Starting /dee2/code/volunteer_pipeline.sh SRR7030810 current disk space = 3050895294464 free memory = 1576484156 SRR7030810 SRAfilesize 7b5df2cf46aa9783c9a17a94cdfad821 SRR7030810.sra SRR7030810.sra file validated SRR7030810 is paired end SRR7030810 is conventional basespace SRR7030810 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030810_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.271 30.0 18.0 33.0 18.0 33.0 2 28.17175 30.0 25.0 33.0 18.0 33.0 3 30.45125 31.0 29.0 33.0 27.0 33.0 4 30.96325 33.0 31.0 33.0 28.0 33.0 5 32.51575 33.0 33.0 33.0 32.0 34.0 6 36.5905 38.0 37.0 38.0 34.0 38.0 7 36.95675 38.0 38.0 38.0 35.0 38.0 8 37.184 38.0 38.0 38.0 36.0 38.0 9 37.338 38.0 38.0 38.0 37.0 38.0 10-14 37.3875 38.0 38.0 38.0 37.0 38.0 15-19 37.42865 38.0 38.0 38.0 37.0 38.0 20-24 37.42375 38.0 38.0 38.0 37.0 38.0 25-29 37.3753 38.0 38.0 38.0 37.0 38.0 30-34 37.30585 38.0 38.0 38.0 36.8 38.0 35-39 37.268699999999995 38.0 38.0 38.0 36.8 38.0 40-44 37.17575 38.0 38.0 38.0 36.4 38.0 45-49 37.1842 38.0 38.0 38.0 36.4 38.0 50-54 37.20005 38.0 38.0 38.0 36.2 38.0 55-59 37.12705 38.0 38.0 38.0 36.0 38.0 60-64 37.063849999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.98785 38.0 38.0 38.0 36.0 38.0 70-74 36.9259 38.0 38.0 38.0 35.6 38.0 75-79 36.8501 38.0 38.0 38.0 35.0 38.0 80-84 36.81250000000001 38.0 38.0 38.0 35.0 38.0 85-89 36.637449999999994 38.0 38.0 38.0 34.2 38.0 90-94 36.568 38.0 38.0 38.0 34.0 38.0 95-99 36.14835 38.0 37.4 38.0 33.0 38.0 100-104 36.26445 38.0 37.8 38.0 33.8 38.0 105-109 35.9593 38.0 37.0 38.0 32.6 38.0 110-114 35.97585 38.0 37.0 38.0 33.0 38.0 115-119 35.78055 38.0 36.8 38.0 31.8 38.0 120-124 35.57785 38.0 36.2 38.0 31.0 38.0 125-129 35.1967 38.0 36.0 38.0 28.4 38.0 130-134 34.9868 38.0 35.4 38.0 28.0 38.0 135-139 34.65305 38.0 35.0 38.0 27.4 38.0 140-144 34.34250000000001 38.0 35.0 38.0 25.4 38.0 145-149 33.60585 38.0 34.4 38.0 20.6 38.0 150-151 30.352375 36.5 28.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 8.0 20 7.0 21 6.0 22 7.0 23 8.0 24 9.0 25 11.0 26 24.0 27 22.0 28 29.0 29 34.0 30 38.0 31 64.0 32 91.0 33 117.0 34 177.0 35 348.0 36 814.0 37 2182.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.02579418951942 12.462666304642953 10.806407819712192 41.70513168612544 2 22.25 13.625000000000002 34.125 30.0 3 19.275000000000002 17.9 27.250000000000004 35.575 4 22.675 23.849999999999998 24.9 28.575 5 21.9 31.574999999999996 24.5 22.025 6 17.95 35.15 25.25 21.65 7 13.5 28.225 41.05 17.224999999999998 8 18.175 25.674999999999997 31.025000000000002 25.124999999999996 9 16.575 24.8 33.925 24.7 10-14 19.735 29.349999999999998 27.310000000000002 23.605 15-19 20.150000000000002 27.975 28.04 23.835 20-24 19.875 29.065 27.735 23.325000000000003 25-29 19.64 28.575 27.57 24.215 30-34 19.505 28.139999999999997 27.834999999999997 24.52 35-39 20.244999999999997 28.775000000000002 27.015 23.965 40-44 20.07 28.355000000000004 27.67 23.905 45-49 19.73 28.64 27.634999999999998 23.995 50-54 20.155 28.294999999999998 27.82 23.73 55-59 19.875 28.12 27.765 24.240000000000002 60-64 19.865 28.015 27.72 24.4 65-69 19.88 27.944999999999997 28.275 23.9 70-74 20.525 28.32 27.725 23.43 75-79 19.98 27.74 27.815 24.465 80-84 19.98 28.01 28.035 23.974999999999998 85-89 19.835 28.025 27.735 24.404999999999998 90-94 20.315 27.37 28.294999999999998 24.02 95-99 20.61 28.23 27.705000000000002 23.455000000000002 100-104 20.49 28.075 27.750000000000004 23.685000000000002 105-109 20.34 28.044999999999998 27.500000000000004 24.115000000000002 110-114 20.555 27.97 27.639999999999997 23.835 115-119 20.14 28.299999999999997 27.845 23.715 120-124 20.16 27.794999999999998 28.26 23.785 125-129 20.424999999999997 27.505000000000003 27.405 24.665 130-134 20.24 28.33 27.644999999999996 23.785 135-139 20.005 27.415 28.125 24.455 140-144 20.31 27.985 27.55 24.154999999999998 145-149 21.025 28.015 27.425 23.535 150-151 21.092773193298324 28.00700175043761 26.9567391847962 23.943485871467868 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.5 25 3.5 26 6.5 27 8.0 28 9.0 29 11.5 30 16.0 31 28.0 32 36.5 33 41.5 34 61.5 35 73.5 36 80.0 37 104.5 38 132.0 39 153.0 40 185.5 41 207.5 42 219.5 43 256.5 44 261.5 45 262.0 46 257.0 47 250.0 48 237.0 49 207.5 50 193.0 51 150.0 52 117.5 53 110.5 54 90.0 55 62.5 56 41.5 57 26.5 58 22.5 59 20.5 60 15.5 61 12.0 62 10.5 63 5.5 64 1.5 65 0.5 66 1.0 67 1.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.9125000000000001 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.0499999999999998 0.0 0.0 0.0 0.0 124-125 1.2000000000000002 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.4874999999999998 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.0625 0.0 0.0 0.0 0.0 136-137 2.3125 0.0 0.0 0.0 0.0 138-139 2.4749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTGTT 10 0.006841402 144.925 145 ACATTAT 10 0.006841402 144.925 3 >>END_MODULE SRR7030810 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030810_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.563 33.0 33.0 34.0 32.0 34.0 2 32.7505 33.0 33.0 34.0 32.0 34.0 3 32.78025 33.0 33.0 34.0 32.0 34.0 4 32.7395 33.0 33.0 34.0 32.0 34.0 5 32.769 33.0 33.0 34.0 32.0 34.0 6 36.98025 38.0 38.0 38.0 36.0 38.0 7 37.06475 38.0 38.0 38.0 36.0 38.0 8 37.0215 38.0 38.0 38.0 36.0 38.0 9 36.93775 38.0 38.0 38.0 36.0 38.0 10-14 37.031949999999995 38.0 38.0 38.0 36.0 38.0 15-19 36.8504 38.0 38.0 38.0 35.6 38.0 20-24 36.9511 38.0 38.0 38.0 35.8 38.0 25-29 36.9105 38.0 38.0 38.0 36.0 38.0 30-34 36.91095 38.0 38.0 38.0 36.0 38.0 35-39 36.87475 38.0 38.0 38.0 36.0 38.0 40-44 36.68035 38.0 38.0 38.0 35.0 38.0 45-49 36.58685 38.0 38.0 38.0 34.6 38.0 50-54 36.68695 38.0 38.0 38.0 35.0 38.0 55-59 36.658100000000005 38.0 38.0 38.0 34.6 38.0 60-64 36.589200000000005 38.0 38.0 38.0 34.4 38.0 65-69 36.4008 38.0 38.0 38.0 34.0 38.0 70-74 36.402 38.0 38.0 38.0 34.0 38.0 75-79 36.27 38.0 37.8 38.0 33.6 38.0 80-84 36.23935 38.0 37.8 38.0 33.6 38.0 85-89 36.07195 38.0 37.0 38.0 33.2 38.0 90-94 36.0012 38.0 37.0 38.0 33.0 38.0 95-99 35.8644 38.0 37.0 38.0 31.8 38.0 100-104 35.5361 38.0 36.8 38.0 30.2 38.0 105-109 35.4327 38.0 36.6 38.0 29.8 38.0 110-114 35.169549999999994 38.0 36.0 38.0 28.2 38.0 115-119 34.9919 38.0 36.0 38.0 27.4 38.0 120-124 34.86175 38.0 35.2 38.0 27.6 38.0 125-129 34.2494 38.0 34.6 38.0 24.4 38.0 130-134 34.05395 38.0 35.0 38.0 23.0 38.0 135-139 33.489599999999996 38.0 34.0 38.0 20.6 38.0 140-144 32.2811 37.4 31.6 38.0 15.2 38.0 145-149 31.476100000000002 36.6 31.4 38.0 11.2 38.0 150-151 27.644 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 1.0 5 0.0 6 1.0 7 3.0 8 1.0 9 2.0 10 1.0 11 1.0 12 0.0 13 2.0 14 2.0 15 4.0 16 2.0 17 3.0 18 6.0 19 6.0 20 8.0 21 13.0 22 17.0 23 12.0 24 21.0 25 32.0 26 27.0 27 40.0 28 38.0 29 50.0 30 65.0 31 68.0 32 73.0 33 146.0 34 212.0 35 410.0 36 821.0 37 1906.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.08408408408408 20.145145145145147 16.016016016016017 29.754754754754753 2 27.284105131414265 26.933667083854818 28.71088861076345 17.07133917396746 3 21.206810215322985 28.217325988983475 30.24536805207812 20.330495743615423 4 22.728410513141426 34.34292866082603 23.729662077597 19.198998748435546 5 24.324324324324326 35.08508508508508 23.5985985985986 16.99199199199199 6 20.795795795795797 39.16416416416417 22.997997997998 17.04204204204204 7 19.26926926926927 22.972972972972975 38.91391391391391 18.843843843843842 8 22.4974974974975 26.05105105105105 28.053053053053052 23.3983983983984 9 22.942206654991242 26.870152614460846 28.74655991993996 21.441080810607957 10-14 23.3343337334934 29.996998799519808 25.70528211284514 20.963385354141657 15-19 22.969593918783758 28.895779155831164 26.910382076415285 21.224244848969796 20-24 22.829565913182638 28.655731146229247 27.795559111822364 20.719143828765755 25-29 22.551765529658898 29.308792637791335 27.233169950985296 20.90627188156447 30-34 22.749549909981997 29.285857171434287 27.350470094018803 20.614122824564912 35-39 23.0 28.37 27.794999999999998 20.835 40-44 23.135 28.735 27.634999999999998 20.495 45-49 23.352005601680503 27.74332299689907 28.49354806441933 20.4111233370011 50-54 23.076923076923077 27.856463640458433 28.326910565036783 20.739702717581704 55-59 23.35101591432289 28.4205785206686 27.23451105995396 20.99389450505455 60-64 23.27629340538377 28.319823876713702 28.019613729610725 20.384268988291804 65-69 23.671570099069346 27.349144401080753 27.994596217352147 20.984689282497747 70-74 23.22822822822823 27.87787787787788 28.128128128128125 20.765765765765764 75-79 23.51498773957864 27.508382124806086 27.938747935745383 21.03788219986989 80-84 23.563563563563562 28.053053053053052 27.807807807807805 20.575575575575574 85-89 23.617989894441944 28.24553504427435 27.735254389914456 20.401220671369252 90-94 24.340821533997097 28.17831590533847 27.27272727272727 20.20813528793716 95-99 23.176223356349446 27.494245972180526 27.809466626638645 21.520064044831383 100-104 23.453453453453456 28.143143143143146 28.203203203203202 20.2002002002002 105-109 23.57857857857858 27.822822822822822 27.72272272272272 20.875875875875877 110-114 23.63863863863864 27.52752752752753 28.048048048048045 20.785785785785784 115-119 23.346011410269245 28.16534881393254 27.860074066659994 20.628565709138226 120-124 23.373373373373376 28.233233233233236 28.213213213213212 20.18018018018018 125-129 24.352046432502753 27.77944561192835 27.824477133993796 20.044030821575102 130-134 23.278622898318655 27.83226581265012 28.49279423538831 20.396317053642914 135-139 24.229383506805444 27.997397918334666 27.46196957566053 20.31124899919936 140-144 24.75975975975976 27.94794794794795 27.387387387387385 19.904904904904903 145-149 24.43943943943944 27.95795795795796 27.40740740740741 20.195195195195197 150-151 24.099549774887443 28.05152576288144 27.763881940970485 20.08504252126063 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.0 18 1.5 19 2.0 20 2.0 21 2.0 22 0.5 23 1.0 24 2.5 25 4.5 26 5.5 27 3.5 28 4.5 29 8.5 30 15.0 31 20.0 32 23.5 33 39.0 34 55.5 35 61.0 36 77.0 37 106.5 38 139.0 39 166.5 40 197.5 41 237.5 42 261.5 43 273.5 44 282.0 45 281.5 46 274.0 47 261.5 48 224.5 49 196.0 50 176.5 51 139.5 52 107.5 53 80.0 54 64.0 55 49.0 56 34.0 57 29.0 58 26.5 59 19.5 60 10.5 61 8.5 62 7.5 63 5.5 64 3.5 65 0.5 66 0.5 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.125 3 0.15 4 0.125 5 0.1 6 0.1 7 0.1 8 0.1 9 0.075 10-14 0.04 15-19 0.02 20-24 0.02 25-29 0.03 30-34 0.02 35-39 0.0 40-44 0.0 45-49 0.03 50-54 0.095 55-59 0.09 60-64 0.06999999999999999 65-69 0.06999999999999999 70-74 0.1 75-79 0.08499999999999999 80-84 0.1 85-89 0.055 90-94 0.065 95-99 0.06999999999999999 100-104 0.1 105-109 0.1 110-114 0.1 115-119 0.09 120-124 0.1 125-129 0.06999999999999999 130-134 0.08 135-139 0.08 140-144 0.1 145-149 0.1 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5284348263714143 1.05 3 0.025163563160543533 0.075 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.7749999999999999 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.15 0.0 0.0 0.0 0.0 126-127 1.2625 0.0 0.0 0.0 0.0 128-129 1.4375 0.0 0.0 0.0 0.0 130-131 1.6625 0.0 0.0 0.0 0.0 132-133 1.8250000000000002 0.0 0.0 0.0 0.0 134-135 2.025 0.0 0.0 0.0 0.0 136-137 2.2625 0.0 0.0 0.0 0.0 138-139 2.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTACA 10 0.006830828 145.0 5 GGAAAGA 10 0.006830828 145.0 1 >>END_MODULE Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083695 spots for SRR7030810.sra Written 1083695 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra Read 1083681 spots for SRR7030810.sra Written 1083681 spots for SRR7030810.sra SRR ids: ['SRR7030810.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l6zvk8g0 SRR7030810.sra spots: 21673634 blocks: [[1, 1083681], [1083682, 2167362], [2167363, 3251043], [3251044, 4334724], [4334725, 5418405], [5418406, 6502086], [6502087, 7585767], [7585768, 8669448], [8669449, 9753129], [9753130, 10836810], [10836811, 11920491], [11920492, 13004172], [13004173, 14087853], [14087854, 15171534], [15171535, 16255215], [16255216, 17338896], [17338897, 18422577], [18422578, 19506258], [19506259, 20589939], [20589940, 21673634]] SRR7030810 file size 7322783 SRR7030810 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030810 SRR7030810_1.fastq SRR7030810_2.fastq Input file: SRR7030810_1.fastq Paired file: SRR7030810_2.fastq trimmed: SRR7030810-trimmed-pair1.fastq, SRR7030810-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:50:47 2025 >> started Wed Feb 12 19:51:19 2025 >> done (31.737s) 21673634 read pairs processed; of these: 17259 ( 0.08%) short read pairs filtered out after trimming by size control 22554 ( 0.10%) empty read pairs filtered out after trimming by size control 21633821 (99.82%) read pairs available; of these: 8742528 (40.41%) trimmed read pairs available after processing 12891293 (59.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 1 0.00% 21 2 0.00% 22 9 0.00% 23 4 0.00% 24 4 0.00% 25 1 0.00% 26 3 0.00% 27 6 0.00% 28 5 0.00% 29 5 0.00% 30 8 0.00% 31 7 0.00% 32 11 0.00% 33 4 0.00% 34 6 0.00% 35 7 0.00% 36 5 0.00% 37 6 0.00% 38 8 0.00% 39 6 0.00% 40 7 0.00% 41 6 0.00% 42 6 0.00% 43 7 0.00% 44 8 0.00% 45 16 0.00% 46 9 0.00% 47 18 0.00% 48 11 0.00% 49 12 0.00% 50 18 0.00% 51 17 0.00% 52 19 0.00% 53 24 0.00% 54 24 0.00% 55 26 0.00% 56 19 0.00% 57 32 0.00% 58 40 0.00% 59 52 0.00% 60 41 0.00% 61 60 0.00% 62 51 0.00% 63 72 0.00% 64 77 0.00% 65 84 0.00% 66 111 0.00% 67 113 0.00% 68 111 0.00% 69 142 0.00% 70 148 0.00% 71 175 0.00% 72 205 0.00% 73 224 0.00% 74 273 0.00% 75 308 0.00% 76 361 0.00% 77 400 0.00% 78 458 0.00% 79 518 0.00% 80 580 0.00% 81 680 0.00% 82 819 0.00% 83 1023 0.00% 84 1821 0.01% 85 2430 0.01% 86 2588 0.01% 87 2786 0.01% 88 2915 0.01% 89 3083 0.01% 90 3227 0.01% 91 3388 0.02% 92 3575 0.02% 93 3851 0.02% 94 4267 0.02% 95 4350 0.02% 96 4753 0.02% 97 5038 0.02% 98 5620 0.03% 99 6065 0.03% 100 5940 0.03% 101 6350 0.03% 102 6940 0.03% 103 7399 0.03% 104 8006 0.04% 105 8614 0.04% 106 9476 0.04% 107 10104 0.05% 108 10760 0.05% 109 11536 0.05% 110 12380 0.06% 111 13515 0.06% 112 14449 0.07% 113 15679 0.07% 114 17085 0.08% 115 18290 0.08% 116 19589 0.09% 117 20775 0.10% 118 21575 0.10% 119 23056 0.11% 120 24344 0.11% 121 26166 0.12% 122 27369 0.13% 123 29126 0.13% 124 31149 0.14% 125 33215 0.15% 126 34963 0.16% 127 37296 0.17% 128 39438 0.18% 129 41782 0.19% 130 45407 0.21% 131 47321 0.22% 132 50824 0.23% 133 54465 0.25% 134 58276 0.27% 135 62847 0.29% 136 67565 0.31% 137 73208 0.34% 138 80153 0.37% 139 88117 0.41% 140 95603 0.44% 141 103984 0.48% 142 115617 0.53% 143 131946 0.61% 144 155575 0.72% 145 187430 0.87% 146 240329 1.11% 147 319150 1.48% 148 476092 2.20% 149 945892 4.37% 150 4689086 21.67% 151 12891293 59.59% 21633821 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=37 prefix-density=0.26 prefix-fanout=2.2 sequence=ACTGATTCCTTTGCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=113.23 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=20.7 sequence=CCTTCTTCTTGA criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=35 prefix-density=0.44 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=12 fanout-score=172.83 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=27.0 sequence=AAAGAAGAAAAACAGTTTCTCAAGAGCAGTATATATAGATCTTTCAGAAGAATTAAGGAGATGGCAGACGAGGGAACAGCTACTTGCATAGACATCTTGTTGGCCATCATCTTGCCTCCGCTTGGTGTCTTCCTCAAGTT SRR7030810 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:52:18 Started mapping on | Feb 12 19:52:18 Finished on | Feb 12 19:54:36 Mapping speed, Million of reads per hour | 564.36 Number of input reads | 21633821 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20662354 Uniquely mapped reads % | 95.51% Average mapped length | 296.74 Number of splices: Total | 19247421 Number of splices: Annotated (sjdb) | 18879700 Number of splices: GT/AG | 18938657 Number of splices: GC/AG | 242970 Number of splices: AT/AC | 14594 Number of splices: Non-canonical | 51200 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 594050 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 172045 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.83% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 395440 395440 395440 N_multimapping 594050 594050 594050 N_noFeature 502790 20432824 617742 N_ambiguous 217445 1273 102220 UnstrandedReadsAssigned:19942119 PositiveStrandReadsAssigned:228257 NegativeStrandReadsAssigned:19942392 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030810 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030810-trimmed-pair1.fastq SRR7030810-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,633,821 reads, 19,977,352 reads pseudoaligned [quant] estimated average fragment length: 250.546 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR7030810.ke.tsv 34699 SRR7030810.se.tsv 87100 total ==> SRR7030810.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.45 2881 59.8961 Potri.005G024800.1.v4.1 1035 785.454 2817 131.861 Potri.004G059700.1.v4.1 961 711.467 14 0.723473 Potri.007G009000.2.v4.1 1416 1166.45 0 0 Potri.003G141000.2.v4.1 2943 2693.45 958.257 13.0804 Potri.016G087400.1.v4.1 270 69.8179 1107.89 583.417 Potri.015G069301.1.v4.1 564 317.804 0 0 Potri.010G195200.1.v4.1 1773 1523.45 30 0.724004 Potri.012G127500.1.v4.1 977 727.454 11993 606.138 ==> SRR7030810.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 32 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7030810 completed mapping pipeline successfully