Starting /dee2/code/volunteer_pipeline.sh SRR7030811 current disk space = 3051130503168 free memory = 1457094132 SRR7030811 SRAfilesize 7e490a6b9ccfadad1b18ac871c059dc1 SRR7030811.sra SRR7030811.sra file validated SRR7030811 is paired end SRR7030811 is conventional basespace SRR7030811 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030811_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.918 33.0 33.0 34.0 31.0 34.0 2 32.45625 33.0 33.0 34.0 30.0 34.0 3 32.69825 33.0 33.0 34.0 31.0 34.0 4 32.6725 33.0 33.0 34.0 32.0 34.0 5 32.5375 33.0 33.0 34.0 31.0 34.0 6 36.9545 38.0 37.0 38.0 35.0 38.0 7 37.27175 38.0 38.0 38.0 36.0 38.0 8 37.44425 38.0 38.0 38.0 37.0 38.0 9 37.554 38.0 38.0 38.0 38.0 38.0 10-14 37.4587 38.0 38.0 38.0 38.0 38.0 15-19 37.55185 38.0 38.0 38.0 38.0 38.0 20-24 37.4668 38.0 38.0 38.0 37.8 38.0 25-29 37.4021 38.0 38.0 38.0 37.6 38.0 30-34 37.376099999999994 38.0 38.0 38.0 37.4 38.0 35-39 37.4012 38.0 38.0 38.0 37.4 38.0 40-44 37.4243 38.0 38.0 38.0 37.4 38.0 45-49 37.33455 38.0 38.0 38.0 37.0 38.0 50-54 37.330450000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.287 38.0 38.0 38.0 37.0 38.0 60-64 37.2218 38.0 38.0 38.0 36.8 38.0 65-69 37.19584999999999 38.0 38.0 38.0 36.8 38.0 70-74 37.24455 38.0 38.0 38.0 37.0 38.0 75-79 37.138349999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.888850000000005 38.0 38.0 38.0 35.6 38.0 85-89 36.704899999999995 38.0 38.0 38.0 34.6 38.0 90-94 36.733999999999995 38.0 38.0 38.0 34.8 38.0 95-99 36.682649999999995 38.0 38.0 38.0 34.8 38.0 100-104 36.643950000000004 38.0 38.0 38.0 34.4 38.0 105-109 36.54095 38.0 38.0 38.0 34.0 38.0 110-114 36.24455 38.0 37.6 38.0 33.6 38.0 115-119 36.131150000000005 38.0 37.8 38.0 33.2 38.0 120-124 35.879 38.0 37.0 38.0 32.2 38.0 125-129 35.711200000000005 38.0 36.6 38.0 31.0 38.0 130-134 35.504900000000006 38.0 36.2 38.0 31.0 38.0 135-139 35.1659 38.0 35.8 38.0 29.2 38.0 140-144 34.518499999999996 38.0 35.0 38.0 25.8 38.0 145-149 34.07015 38.0 34.6 38.0 24.0 38.0 150-151 30.032375 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 4.0 17 1.0 18 3.0 19 3.0 20 2.0 21 1.0 22 3.0 23 3.0 24 7.0 25 8.0 26 18.0 27 18.0 28 20.0 29 37.0 30 41.0 31 56.0 32 67.0 33 122.0 34 150.0 35 253.0 36 595.0 37 2585.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.694859458090654 12.281590276019246 7.546214231451 35.4773360344391 2 23.225 13.3 33.875 29.599999999999998 3 19.15 18.55 27.625 34.675 4 23.35 25.674999999999997 23.974999999999998 27.0 5 23.64864864864865 29.954954954954953 24.4994994994995 21.896896896896898 6 19.225 34.075 24.425 22.275 7 15.9 27.950000000000003 37.5 18.65 8 18.975 26.450000000000003 30.475 24.099999999999998 9 17.875 23.275000000000002 34.55 24.3 10-14 20.349999999999998 29.49 26.36 23.799999999999997 15-19 20.775 28.215 27.11 23.9 20-24 19.689999999999998 28.225 27.584999999999997 24.5 25-29 20.43 28.365000000000002 27.16 24.044999999999998 30-34 19.939999999999998 28.665000000000003 27.250000000000004 24.145 35-39 20.085 28.505000000000003 27.24 24.169999999999998 40-44 21.11 28.134999999999998 26.555 24.2 45-49 20.695 28.465 26.775 24.065 50-54 20.215 28.84 27.134999999999998 23.810000000000002 55-59 20.715 27.994999999999997 27.05 24.240000000000002 60-64 20.95 28.555000000000003 26.479999999999997 24.015 65-69 20.96 28.349999999999998 27.415 23.275000000000002 70-74 20.73 27.560000000000002 27.694999999999997 24.015 75-79 20.36 27.694999999999997 27.58 24.365000000000002 80-84 21.33 27.279999999999998 27.66 23.73 85-89 20.549999999999997 28.115000000000002 27.6 23.735 90-94 20.84 27.450000000000003 27.55 24.16 95-99 20.315 27.76 27.565 24.36 100-104 20.645 27.700000000000003 27.894999999999996 23.76 105-109 21.075 27.250000000000004 27.875 23.799999999999997 110-114 20.735 28.13 26.924999999999997 24.21 115-119 21.145 27.77 27.529999999999998 23.555 120-124 20.979999999999997 27.915 27.115000000000002 23.990000000000002 125-129 21.154999999999998 27.339999999999996 27.505000000000003 24.0 130-134 20.845 27.48 27.755000000000003 23.919999999999998 135-139 21.490000000000002 27.644999999999996 27.205000000000002 23.66 140-144 21.295 27.66 27.155 23.89 145-149 21.09 27.644999999999996 27.42 23.845 150-151 21.7 26.325 27.900000000000002 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 1.5 23 2.5 24 3.5 25 3.0 26 2.5 27 6.0 28 11.5 29 13.0 30 15.5 31 22.0 32 30.5 33 35.0 34 43.5 35 60.5 36 79.5 37 93.0 38 109.0 39 131.5 40 155.0 41 190.5 42 221.5 43 235.5 44 255.0 45 272.5 46 265.5 47 244.0 48 239.5 49 228.0 50 196.0 51 163.0 52 132.0 53 120.5 54 97.5 55 72.0 56 60.0 57 42.0 58 32.5 59 30.0 60 23.5 61 16.0 62 12.5 63 11.5 64 6.0 65 2.0 66 1.0 67 0.5 68 1.0 69 2.0 70 2.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.07500000000000001 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.7875000000000001 0.0 0.0 0.0 0.0 126-127 0.9874999999999999 0.0 0.0 0.0 0.0 128-129 1.1375000000000002 0.0 0.0 0.0 0.0 130-131 1.2625 0.0 0.0 0.0 0.0 132-133 1.45 0.0 0.0 0.0 0.0 134-135 1.6625 0.0 0.0 0.0 0.0 136-137 1.825 0.0 0.0 0.0 0.0 138-139 1.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATAAC 10 0.006830828 145.0 2 >>END_MODULE SRR7030811 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030811_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7825 34.0 33.0 34.0 32.0 34.0 2 32.8125 34.0 33.0 34.0 32.0 34.0 3 32.71475 34.0 33.0 34.0 32.0 34.0 4 32.74625 34.0 33.0 34.0 32.0 34.0 5 32.7635 34.0 33.0 34.0 32.0 34.0 6 36.9605 38.0 38.0 38.0 36.0 38.0 7 36.94025 38.0 38.0 38.0 36.0 38.0 8 36.9935 38.0 38.0 38.0 37.0 38.0 9 36.924 38.0 38.0 38.0 36.0 38.0 10-14 36.92975 38.0 38.0 38.0 36.6 38.0 15-19 36.88635000000001 38.0 38.0 38.0 36.6 38.0 20-24 36.777550000000005 38.0 38.0 38.0 35.8 38.0 25-29 36.74715 38.0 38.0 38.0 36.2 38.0 30-34 36.785399999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.6995 38.0 38.0 38.0 36.0 38.0 40-44 36.645700000000005 38.0 38.0 38.0 35.8 38.0 45-49 36.56585 38.0 38.0 38.0 35.6 38.0 50-54 36.51075 38.0 38.0 38.0 35.2 38.0 55-59 36.4452 38.0 38.0 38.0 34.8 38.0 60-64 36.426249999999996 38.0 38.0 38.0 35.0 38.0 65-69 36.47265 38.0 38.0 38.0 35.0 38.0 70-74 36.2531 38.0 38.0 38.0 34.0 38.0 75-79 36.078500000000005 38.0 38.0 38.0 33.2 38.0 80-84 36.215700000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.1568 38.0 38.0 38.0 33.8 38.0 90-94 36.1004 38.0 38.0 38.0 33.8 38.0 95-99 35.9639 38.0 38.0 38.0 33.4 38.0 100-104 35.58165 38.0 37.4 38.0 31.2 38.0 105-109 35.462450000000004 38.0 37.0 38.0 30.2 38.0 110-114 35.425050000000006 38.0 37.0 38.0 30.2 38.0 115-119 35.281600000000005 38.0 36.8 38.0 30.0 38.0 120-124 34.91895 38.0 36.0 38.0 27.6 38.0 125-129 34.50725 38.0 35.0 38.0 25.4 38.0 130-134 34.4708 38.0 35.0 38.0 25.4 38.0 135-139 33.9644 38.0 34.6 38.0 21.2 38.0 140-144 33.23055000000001 38.0 33.0 38.0 18.2 38.0 145-149 32.1078 38.0 32.6 38.0 11.0 38.0 150-151 27.80475 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 12.0 4 2.0 5 1.0 6 2.0 7 1.0 8 3.0 9 2.0 10 0.0 11 3.0 12 3.0 13 3.0 14 4.0 15 3.0 16 7.0 17 4.0 18 4.0 19 7.0 20 10.0 21 8.0 22 11.0 23 14.0 24 18.0 25 18.0 26 28.0 27 23.0 28 35.0 29 38.0 30 61.0 31 69.0 32 100.0 33 108.0 34 176.0 35 263.0 36 598.0 37 2344.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.07268170426065 21.654135338345863 12.456140350877194 26.81704260651629 2 27.290936404606907 26.84026039058588 27.391086629944915 18.477716574862292 3 20.150375939849624 28.92230576441103 31.403508771929822 19.523809523809526 4 23.872745490981963 33.06613226452906 23.42184368737475 19.639278557114228 5 25.18796992481203 36.31578947368421 21.17794486215539 17.318295739348372 6 21.2 38.2 21.625 18.975 7 19.775000000000002 23.1 37.5 19.625 8 21.475 24.95 27.250000000000004 26.325 9 21.075 25.2 30.049999999999997 23.674999999999997 10-14 23.14 29.345 26.105 21.41 15-19 23.16 27.675 27.245 21.92 20-24 23.1 27.805000000000003 27.744999999999997 21.349999999999998 25-29 22.765 28.305000000000003 26.97 21.959999999999997 30-34 22.73 28.689999999999998 26.865 21.715 35-39 22.795 28.060000000000002 27.185 21.959999999999997 40-44 22.625 28.244999999999997 27.195000000000004 21.935 45-49 23.67210163048915 27.588276482944885 26.89806942082625 21.84155246573972 50-54 22.856426960661487 28.6695063893761 27.29140566274117 21.182660987221247 55-59 22.741386217948715 28.03485576923077 26.822916666666668 22.400841346153847 60-64 23.24 27.500000000000004 27.810000000000002 21.45 65-69 23.395 26.735 27.815 22.055 70-74 23.485 27.515 27.065 21.935 75-79 23.36 27.505000000000003 27.435 21.7 80-84 23.369999999999997 28.470000000000002 26.87 21.29 85-89 24.015 27.639999999999997 26.735 21.61 90-94 23.189999999999998 28.000000000000004 27.07 21.740000000000002 95-99 23.165 27.775 27.29 21.77 100-104 24.08576294960425 27.236749824666866 27.116521390642216 21.560965835086666 105-109 23.15431202762901 27.608989438910857 27.573952650282795 21.662745883177337 110-114 23.515 27.16 27.71 21.615000000000002 115-119 23.94 27.250000000000004 27.265 21.545 120-124 23.73 27.02 27.465 21.785 125-129 24.22 27.99 27.02 20.77 130-134 24.07 27.36 27.400000000000002 21.17 135-139 23.74 27.58 27.250000000000004 21.43 140-144 24.37193474126714 27.519767791011912 27.16945250725653 20.93884496046442 145-149 23.961885656970914 27.53259779338014 27.031093279839517 21.474423269809428 150-151 24.44305381727159 26.83354192740926 27.284105131414265 21.43929912390488 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 2.5 22 2.0 23 0.5 24 1.5 25 1.0 26 0.0 27 2.5 28 5.5 29 10.5 30 13.0 31 9.5 32 14.0 33 26.5 34 40.0 35 46.0 36 61.0 37 91.0 38 128.5 39 146.0 40 165.0 41 206.0 42 241.5 43 275.0 44 282.5 45 275.5 46 263.5 47 248.0 48 246.5 49 230.0 50 190.0 51 167.5 52 138.5 53 100.0 54 86.0 55 74.0 56 57.0 57 42.0 58 27.0 59 18.0 60 12.5 61 13.0 62 13.0 63 7.0 64 4.5 65 2.5 66 1.0 67 1.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.15 3 0.25 4 0.2 5 0.25 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.03 50-54 0.22499999999999998 55-59 0.16 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.19 105-109 0.105 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.09 145-149 0.3 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.528834046839587 1.05 3 0.1007302946361118 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.07500000000000001 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.9625 0.0 0.0 0.0 0.0 128-129 1.1124999999999998 0.0 0.0 0.0 0.0 130-131 1.2125 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.6124999999999998 0.0 0.0 0.0 0.0 136-137 1.8 0.0 0.0 0.0 0.0 138-139 1.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGGAA 10 0.006830828 145.0 3 GGAGCAG 10 0.006830828 145.0 1 >>END_MODULE Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740555 spots for SRR7030811.sra Written 740555 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra Read 740553 spots for SRR7030811.sra Written 740553 spots for SRR7030811.sra SRR ids: ['SRR7030811.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vcpx367t SRR7030811.sra spots: 14811062 blocks: [[1, 740553], [740554, 1481106], [1481107, 2221659], [2221660, 2962212], [2962213, 3702765], [3702766, 4443318], [4443319, 5183871], [5183872, 5924424], [5924425, 6664977], [6664978, 7405530], [7405531, 8146083], [8146084, 8886636], [8886637, 9627189], [9627190, 10367742], [10367743, 11108295], [11108296, 11848848], [11848849, 12589401], [12589402, 13329954], [13329955, 14070507], [14070508, 14811062]] SRR7030811 file size 4997282 SRR7030811 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030811 SRR7030811_1.fastq SRR7030811_2.fastq Input file: SRR7030811_1.fastq Paired file: SRR7030811_2.fastq trimmed: SRR7030811-trimmed-pair1.fastq, SRR7030811-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:59:15 2025 >> started Wed Feb 12 18:59:32 2025 >> done (16.972s) 14811062 read pairs processed; of these: 50717 ( 0.34%) short read pairs filtered out after trimming by size control 40165 ( 0.27%) empty read pairs filtered out after trimming by size control 14720180 (99.39%) read pairs available; of these: 5711318 (38.80%) trimmed read pairs available after processing 9008862 (61.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 4 0.00% 22 2 0.00% 23 8 0.00% 24 3 0.00% 25 9 0.00% 26 8 0.00% 27 5 0.00% 28 4 0.00% 29 7 0.00% 30 6 0.00% 31 3 0.00% 32 6 0.00% 33 6 0.00% 34 7 0.00% 35 4 0.00% 36 8 0.00% 37 6 0.00% 38 2 0.00% 39 7 0.00% 40 6 0.00% 41 5 0.00% 42 9 0.00% 43 5 0.00% 44 12 0.00% 45 5 0.00% 46 5 0.00% 47 9 0.00% 48 16 0.00% 49 9 0.00% 50 11 0.00% 51 14 0.00% 52 19 0.00% 53 20 0.00% 54 31 0.00% 55 26 0.00% 56 28 0.00% 57 31 0.00% 58 31 0.00% 59 48 0.00% 60 50 0.00% 61 69 0.00% 62 63 0.00% 63 62 0.00% 64 76 0.00% 65 65 0.00% 66 102 0.00% 67 98 0.00% 68 121 0.00% 69 132 0.00% 70 139 0.00% 71 139 0.00% 72 173 0.00% 73 207 0.00% 74 220 0.00% 75 279 0.00% 76 348 0.00% 77 357 0.00% 78 384 0.00% 79 471 0.00% 80 506 0.00% 81 613 0.00% 82 764 0.01% 83 1006 0.01% 84 3351 0.02% 85 3863 0.03% 86 3491 0.02% 87 3450 0.02% 88 3419 0.02% 89 3332 0.02% 90 3441 0.02% 91 3464 0.02% 92 3541 0.02% 93 3720 0.03% 94 4034 0.03% 95 4346 0.03% 96 4708 0.03% 97 7158 0.05% 98 6845 0.05% 99 4758 0.03% 100 5114 0.03% 101 5288 0.04% 102 5789 0.04% 103 6090 0.04% 104 6513 0.04% 105 7013 0.05% 106 7359 0.05% 107 7983 0.05% 108 8289 0.06% 109 8899 0.06% 110 9375 0.06% 111 9832 0.07% 112 10542 0.07% 113 11306 0.08% 114 11915 0.08% 115 12856 0.09% 116 13920 0.09% 117 14384 0.10% 118 15391 0.10% 119 16099 0.11% 120 16992 0.12% 121 18186 0.12% 122 19531 0.13% 123 19785 0.13% 124 20318 0.14% 125 21610 0.15% 126 22646 0.15% 127 24317 0.17% 128 25506 0.17% 129 26703 0.18% 130 28639 0.19% 131 30192 0.21% 132 32496 0.22% 133 34858 0.24% 134 37273 0.25% 135 39274 0.27% 136 42791 0.29% 137 45819 0.31% 138 49806 0.34% 139 55305 0.38% 140 60534 0.41% 141 67011 0.46% 142 76711 0.52% 143 89965 0.61% 144 110880 0.75% 145 136063 0.92% 146 168971 1.15% 147 216407 1.47% 148 299706 2.04% 149 542190 3.68% 150 3063054 20.81% 151 9008862 61.20% 14720180 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.95 fanout-score-rank=17 prefix-density=0.35 prefix-fanout=4.1 sequence=TGAGCTTCACCG criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=270.99 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=27.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=36 prefix-density=0.73 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=58.17 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.6 sequence=AACTCTCTTGCAACCTGAAACAGGGAAACCAGTTAGTCGGGAACCAAAATCAAGGCTATGGCATCACTAGCAACCTTTGCTGCAGTGCAACCGGCCACCATCAAAGGCCTTGGTGGTAGCTCCCTCAGTGGAACCAAGCTCCATGTTAAACCATCACGCCAGGGCTTAAGACCCAAAAGCTTGAGGAGTGGTGCTGTGGTGGCCAAGTATGGTGACAAGAGTGTCTACTTTGATTTGGAGGATTTGGGCAACACTACTGGGCAATGGGACTTGTATGGATCTGATGCACCTTCACCATACAACCCTCTCCAGAGCAAATTCTTTGAGACATTTG SRR7030811 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:00:16 Started mapping on | Feb 12 19:00:16 Finished on | Feb 12 19:01:44 Mapping speed, Million of reads per hour | 602.19 Number of input reads | 14720180 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13903501 Uniquely mapped reads % | 94.45% Average mapped length | 296.61 Number of splices: Total | 14460397 Number of splices: Annotated (sjdb) | 14261202 Number of splices: GT/AG | 14206278 Number of splices: GC/AG | 213602 Number of splices: AT/AC | 9540 Number of splices: Non-canonical | 30977 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433964 % of reads mapped to multiple loci | 2.95% Number of reads mapped to too many loci | 190031 % of reads mapped to too many loci | 1.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.11% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 412895 412895 412895 N_multimapping 433964 433964 433964 N_noFeature 244332 13742236 314803 N_ambiguous 171227 604 80067 UnstrandedReadsAssigned:13487942 PositiveStrandReadsAssigned:160661 NegativeStrandReadsAssigned:13508631 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030811 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030811-trimmed-pair1.fastq SRR7030811-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,720,180 reads, 13,667,005 reads pseudoaligned [quant] estimated average fragment length: 256.826 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 947 rounds 52401 SRR7030811.ke.tsv 34699 SRR7030811.se.tsv 87100 total ==> SRR7030811.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.17 684 21.5342 Potri.005G024800.1.v4.1 1035 779.174 219 15.5931 Potri.004G059700.1.v4.1 961 705.228 12 0.944002 Potri.007G009000.2.v4.1 1416 1160.17 0 0 Potri.003G141000.2.v4.1 2943 2687.17 253 5.22331 Potri.016G087400.1.v4.1 270 67.75 859.88 704.125 Potri.015G069301.1.v4.1 564 312.979 0 0 Potri.010G195200.1.v4.1 1773 1517.17 0 0 Potri.012G127500.1.v4.1 977 721.216 4338 333.692 ==> SRR7030811.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7030811 completed mapping pipeline successfully