518 15-19 22.813516896120152 28.030037546933666 26.853566958698373 22.302878598247812 20-24 22.95369211514393 28.53566958698373 26.428035043804755 22.082603254067585 25-29 22.523153942428035 28.08010012515644 27.319148936170212 22.07759699624531 30-34 23.314142678347935 28.275344180225282 26.803504380475594 21.60700876095119 35-39 22.972567080496596 28.123748498197838 27.287745294353222 21.615939126952345 40-44 23.415757333066374 28.180999099008908 26.869556512163378 21.533687055761337 45-49 22.993742177722154 27.339173967459324 27.489361702127656 22.177722152690862 50-54 23.23404255319149 27.684605757196497 27.153942428035045 21.927409261576972 55-59 23.143929912390487 27.193992490613265 27.5694618272841 22.09261576971214 60-64 23.58448060075094 27.038798498122652 27.063829787234045 22.312891113892366 65-69 23.284105131414268 27.093867334167708 27.55944931163955 22.062578222778473 70-74 23.455492139781718 26.904976469410236 27.701011314709124 21.93852007609893 75-79 23.933506909673543 26.847586621269777 27.65371520128179 21.565191267774885 80-84 23.601862514394433 26.981424923646923 27.401992690131678 22.014719871826966 85-89 23.669586983729662 27.043804755944933 26.968710888610765 22.317897371714643 90-94 23.544430538172715 27.85481852315394 26.753441802252816 21.847309136420527 95-99 24.23028785982478 26.823529411764707 27.414267834793492 21.53191489361702 100-104 23.979974968710888 27.053817271589487 26.888610763454317 22.07759699624531 105-109 23.94612996895965 27.385601281666165 27.37058175628317 21.29768699309102 110-114 23.198998748435546 27.964956195244056 26.913642052565706 21.92240300375469 115-119 23.94993742177722 26.488110137672088 27.97496871088861 21.586983729662077 120-124 23.869837296620776 27.2540675844806 27.27909887359199 21.59699624530663 125-129 24.225281602002504 27.2090112640801 27.128911138923655 21.436795994993744 130-134 25.321652065081352 26.943679599499376 26.883604505632043 20.851063829787233 135-139 24.590738423028785 27.18898623279099 26.97371714643304 21.246558197747184 140-144 24.705882352941178 27.88986232790989 26.36795994993742 21.036295369211512 145-149 25.0613266583229 26.99374217772215 27.10387984981227 20.84105131414268 150-151 24.590368980612883 27.204502814258912 26.79174484052533 21.41338336460288 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 2.0 26 3.0 27 3.0 28 4.0 29 5.5 30 8.5 31 9.0 32 13.5 33 21.0 34 29.0 35 52.0 36 65.0 37 77.5 38 96.0 39 128.5 40 174.5 41 192.0 42 230.0 43 278.5 44 289.5 45 288.5 46 277.5 47 269.0 48 243.0 49 205.0 50 195.0 51 166.0 52 135.0 53 119.0 54 92.5 55 70.0 56 58.0 57 55.5 58 44.5 59 26.5 60 18.0 61 13.0 62 11.0 63 8.0 64 4.5 65 4.5 66 3.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.125 4 0.15 5 0.0 6 0.2 7 0.15 8 0.15 9 0.15 10-14 0.135 15-19 0.125 20-24 0.125 25-29 0.125 30-34 0.125 35-39 0.12 40-44 0.11 45-49 0.125 50-54 0.125 55-59 0.125 60-64 0.125 65-69 0.125 70-74 0.13 75-79 0.13999999999999999 80-84 0.135 85-89 0.125 90-94 0.125 95-99 0.125 100-104 0.125 105-109 0.13 110-114 0.125 115-119 0.125 120-124 0.125 125-129 0.125 130-134 0.125 135-139 0.125 140-144 0.125 145-149 0.125 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91111673841479 97.65 2 0.9622689288427451 1.9 3 0.07596859964547988 0.22499999999999998 4 0.02532286654849329 0.1 5 0.02532286654849329 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.175 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.6375000000000002 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.3625 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 2.75 0.0 0.0 0.0 0.0 136-137 3.0875000000000004 0.0 0.0 0.0 0.0 138-139 3.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGAAAA 10 0.006830828 145.0 7 TCAAAGT 10 0.006830828 145.0 2 CGAAAAA 10 0.006830828 145.0 8 >>END_MODULE Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060504 spots for SRR7030808.sra Written 1060504 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra Read 1060493 spots for SRR7030808.sra Written 1060493 spots for SRR7030808.sra SRR ids: ['SRR7030808.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vj5h3jkc SRR7030808.sra spots: 21209871 blocks: [[1, 1060493], [1060494, 2120986], [2120987, 3181479], [3181480, 4241972], [4241973, 5302465], [5302466, 6362958], [6362959, 7423451], [7423452, 8483944], [8483945, 9544437], [9544438, 10604930], [10604931, 11665423], [11665424, 12725916], [12725917, 13786409], [13786410, 14846902], [14846903, 15907395], [15907396, 16967888], [16967889, 18028381], [18028382, 19088874], [19088875, 20149367], [20149368, 21209871]] SRR7030808 file size 7165628 SRR7030808 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030808 SRR7030808_1.fastq SRR7030808_2.fastq Input file: SRR7030808_1.fastq Paired file: SRR7030808_2.fastq trimmed: SRR7030808-trimmed-pair1.fastq, SRR7030808-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:24:50 2025 >> started Wed Feb 12 19:25:16 2025 >> done (25.212s) 21209871 read pairs processed; of these: 28679 ( 0.14%) short read pairs filtered out after trimming by size control 17519 ( 0.08%) empty read pairs filtered out after trimming by size control 21163673 (99.78%) read pairs available; of these: 8374354 (39.57%) trimmed read pairs available after processing 12789319 (60.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 5 0.00% 21 4 0.00% 22 3 0.00% 23 4 0.00% 24 3 0.00% 25 4 0.00% 26 7 0.00% 27 2 0.00% 28 5 0.00% 29 6 0.00% 30 7 0.00% 31 2 0.00% 32 9 0.00% 33 4 0.00% 34 4 0.00% 35 3 0.00% 36 2 0.00% 37 4 0.00% 38 12 0.00% 39 9 0.00% 40 5 0.00% 41 9 0.00% 42 5 0.00% 43 8 0.00% 44 5 0.00% 45 9 0.00% 46 14 0.00% 47 7 0.00% 48 13 0.00% 49 12 0.00% 50 13 0.00% 51 18 0.00% 52 15 0.00% 53 20 0.00% 54 23 0.00% 55 17 0.00% 56 30 0.00% 57 26 0.00% 58 37 0.00% 59 36 0.00% 60 51 0.00% 61 53 0.00% 62 65 0.00% 63 73 0.00% 64 79 0.00% 65 72 0.00% 66 107 0.00% 67 97 0.00% 68 125 0.00% 69 146 0.00% 70 140 0.00% 71 163 0.00% 72 200 0.00% 73 251 0.00% 74 275 0.00% 75 354 0.00% 76 367 0.00% 77 417 0.00% 78 513 0.00% 79 513 0.00% 80 634 0.00% 81 758 0.00% 82 873 0.00% 83 1114 0.01% 84 1881 0.01% 85 2451 0.01% 86 2689 0.01% 87 2914 0.01% 88 3128 0.01% 89 3305 0.02% 90 3438 0.02% 91 3649 0.02% 92 3911 0.02% 93 4229 0.02% 94 4356 0.02% 95 4776 0.02% 96 4992 0.02% 97 5439 0.03% 98 5891 0.03% 99 6661 0.03% 100 6509 0.03% 101 6995 0.03% 102 7476 0.04% 103 8258 0.04% 104 8640 0.04% 105 9430 0.04% 106 9929 0.05% 107 10700 0.05% 108 11120 0.05% 109 11787 0.06% 110 12394 0.06% 111 13555 0.06% 112 14630 0.07% 113 15666 0.07% 114 16505 0.08% 115 17977 0.08% 116 19093 0.09% 117 20182 0.10% 118 20882 0.10% 119 22101 0.10% 120 23466 0.11% 121 24843 0.12% 122 26326 0.12% 123 28515 0.13% 124 29681 0.14% 125 31283 0.15% 126 33240 0.16% 127 35198 0.17% 128 37070 0.18% 129 38936 0.18% 130 41840 0.20% 131 44176 0.21% 132 46857 0.22% 133 49952 0.24% 134 54062 0.26% 135 57638 0.27% 136 62232 0.29% 137 66993 0.32% 138 73946 0.35% 139 79111 0.37% 140 85256 0.40% 141 91615 0.43% 142 102268 0.48% 143 116253 0.55% 144 136657 0.65% 145 165967 0.78% 146 209247 0.99% 147 283322 1.34% 148 436276 2.06% 149 887429 4.19% 150 4639296 21.92% 151 12789319 60.43% 21163673 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.91 fanout-score-rank=27 prefix-density=0.45 prefix-fanout=2.8 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=122.68 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=12.8 sequence=CTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=34 prefix-density=0.63 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=141.24 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=1.6 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCAGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTCCAGGTGGGCCATGCTTGGAGCTCTTGGATGCGTCTTCCCCGAGCTCTTGTCCCGCAACGGTGTCAAGTTCGGCGAGGCTGTATGGTTCAAGGCTGGAGCCCAG SRR7030808 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:25:57 Started mapping on | Feb 12 19:25:57 Finished on | Feb 12 19:27:42 Mapping speed, Million of reads per hour | 725.61 Number of input reads | 21163673 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19980455 Uniquely mapped reads % | 94.41% Average mapped length | 297.00 Number of splices: Total | 19974214 Number of splices: Annotated (sjdb) | 19737542 Number of splices: GT/AG | 19634022 Number of splices: GC/AG | 278012 Number of splices: AT/AC | 17231 Number of splices: Non-canonical | 44949 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 879246 % of reads mapped to multiple loci | 4.15% Number of reads mapped to too many loci | 146776 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 321582 321582 321582 N_multimapping 879246 879246 879246 N_noFeature 233503 19800210 295274 N_ambiguous 233954 639 115026 UnstrandedReadsAssigned:19512998 PositiveStrandReadsAssigned:179606 NegativeStrandReadsAssigned:19570155 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030808 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030808-trimmed-pair1.fastq SRR7030808-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,163,673 reads, 19,958,932 reads pseudoaligned [quant] estimated average fragment length: 251.94 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52401 SRR7030808.ke.tsv 34699 SRR7030808.se.tsv 87100 total ==> SRR7030808.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.06 622 12.2391 Potri.005G024800.1.v4.1 1035 784.06 160 7.09548 Potri.004G059700.1.v4.1 961 710.079 22 1.07728 Potri.007G009000.2.v4.1 1416 1165.06 1 0.0298444 Potri.003G141000.2.v4.1 2943 2692.06 333 4.30101 Potri.016G087400.1.v4.1 270 68.942 2109.08 1063.71 Potri.015G069301.1.v4.1 564 316.474 0 0 Potri.010G195200.1.v4.1 1773 1522.06 1 0.0228444 Potri.012G127500.1.v4.1 977 726.073 5102 244.327 ==> SRR7030808.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 470 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7030808 completed mapping pipeline successfully