Starting /dee2/code/volunteer_pipeline.sh SRR7030812 current disk space = 3051000889344 free memory = 1541494160 SRR7030812 SRAfilesize 0f2e69e019731c7c3be4871739a198f5 SRR7030812.sra SRR7030812.sra file validated SRR7030812 is paired end SRR7030812 is conventional basespace SRR7030812 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030812_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.49525 18.0 18.0 30.0 18.0 33.0 2 30.84025 32.0 28.0 33.0 27.0 33.0 3 32.116 33.0 32.0 33.0 30.0 33.0 4 31.25075 33.0 31.0 33.0 29.0 33.0 5 32.4825 33.0 33.0 33.0 32.0 34.0 6 35.48825 37.0 35.0 38.0 31.0 38.0 7 36.8745 38.0 37.0 38.0 35.0 38.0 8 37.1915 38.0 38.0 38.0 36.0 38.0 9 37.472 38.0 38.0 38.0 37.0 38.0 10-14 37.45715 38.0 38.0 38.0 37.0 38.0 15-19 37.473 38.0 38.0 38.0 37.0 38.0 20-24 37.50745 38.0 38.0 38.0 37.4 38.0 25-29 37.4432 38.0 38.0 38.0 37.0 38.0 30-34 37.4116 38.0 38.0 38.0 37.0 38.0 35-39 37.3831 38.0 38.0 38.0 37.0 38.0 40-44 37.37285 38.0 38.0 38.0 37.0 38.0 45-49 37.32335 38.0 38.0 38.0 37.0 38.0 50-54 37.2741 38.0 38.0 38.0 37.0 38.0 55-59 37.26165 38.0 38.0 38.0 36.8 38.0 60-64 37.10565 38.0 38.0 38.0 36.0 38.0 65-69 37.031150000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.972449999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.97345 38.0 38.0 38.0 36.0 38.0 80-84 36.78345 38.0 38.0 38.0 35.2 38.0 85-89 36.8488 38.0 38.0 38.0 35.2 38.0 90-94 36.7681 38.0 38.0 38.0 35.0 38.0 95-99 36.45265 38.0 37.8 38.0 33.8 38.0 100-104 36.3773 38.0 38.0 38.0 34.0 38.0 105-109 36.199650000000005 38.0 37.4 38.0 33.4 38.0 110-114 36.24635 38.0 38.0 38.0 33.8 38.0 115-119 36.03895 38.0 37.0 38.0 33.0 38.0 120-124 35.9542 38.0 37.0 38.0 32.6 38.0 125-129 35.819449999999996 38.0 36.8 38.0 32.2 38.0 130-134 35.3903 38.0 36.0 38.0 30.6 38.0 135-139 35.08284999999999 38.0 35.8 38.0 28.4 38.0 140-144 34.851 38.0 35.0 38.0 28.0 38.0 145-149 34.3737 38.0 35.0 38.0 26.4 38.0 150-151 31.016624999999998 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 1.0 15 0.0 16 2.0 17 1.0 18 2.0 19 3.0 20 1.0 21 4.0 22 1.0 23 4.0 24 6.0 25 14.0 26 19.0 27 20.0 28 25.0 29 35.0 30 38.0 31 56.0 32 84.0 33 86.0 34 184.0 35 256.0 36 709.0 37 2445.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.35355648535565 10.120292887029288 19.586820083682007 42.93933054393305 2 24.175 12.825000000000001 33.75 29.25 3 21.475 15.475 25.15 37.9 4 22.35 24.425 23.525 29.7 5 22.775000000000002 29.599999999999998 26.025 21.6 6 20.349999999999998 34.275 24.3 21.075 7 14.825 25.674999999999997 40.075 19.425 8 18.025 26.8 30.825000000000003 24.349999999999998 9 17.625 24.675 34.525 23.175 10-14 20.015 29.755 26.965 23.265 15-19 20.345 27.79 27.639999999999997 24.224999999999998 20-24 20.3 28.33 27.439999999999998 23.93 25-29 20.3 27.245 27.950000000000003 24.505 30-34 19.905 27.495000000000005 28.294999999999998 24.305 35-39 20.14 28.105000000000004 27.35 24.404999999999998 40-44 19.85 27.875 28.09 24.185000000000002 45-49 20.015 27.74 28.13 24.115000000000002 50-54 20.48 28.125 27.405 23.990000000000002 55-59 19.935 28.155 27.35 24.560000000000002 60-64 21.035 27.744999999999997 27.48 23.74 65-69 20.54 27.985 27.18 24.295 70-74 20.555 28.435 27.034999999999997 23.974999999999998 75-79 20.419999999999998 27.76 27.625 24.195 80-84 20.625 27.935 27.705000000000002 23.735 85-89 20.630000000000003 27.529999999999998 28.084999999999997 23.755000000000003 90-94 21.3 27.775 27.095000000000002 23.830000000000002 95-99 20.830000000000002 27.985 27.644999999999996 23.54 100-104 21.27 27.68 27.205000000000002 23.845 105-109 21.105 27.51 27.525 23.86 110-114 20.515 27.755000000000003 27.839999999999996 23.89 115-119 21.33 27.575 27.575 23.52 120-124 20.810000000000002 27.889999999999997 27.0 24.3 125-129 20.62 27.57 27.57 24.240000000000002 130-134 21.095 27.26 27.445000000000004 24.2 135-139 21.425 27.400000000000002 27.084999999999997 24.09 140-144 21.525 27.675 26.965 23.835 145-149 21.37 27.279999999999998 27.71 23.64 150-151 21.625 26.8125 27.1125 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 1.5 25 2.5 26 4.0 27 5.0 28 8.5 29 14.0 30 20.5 31 23.0 32 29.0 33 40.0 34 40.0 35 53.5 36 71.0 37 89.0 38 118.5 39 137.5 40 173.5 41 205.5 42 233.5 43 256.0 44 243.5 45 240.0 46 260.0 47 262.0 48 249.5 49 229.0 50 201.5 51 175.0 52 137.5 53 112.0 54 92.0 55 65.5 56 43.5 57 41.0 58 35.0 59 19.5 60 16.0 61 12.5 62 11.0 63 8.5 64 3.5 65 2.5 66 2.5 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3999999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.6124999999999998 0.0 0.0 0.0 0.0 126-127 1.8875 0.0 0.0 0.0 0.0 128-129 2.15 0.0 0.0 0.0 0.0 130-131 2.4125 0.0 0.0 0.0 0.0 132-133 2.6875 0.0 0.0 0.0 0.0 134-135 3.15 0.0 0.0 0.0 0.0 136-137 3.6125 0.0 0.0 0.0 0.0 138-139 4.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030812 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030812_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.501 33.0 33.0 34.0 32.0 34.0 2 32.702 33.0 33.0 34.0 32.0 34.0 3 32.7855 33.0 33.0 34.0 32.0 34.0 4 32.718 33.0 33.0 34.0 32.0 34.0 5 32.7415 33.0 33.0 34.0 32.0 34.0 6 36.90925 38.0 38.0 38.0 35.0 38.0 7 37.0625 38.0 38.0 38.0 36.0 38.0 8 37.1 38.0 38.0 38.0 36.0 38.0 9 36.94025 38.0 38.0 38.0 36.0 38.0 10-14 37.04595 38.0 38.0 38.0 36.0 38.0 15-19 37.093849999999996 38.0 38.0 38.0 36.0 38.0 20-24 37.0649 38.0 38.0 38.0 36.0 38.0 25-29 36.89355 38.0 38.0 38.0 35.6 38.0 30-34 36.959649999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.879 38.0 38.0 38.0 35.8 38.0 40-44 36.7908 38.0 38.0 38.0 35.2 38.0 45-49 36.67755 38.0 38.0 38.0 34.8 38.0 50-54 36.66865 38.0 38.0 38.0 34.6 38.0 55-59 36.60955 38.0 38.0 38.0 34.4 38.0 60-64 36.64059999999999 38.0 38.0 38.0 34.4 38.0 65-69 36.41035 38.0 38.0 38.0 34.0 38.0 70-74 36.418600000000005 38.0 38.0 38.0 34.0 38.0 75-79 36.30650000000001 38.0 38.0 38.0 33.6 38.0 80-84 36.334199999999996 38.0 37.6 38.0 34.0 38.0 85-89 36.07405 38.0 37.2 38.0 32.6 38.0 90-94 35.96485 38.0 37.0 38.0 32.6 38.0 95-99 35.851099999999995 38.0 37.0 38.0 31.8 38.0 100-104 35.34015 38.0 36.2 38.0 29.2 38.0 105-109 35.38715 38.0 36.0 38.0 29.6 38.0 110-114 35.2602 38.0 36.2 38.0 28.8 38.0 115-119 34.82385000000001 38.0 35.6 38.0 27.0 38.0 120-124 34.6545 38.0 35.0 38.0 26.4 38.0 125-129 34.58815 38.0 35.0 38.0 26.6 38.0 130-134 34.0245 38.0 34.2 38.0 23.0 38.0 135-139 33.56895 38.0 34.0 38.0 20.2 38.0 140-144 33.03490000000001 38.0 33.6 38.0 17.0 38.0 145-149 32.17135 38.0 33.0 38.0 11.6 38.0 150-151 28.024124999999998 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 3.0 10 0.0 11 3.0 12 2.0 13 2.0 14 4.0 15 4.0 16 1.0 17 2.0 18 6.0 19 8.0 20 9.0 21 12.0 22 12.0 23 7.0 24 24.0 25 16.0 26 27.0 27 36.0 28 39.0 29 48.0 30 64.0 31 69.0 32 104.0 33 147.0 34 211.0 35 381.0 36 829.0 37 1924.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.02176632474356 21.56617463097323 17.588191143357516 31.823867900925695 2 27.265898848272407 24.937406109163746 28.943415122684023 18.85327991987982 3 20.36573146292585 28.106212424849698 30.68637274549098 20.841683366733466 4 23.38507761642464 33.14972458688032 23.685528292438658 19.779669504256383 5 24.925 35.275 22.825 16.975 6 20.68017004251063 36.384096024006 24.406101525381345 18.529632408102024 7 19.575 22.05 38.85 19.525000000000002 8 21.85 25.95 27.500000000000004 24.7 9 21.925 26.375 28.499999999999996 23.200000000000003 10-14 23.04 29.875 25.224999999999998 21.86 15-19 22.68 28.12 27.265 21.935 20-24 22.68 28.705000000000002 26.655 21.959999999999997 25-29 22.45 28.345 27.395000000000003 21.81 30-34 22.28 28.599999999999998 27.034999999999997 22.085 35-39 22.98 28.425 26.919999999999998 21.675 40-44 22.900000000000002 27.839999999999996 27.33 21.93 45-49 22.775000000000002 27.445000000000004 28.165000000000003 21.615000000000002 50-54 22.945 28.244999999999997 26.939999999999998 21.87 55-59 22.685 28.675 27.165 21.475 60-64 22.955000000000002 27.43 28.01 21.605 65-69 23.419999999999998 27.595 27.150000000000002 21.834999999999997 70-74 23.41 28.04 27.150000000000002 21.4 75-79 23.77 27.450000000000003 26.955000000000002 21.825 80-84 23.345 28.22 26.655 21.78 85-89 23.565 27.36 27.450000000000003 21.625 90-94 23.974999999999998 27.855 27.29 20.880000000000003 95-99 23.265 28.395 26.955000000000002 21.385 100-104 24.395 28.03 26.38 21.195 105-109 23.474999999999998 28.15 27.435 20.94 110-114 24.12 27.715 27.41 20.755000000000003 115-119 24.36 28.075 26.840000000000003 20.724999999999998 120-124 23.71 27.639999999999997 27.125 21.525 125-129 24.095 28.165000000000003 27.095000000000002 20.645 130-134 24.345 28.21 26.35 21.095 135-139 24.675 27.93 26.83 20.565 140-144 24.525 27.805000000000003 26.784999999999997 20.885 145-149 24.675 28.07 27.015 20.24 150-151 26.087500000000002 28.000000000000004 26.6125 19.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 1.0 25 1.5 26 1.0 27 2.5 28 6.0 29 7.5 30 7.5 31 12.5 32 22.0 33 29.0 34 40.0 35 57.0 36 76.0 37 87.5 38 119.5 39 154.0 40 180.0 41 217.5 42 248.0 43 277.0 44 280.5 45 274.5 46 273.0 47 265.5 48 250.5 49 214.5 50 182.5 51 147.0 52 114.5 53 99.0 54 83.5 55 66.5 56 51.0 57 45.0 58 31.5 59 18.5 60 15.0 61 9.5 62 7.5 63 7.5 64 4.5 65 3.0 66 1.5 67 0.5 68 0.5 69 1.0 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.15 3 0.2 4 0.15 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.6048387096774194 1.2 3 0.10080645161290322 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.5375 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.1125 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.525 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 2.05 0.0 0.0 0.0 0.0 130-131 2.3125 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 3.025 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 3.9749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917370 spots for SRR7030812.sra Written 917370 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra Read 917363 spots for SRR7030812.sra Written 917363 spots for SRR7030812.sra SRR ids: ['SRR7030812.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zw4u5t_2 SRR7030812.sra spots: 18347267 blocks: [[1, 917363], [917364, 1834726], [1834727, 2752089], [2752090, 3669452], [3669453, 4586815], [4586816, 5504178], [5504179, 6421541], [6421542, 7338904], [7338905, 8256267], [8256268, 9173630], [9173631, 10090993], [10090994, 11008356], [11008357, 11925719], [11925720, 12843082], [12843083, 13760445], [13760446, 14677808], [14677809, 15595171], [15595172, 16512534], [16512535, 17429897], [17429898, 18347267]] SRR7030812 file size 6195586 SRR7030812 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030812 SRR7030812_1.fastq SRR7030812_2.fastq Input file: SRR7030812_1.fastq Paired file: SRR7030812_2.fastq trimmed: SRR7030812-trimmed-pair1.fastq, SRR7030812-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:34:14 2025 >> started Wed Feb 12 19:34:36 2025 >> done (22.114s) 18347267 read pairs processed; of these: 10301 ( 0.06%) short read pairs filtered out after trimming by size control 11627 ( 0.06%) empty read pairs filtered out after trimming by size control 18325339 (99.88%) read pairs available; of these: 7436629 (40.58%) trimmed read pairs available after processing 10888710 (59.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 4 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 5 0.00% 25 3 0.00% 26 5 0.00% 27 2 0.00% 28 6 0.00% 29 3 0.00% 30 1 0.00% 31 3 0.00% 32 2 0.00% 33 4 0.00% 34 5 0.00% 35 2 0.00% 36 4 0.00% 37 6 0.00% 38 4 0.00% 39 4 0.00% 40 3 0.00% 41 4 0.00% 42 6 0.00% 43 10 0.00% 44 6 0.00% 45 11 0.00% 46 4 0.00% 47 4 0.00% 48 5 0.00% 49 8 0.00% 50 15 0.00% 51 11 0.00% 52 16 0.00% 53 9 0.00% 54 18 0.00% 55 17 0.00% 56 16 0.00% 57 25 0.00% 58 30 0.00% 59 29 0.00% 60 46 0.00% 61 40 0.00% 62 48 0.00% 63 77 0.00% 64 80 0.00% 65 72 0.00% 66 84 0.00% 67 94 0.00% 68 109 0.00% 69 130 0.00% 70 143 0.00% 71 160 0.00% 72 188 0.00% 73 203 0.00% 74 268 0.00% 75 286 0.00% 76 350 0.00% 77 380 0.00% 78 417 0.00% 79 503 0.00% 80 564 0.00% 81 627 0.00% 82 754 0.00% 83 926 0.01% 84 1511 0.01% 85 2001 0.01% 86 2193 0.01% 87 2364 0.01% 88 2623 0.01% 89 2814 0.02% 90 2923 0.02% 91 3105 0.02% 92 3369 0.02% 93 3674 0.02% 94 3958 0.02% 95 4388 0.02% 96 4777 0.03% 97 5183 0.03% 98 5511 0.03% 99 5765 0.03% 100 6265 0.03% 101 6965 0.04% 102 7388 0.04% 103 8211 0.04% 104 8778 0.05% 105 9520 0.05% 106 10327 0.06% 107 11073 0.06% 108 11617 0.06% 109 12612 0.07% 110 13483 0.07% 111 14301 0.08% 112 15557 0.08% 113 16499 0.09% 114 17812 0.10% 115 19322 0.11% 116 20849 0.11% 117 21794 0.12% 118 23385 0.13% 119 23978 0.13% 120 26013 0.14% 121 26884 0.15% 122 29050 0.16% 123 30417 0.17% 124 32470 0.18% 125 34142 0.19% 126 36703 0.20% 127 38966 0.21% 128 40833 0.22% 129 42501 0.23% 130 45041 0.25% 131 47200 0.26% 132 49843 0.27% 133 52843 0.29% 134 56480 0.31% 135 60461 0.33% 136 64997 0.35% 137 69943 0.38% 138 75232 0.41% 139 81086 0.44% 140 86364 0.47% 141 93067 0.51% 142 102843 0.56% 143 115496 0.63% 144 132968 0.73% 145 157399 0.86% 146 193759 1.06% 147 259945 1.42% 148 384804 2.10% 149 748253 4.08% 150 3877864 21.16% 151 10888710 59.42% 18325339 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.74 fanout-score-rank=20 prefix-density=0.34 prefix-fanout=3.2 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=373.06 fanout-score-rank=1 prefix-density=1.19 prefix-fanout=32.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=37 prefix-density=0.42 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=80.19 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.9 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR7030812 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:35:17 Started mapping on | Feb 12 19:35:18 Finished on | Feb 12 19:37:33 Mapping speed, Million of reads per hour | 488.68 Number of input reads | 18325339 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17463509 Uniquely mapped reads % | 95.30% Average mapped length | 296.24 Number of splices: Total | 17470674 Number of splices: Annotated (sjdb) | 17230633 Number of splices: GT/AG | 17168848 Number of splices: GC/AG | 248025 Number of splices: AT/AC | 13861 Number of splices: Non-canonical | 39940 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 592344 % of reads mapped to multiple loci | 3.23% Number of reads mapped to too many loci | 143478 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.58% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 281358 281358 281358 N_multimapping 592344 592344 592344 N_noFeature 251561 17293827 325038 N_ambiguous 191324 625 94686 UnstrandedReadsAssigned:17020624 PositiveStrandReadsAssigned:169057 NegativeStrandReadsAssigned:17043785 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030812 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030812-trimmed-pair1.fastq SRR7030812-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,325,339 reads, 17,226,630 reads pseudoaligned [quant] estimated average fragment length: 238.542 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52401 SRR7030812.ke.tsv 34699 SRR7030812.se.tsv 87100 total ==> SRR7030812.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.46 1043 25.3868 Potri.005G024800.1.v4.1 1035 797.458 335 18.205 Potri.004G059700.1.v4.1 961 723.473 20 1.19801 Potri.007G009000.2.v4.1 1416 1178.46 1 0.036774 Potri.003G141000.2.v4.1 2943 2705.46 380 6.08692 Potri.016G087400.1.v4.1 270 73.8806 1588.61 931.841 Potri.015G069301.1.v4.1 564 328.224 0 0 Potri.010G195200.1.v4.1 1773 1535.46 2 0.0564478 Potri.012G127500.1.v4.1 977 739.473 5395 316.172 ==> SRR7030812.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 23 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 352 Potri.001G212900.v4.1 34 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7030812 completed mapping pipeline successfully