Starting /dee2/code/volunteer_pipeline.sh SRR7030809 current disk space = 3050898001920 free memory = 1577043508 SRR7030809 SRAfilesize 00793015d43a7b5c03ffe432ee96bd82 SRR7030809.sra SRR7030809.sra file validated SRR7030809 is paired end SRR7030809 is conventional basespace SRR7030809 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030809_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.96325 33.0 33.0 34.0 31.0 34.0 2 32.63225 33.0 33.0 34.0 30.0 34.0 3 31.47225 33.0 31.0 33.0 28.0 34.0 4 32.5005 33.0 33.0 33.0 32.0 34.0 5 32.74475 33.0 33.0 34.0 32.0 34.0 6 36.3275 38.0 36.0 38.0 33.0 38.0 7 37.26475 38.0 38.0 38.0 36.0 38.0 8 37.42425 38.0 38.0 38.0 37.0 38.0 9 37.601 38.0 38.0 38.0 38.0 38.0 10-14 37.618300000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.60475 38.0 38.0 38.0 38.0 38.0 20-24 37.62345 38.0 38.0 38.0 38.0 38.0 25-29 37.5791 38.0 38.0 38.0 38.0 38.0 30-34 37.528299999999994 38.0 38.0 38.0 37.6 38.0 35-39 37.5335 38.0 38.0 38.0 38.0 38.0 40-44 37.459199999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.4677 38.0 38.0 38.0 37.0 38.0 50-54 37.416399999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.39045 38.0 38.0 38.0 37.0 38.0 60-64 37.3448 38.0 38.0 38.0 36.8 38.0 65-69 37.28465 38.0 38.0 38.0 37.0 38.0 70-74 37.2358 38.0 38.0 38.0 36.0 38.0 75-79 37.21835 38.0 38.0 38.0 36.4 38.0 80-84 37.134049999999995 38.0 38.0 38.0 36.2 38.0 85-89 36.99570000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.9996 38.0 38.0 38.0 36.0 38.0 95-99 36.92 38.0 38.0 38.0 35.8 38.0 100-104 36.739149999999995 38.0 38.0 38.0 34.8 38.0 105-109 36.63975 38.0 38.0 38.0 34.6 38.0 110-114 36.549099999999996 38.0 38.0 38.0 34.2 38.0 115-119 36.442600000000006 38.0 38.0 38.0 34.0 38.0 120-124 36.27665 38.0 37.6 38.0 33.6 38.0 125-129 35.89525 38.0 37.0 38.0 32.8 38.0 130-134 35.7354 38.0 36.4 38.0 31.8 38.0 135-139 35.5268 38.0 36.0 38.0 31.2 38.0 140-144 35.376099999999994 38.0 36.0 38.0 31.0 38.0 145-149 34.92965 38.0 35.8 38.0 29.8 38.0 150-151 31.811875 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 1.0 19 1.0 20 0.0 21 1.0 22 2.0 23 5.0 24 7.0 25 10.0 26 8.0 27 12.0 28 10.0 29 33.0 30 33.0 31 45.0 32 54.0 33 82.0 34 130.0 35 242.0 36 581.0 37 2739.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.218841740058714 11.395783293301308 9.100613824392848 39.284761142247135 2 21.7 14.05 36.5 27.750000000000004 3 19.925 18.35 26.775 34.949999999999996 4 22.575 26.0 23.575 27.85 5 23.375 31.075000000000003 24.6 20.95 6 19.7 35.075 24.525 20.7 7 14.825 25.674999999999997 42.3 17.2 8 18.95 25.124999999999996 32.15 23.775 9 17.974999999999998 24.875 33.725 23.425 10-14 19.81 28.9 27.32 23.97 15-19 19.965 28.134999999999998 27.77 24.13 20-24 20.27 28.395 26.974999999999998 24.36 25-29 19.965 28.765 27.29 23.98 30-34 20.355 28.470000000000002 27.42 23.755000000000003 35-39 20.43 28.470000000000002 27.400000000000002 23.7 40-44 20.615 27.975 27.655 23.755000000000003 45-49 20.575 28.12 27.33 23.974999999999998 50-54 20.41 27.815 27.944999999999997 23.830000000000002 55-59 20.905 28.02 27.38 23.695 60-64 21.154999999999998 28.365000000000002 26.905 23.575 65-69 20.835 27.42 27.595 24.15 70-74 20.315 28.825 26.924999999999997 23.935000000000002 75-79 20.365 28.125 27.63 23.880000000000003 80-84 20.82 28.64 26.68 23.86 85-89 20.79 28.185 27.05 23.974999999999998 90-94 21.025 27.425 27.305 24.245 95-99 20.54 27.525 27.99 23.945 100-104 20.72 28.49 26.939999999999998 23.849999999999998 105-109 21.445 27.384999999999998 27.405 23.765 110-114 21.315 27.215 27.275 24.195 115-119 20.53 27.07 27.79 24.610000000000003 120-124 21.605 27.839999999999996 26.884999999999998 23.669999999999998 125-129 21.175 27.700000000000003 27.245 23.880000000000003 130-134 20.84 27.834999999999997 27.415 23.91 135-139 21.75 27.405 27.279999999999998 23.565 140-144 20.835 27.925 27.295 23.945 145-149 21.265 27.765 26.669999999999998 24.3 150-151 20.5875 27.750000000000004 26.937499999999996 24.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.5 25 2.0 26 4.5 27 8.0 28 10.0 29 13.0 30 15.0 31 17.0 32 22.5 33 34.0 34 42.0 35 50.5 36 70.5 37 100.0 38 129.0 39 151.5 40 174.0 41 196.0 42 214.0 43 233.5 44 268.5 45 281.5 46 272.5 47 261.0 48 256.0 49 235.5 50 190.0 51 166.5 52 146.5 53 110.0 54 75.0 55 62.5 56 50.5 57 32.5 58 26.0 59 19.5 60 17.0 61 17.0 62 8.5 63 4.5 64 3.5 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.6375 0.0 0.0 0.0 0.0 128-129 1.7625 0.0 0.0 0.0 0.0 130-131 2.0250000000000004 0.0 0.0 0.0 0.0 132-133 2.1625 0.0 0.0 0.0 0.0 134-135 2.3375 0.0 0.0 0.0 0.0 136-137 2.625 0.0 0.0 0.0 0.0 138-139 2.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTCCT 10 0.0068396386 144.9375 5 >>END_MODULE SRR7030809 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030809_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9035 33.0 33.0 34.0 32.0 34.0 2 33.07975 34.0 33.0 34.0 32.0 34.0 3 33.05875 34.0 33.0 34.0 33.0 34.0 4 33.111 34.0 33.0 34.0 33.0 34.0 5 33.06925 34.0 33.0 34.0 32.0 34.0 6 37.28025 38.0 38.0 38.0 37.0 38.0 7 37.408 38.0 38.0 38.0 37.0 38.0 8 37.339 38.0 38.0 38.0 37.0 38.0 9 37.32725 38.0 38.0 38.0 37.0 38.0 10-14 37.29449999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.2907 38.0 38.0 38.0 37.0 38.0 20-24 37.3125 38.0 38.0 38.0 37.0 38.0 25-29 37.271249999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.3226 38.0 38.0 38.0 37.0 38.0 35-39 37.17255 38.0 38.0 38.0 37.0 38.0 40-44 37.10275 38.0 38.0 38.0 36.6 38.0 45-49 36.99835 38.0 38.0 38.0 36.2 38.0 50-54 37.10065 38.0 38.0 38.0 36.2 38.0 55-59 37.031000000000006 38.0 38.0 38.0 36.0 38.0 60-64 37.0218 38.0 38.0 38.0 36.2 38.0 65-69 36.96065 38.0 38.0 38.0 36.0 38.0 70-74 36.950250000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.837 38.0 38.0 38.0 35.4 38.0 80-84 36.775600000000004 38.0 38.0 38.0 35.4 38.0 85-89 36.576899999999995 38.0 38.0 38.0 34.4 38.0 90-94 36.51975 38.0 38.0 38.0 34.6 38.0 95-99 36.3127 38.0 38.0 38.0 34.0 38.0 100-104 36.15025 38.0 37.8 38.0 33.8 38.0 105-109 36.0467 38.0 37.4 38.0 33.4 38.0 110-114 35.9264 38.0 37.0 38.0 33.0 38.0 115-119 35.6539 38.0 37.0 38.0 31.4 38.0 120-124 35.508750000000006 38.0 36.4 38.0 31.0 38.0 125-129 35.30160000000001 38.0 36.0 38.0 30.0 38.0 130-134 34.854949999999995 38.0 35.4 38.0 27.8 38.0 135-139 34.605000000000004 38.0 35.0 38.0 27.0 38.0 140-144 34.226549999999996 38.0 34.6 38.0 25.2 38.0 145-149 33.5294 38.0 34.6 38.0 20.2 38.0 150-151 29.5415 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 2.0 13 0.0 14 1.0 15 5.0 16 0.0 17 1.0 18 2.0 19 3.0 20 4.0 21 5.0 22 10.0 23 12.0 24 16.0 25 17.0 26 12.0 27 17.0 28 31.0 29 36.0 30 48.0 31 48.0 32 53.0 33 105.0 34 161.0 35 244.0 36 686.0 37 2468.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.18354588647162 21.305326331582897 14.303575893973495 30.207551887971995 2 26.91345672836418 26.3631815907954 29.939969984992498 16.783391695847925 3 20.485242621310658 29.114557278639317 29.514757378689342 20.885442721360683 4 23.261630815407706 34.04202101050525 23.21160580290145 19.484742371185593 5 23.755938984746187 35.608902225556385 22.330582645661416 18.30457614403601 6 21.025 38.0 22.725 18.25 7 20.525 22.475 36.525 20.474999999999998 8 21.875 26.8 26.200000000000003 25.124999999999996 9 20.974999999999998 24.425 29.849999999999998 24.75 10-14 22.49 29.15 26.44 21.92 15-19 22.585 27.944999999999997 27.51 21.959999999999997 20-24 22.325 28.875 26.82 21.98 25-29 23.095 28.455000000000002 27.034999999999997 21.415 30-34 22.814999999999998 27.805000000000003 27.66 21.72 35-39 22.99 27.865000000000002 27.395000000000003 21.75 40-44 22.75 27.565 27.57 22.115000000000002 45-49 22.91 27.705000000000002 27.685 21.7 50-54 23.11 27.889999999999997 27.275 21.725 55-59 23.49 27.16 27.925 21.425 60-64 22.939999999999998 27.975 26.924999999999997 22.16 65-69 23.48 27.455000000000002 27.305 21.759999999999998 70-74 23.435 26.715 27.744999999999997 22.105 75-79 22.7 27.57 27.155 22.575 80-84 23.355 27.794999999999998 27.46 21.39 85-89 23.64 27.495000000000005 27.445000000000004 21.42 90-94 23.36 27.889999999999997 27.305 21.445 95-99 23.285 27.48 27.495000000000005 21.740000000000002 100-104 23.98 27.500000000000004 26.939999999999998 21.58 105-109 23.494999999999997 27.605 27.235 21.665 110-114 24.0 27.865000000000002 27.1 21.035 115-119 23.18 27.71 27.245 21.865000000000002 120-124 23.98 27.93 26.950000000000003 21.14 125-129 24.575 26.93 27.87 20.625 130-134 23.895 27.47 27.235 21.4 135-139 24.21 27.49 27.105 21.195 140-144 24.065 27.639999999999997 27.405 20.89 145-149 24.73 26.840000000000003 27.685 20.745 150-151 24.1375 27.6 27.55 20.7125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 1.0 28 3.5 29 5.5 30 9.5 31 13.5 32 12.0 33 21.0 34 38.5 35 47.5 36 64.0 37 93.0 38 122.0 39 156.0 40 200.0 41 244.0 42 255.0 43 256.5 44 258.0 45 253.0 46 278.5 47 291.0 48 258.0 49 210.5 50 171.0 51 150.0 52 123.5 53 107.0 54 94.5 55 64.0 56 48.5 57 37.5 58 30.5 59 29.0 60 20.0 61 12.0 62 6.5 63 3.5 64 2.5 65 1.0 66 0.0 67 1.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.05 3 0.05 4 0.05 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16771752837327 98.3 2 0.7818411097099622 1.55 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.6375 0.0 0.0 0.0 0.0 128-129 1.7625 0.0 0.0 0.0 0.0 130-131 2.0250000000000004 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.65 0.0 0.0 0.0 0.0 138-139 3.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGTT 10 0.006830828 145.0 2 CCGCTGC 10 0.006830828 145.0 9 GAGAGTA 10 0.006830828 145.0 3 >>END_MODULE Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra Read 963251 spots for SRR7030809.sra Written 963251 spots for SRR7030809.sra SRR ids: ['SRR7030809.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tkkyzfc3 SRR7030809.sra spots: 19265020 blocks: [[1, 963251], [963252, 1926502], [1926503, 2889753], [2889754, 3853004], [3853005, 4816255], [4816256, 5779506], [5779507, 6742757], [6742758, 7706008], [7706009, 8669259], [8669260, 9632510], [9632511, 10595761], [10595762, 11559012], [11559013, 12522263], [12522264, 13485514], [13485515, 14448765], [14448766, 15412016], [15412017, 16375267], [16375268, 17338518], [17338519, 18301769], [18301770, 19265020]] SRR7030809 file size 6506582 SRR7030809 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030809 SRR7030809_1.fastq SRR7030809_2.fastq Input file: SRR7030809_1.fastq Paired file: SRR7030809_2.fastq trimmed: SRR7030809-trimmed-pair1.fastq, SRR7030809-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:51:59 2025 >> started Wed Feb 12 19:52:20 2025 >> done (21.342s) 19265020 read pairs processed; of these: 10306 ( 0.05%) short read pairs filtered out after trimming by size control 9904 ( 0.05%) empty read pairs filtered out after trimming by size control 19244810 (99.90%) read pairs available; of these: 7115004 (36.97%) trimmed read pairs available after processing 12129806 (63.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 4 0.00% 21 3 0.00% 22 2 0.00% 23 2 0.00% 24 5 0.00% 25 6 0.00% 26 6 0.00% 27 7 0.00% 28 2 0.00% 29 0 0.00% 30 4 0.00% 31 5 0.00% 32 5 0.00% 33 3 0.00% 34 4 0.00% 35 3 0.00% 36 2 0.00% 37 6 0.00% 38 8 0.00% 39 8 0.00% 40 9 0.00% 41 2 0.00% 42 6 0.00% 43 6 0.00% 44 13 0.00% 45 6 0.00% 46 12 0.00% 47 11 0.00% 48 11 0.00% 49 20 0.00% 50 13 0.00% 51 19 0.00% 52 19 0.00% 53 30 0.00% 54 11 0.00% 55 35 0.00% 56 20 0.00% 57 37 0.00% 58 24 0.00% 59 40 0.00% 60 57 0.00% 61 53 0.00% 62 67 0.00% 63 48 0.00% 64 77 0.00% 65 70 0.00% 66 99 0.00% 67 104 0.00% 68 116 0.00% 69 110 0.00% 70 152 0.00% 71 180 0.00% 72 205 0.00% 73 242 0.00% 74 280 0.00% 75 313 0.00% 76 335 0.00% 77 396 0.00% 78 398 0.00% 79 488 0.00% 80 590 0.00% 81 631 0.00% 82 794 0.00% 83 950 0.00% 84 1524 0.01% 85 1974 0.01% 86 2109 0.01% 87 2339 0.01% 88 2538 0.01% 89 2759 0.01% 90 2757 0.01% 91 3034 0.02% 92 3225 0.02% 93 3464 0.02% 94 3795 0.02% 95 4028 0.02% 96 4252 0.02% 97 4619 0.02% 98 4908 0.03% 99 5115 0.03% 100 5670 0.03% 101 6075 0.03% 102 6560 0.03% 103 6937 0.04% 104 7531 0.04% 105 8376 0.04% 106 8812 0.05% 107 9207 0.05% 108 9769 0.05% 109 10052 0.05% 110 10795 0.06% 111 11733 0.06% 112 12589 0.07% 113 13501 0.07% 114 14254 0.07% 115 15448 0.08% 116 16429 0.09% 117 17327 0.09% 118 18037 0.09% 119 18858 0.10% 120 19657 0.10% 121 21196 0.11% 122 22278 0.12% 123 23541 0.12% 124 25063 0.13% 125 26551 0.14% 126 28099 0.15% 127 29663 0.15% 128 31074 0.16% 129 32759 0.17% 130 34469 0.18% 131 36034 0.19% 132 38685 0.20% 133 41781 0.22% 134 44700 0.23% 135 47715 0.25% 136 50997 0.26% 137 54994 0.29% 138 60651 0.32% 139 64918 0.34% 140 69202 0.36% 141 75642 0.39% 142 83648 0.43% 143 95420 0.50% 144 111699 0.58% 145 134716 0.70% 146 169488 0.88% 147 230589 1.20% 148 361060 1.88% 149 712711 3.70% 150 4048411 21.04% 151 12129806 63.03% 19244810 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.58 fanout-score-rank=15 prefix-density=0.34 prefix-fanout=4.4 sequence=GCTCCAAGCATGGCCCACCTGGAATGGATGACTTCAAGCTCACGGTTCTTGGCAAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=42 fanout-score=113.36 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.5 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTA criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=38 prefix-density=0.54 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=31 fanout-score=24.50 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=5.0 sequence=GGCAGTGAAGCACACTCTATTCGTGAAGTTCAAAGATGACGTTACCAGAGAGCAAATTGAGAAAATCATAAACGACTTCACTCATCTGGTCAATCAAGTTGAACCCTTGAAGAGCTTACACTGGGGCACTAATCTGGGTATTCACGACCTCAATTTCGGATATACTCATGCTTTTGAAACTACCTTTGATGATCTGGAGGGCTTGCAGGAGTATCTTGATTCTTCGGTTGTTGCTAAATTCGCAGAAGGATTCTTGCCAACCATGTCGCA SRR7030809 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:53:11 Started mapping on | Feb 12 19:53:11 Finished on | Feb 12 19:54:52 Mapping speed, Million of reads per hour | 685.95 Number of input reads | 19244810 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18398036 Uniquely mapped reads % | 95.60% Average mapped length | 297.31 Number of splices: Total | 18032822 Number of splices: Annotated (sjdb) | 17813479 Number of splices: GT/AG | 17702789 Number of splices: GC/AG | 283880 Number of splices: AT/AC | 10754 Number of splices: Non-canonical | 35399 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 552267 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 104787 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 306559 306559 306559 N_multimapping 552267 552267 552267 N_noFeature 221375 18233154 284496 N_ambiguous 198252 620 96122 UnstrandedReadsAssigned:17978409 PositiveStrandReadsAssigned:164262 NegativeStrandReadsAssigned:18017418 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030809 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030809-trimmed-pair1.fastq SRR7030809-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,244,810 reads, 18,084,637 reads pseudoaligned [quant] estimated average fragment length: 255.398 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,001 rounds 52401 SRR7030809.ke.tsv 34699 SRR7030809.se.tsv 87100 total ==> SRR7030809.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.6 1835 44.3614 Potri.005G024800.1.v4.1 1035 780.602 607 33.1535 Potri.004G059700.1.v4.1 961 706.627 19 1.14639 Potri.007G009000.2.v4.1 1416 1161.6 0 0 Potri.003G141000.2.v4.1 2943 2688.6 492 7.80205 Potri.016G087400.1.v4.1 270 68.67 915.919 568.67 Potri.015G069301.1.v4.1 564 313.499 0 0 Potri.010G195200.1.v4.1 1773 1518.6 20 0.561508 Potri.012G127500.1.v4.1 977 722.609 1710 100.893 ==> SRR7030809.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 243 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 88 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7030809 completed mapping pipeline successfully