Starting /dee2/code/volunteer_pipeline.sh SRR7030813 current disk space = 3051049263104 free memory = 1467790920 SRR7030813 SRAfilesize 3dc233082cda76572e6e860759c19655 SRR7030813.sra SRR7030813.sra file validated SRR7030813 is paired end SRR7030813 is conventional basespace SRR7030813 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030813_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.76075 34.0 33.0 34.0 32.0 34.0 2 33.03075 34.0 33.0 34.0 32.0 34.0 3 32.431 33.0 33.0 34.0 30.0 34.0 4 33.056 33.0 33.0 34.0 32.0 34.0 5 33.03725 33.0 33.0 34.0 32.0 34.0 6 36.3065 38.0 36.0 38.0 33.0 38.0 7 37.16375 38.0 38.0 38.0 36.0 38.0 8 37.22425 38.0 38.0 38.0 36.0 38.0 9 37.52575 38.0 38.0 38.0 37.0 38.0 10-14 37.58125 38.0 38.0 38.0 37.8 38.0 15-19 37.62485 38.0 38.0 38.0 38.0 38.0 20-24 37.62665 38.0 38.0 38.0 38.0 38.0 25-29 37.593650000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.522 38.0 38.0 38.0 38.0 38.0 35-39 37.4972 38.0 38.0 38.0 37.8 38.0 40-44 37.49195 38.0 38.0 38.0 37.4 38.0 45-49 37.4791 38.0 38.0 38.0 37.4 38.0 50-54 37.387800000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.38335000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.32855 38.0 38.0 38.0 37.0 38.0 65-69 37.227799999999995 38.0 38.0 38.0 36.6 38.0 70-74 37.1963 38.0 38.0 38.0 36.4 38.0 75-79 37.17305 38.0 38.0 38.0 36.0 38.0 80-84 37.0907 38.0 38.0 38.0 36.0 38.0 85-89 37.07084999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.99804999999999 38.0 38.0 38.0 35.8 38.0 95-99 36.94675 38.0 38.0 38.0 35.8 38.0 100-104 36.708749999999995 38.0 38.0 38.0 35.0 38.0 105-109 36.6683 38.0 38.0 38.0 34.8 38.0 110-114 36.56915 38.0 38.0 38.0 34.4 38.0 115-119 36.408550000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.2525 38.0 37.8 38.0 34.0 38.0 125-129 36.00945 38.0 37.2 38.0 33.2 38.0 130-134 35.90814999999999 38.0 37.0 38.0 32.8 38.0 135-139 35.68925 38.0 36.4 38.0 32.2 38.0 140-144 35.43149999999999 38.0 36.0 38.0 31.0 38.0 145-149 34.9299 38.0 35.6 38.0 29.4 38.0 150-151 31.801125 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 1.0 18 0.0 19 0.0 20 2.0 21 1.0 22 6.0 23 6.0 24 6.0 25 9.0 26 10.0 27 17.0 28 14.0 29 25.0 30 36.0 31 41.0 32 45.0 33 78.0 34 115.0 35 235.0 36 564.0 37 2785.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.19519205644107 12.098249281421479 10.974653775803501 37.73190488633394 2 21.875 14.625 34.2 29.299999999999997 3 19.125 18.675 26.150000000000002 36.05 4 22.900000000000002 26.1 24.625 26.375 5 21.525 31.65 26.775 20.05 6 19.625 35.55 24.575 20.25 7 14.924999999999999 26.974999999999998 39.925 18.175 8 17.7 27.975 31.2 23.125 9 18.2 24.075 32.550000000000004 25.174999999999997 10-14 19.259999999999998 30.085 27.155 23.5 15-19 19.89 28.470000000000002 27.865000000000002 23.775 20-24 20.36 28.655 27.63 23.355 25-29 19.580000000000002 28.970000000000002 27.694999999999997 23.755000000000003 30-34 20.23 28.65 27.295 23.825 35-39 20.04 28.994999999999997 27.229999999999997 23.735 40-44 20.169999999999998 29.195 27.51 23.125 45-49 20.305 28.17 27.46 24.065 50-54 20.05 28.26 27.900000000000002 23.79 55-59 20.06 28.22 27.800000000000004 23.919999999999998 60-64 19.545 28.360000000000003 27.250000000000004 24.845 65-69 20.424999999999997 28.01 27.665 23.9 70-74 20.445 28.494999999999997 27.255000000000003 23.805 75-79 20.330000000000002 27.834999999999997 28.03 23.805 80-84 20.345 27.79 28.095 23.77 85-89 20.405 28.62 27.215 23.76 90-94 20.200000000000003 28.27 27.095000000000002 24.435000000000002 95-99 20.985 28.255000000000003 27.08 23.68 100-104 20.375 28.499999999999996 27.195000000000004 23.93 105-109 20.724999999999998 27.72 27.275 24.279999999999998 110-114 20.65 28.494999999999997 27.529999999999998 23.325000000000003 115-119 21.3 27.46 27.79 23.45 120-124 20.705000000000002 28.225 27.18 23.89 125-129 21.055 27.87 27.48 23.595 130-134 21.335 27.439999999999998 27.66 23.565 135-139 21.035 28.549999999999997 26.945000000000004 23.47 140-144 21.13 27.63 26.729999999999997 24.51 145-149 21.075 27.865000000000002 26.779999999999998 24.279999999999998 150-151 20.15251906488311 27.82847855981998 27.665958244780597 24.353044130516317 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.5 25 4.0 26 4.5 27 6.5 28 10.0 29 13.5 30 21.5 31 25.5 32 31.5 33 45.5 34 56.0 35 69.5 36 90.0 37 105.5 38 121.0 39 143.0 40 161.5 41 194.5 42 239.5 43 267.0 44 277.0 45 267.0 46 253.5 47 247.0 48 229.5 49 219.0 50 185.5 51 150.5 52 139.5 53 106.5 54 81.0 55 62.5 56 43.0 57 34.0 58 28.5 59 19.5 60 10.0 61 5.5 62 5.5 63 5.5 64 1.5 65 2.0 66 3.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.324999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57264957264957 99.02499999999999 2 0.3770739064856712 0.75 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025138260432378077 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTCATTCACGGTGATGTTACGCCCATCAAGGTCTTGGCCGTTCATTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.2000000000000002 0.0 0.0 0.0 0.0 122-123 1.4375 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.875 0.0 0.0 0.0 0.0 128-129 2.075 0.0 0.0 0.0 0.0 130-131 2.3875 0.0 0.0 0.0 0.0 132-133 2.775 0.0 0.0 0.0 0.0 134-135 3.0125 0.0 0.0 0.0 0.0 136-137 3.325 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTTTT 10 0.0063298983 148.6923 1 TGTACGG 10 0.0068343505 144.975 7 CTTGAAA 25 8.7192556E-4 86.985 2 TCGGAAG 20 0.005940113 28.995 140-144 ATCGGAA 20 0.005940113 28.995 140-144 >>END_MODULE SRR7030813 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030813_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0305 33.0 33.0 34.0 32.0 34.0 2 33.169 34.0 33.0 34.0 33.0 34.0 3 33.17225 34.0 33.0 34.0 33.0 34.0 4 33.19775 34.0 33.0 34.0 33.0 34.0 5 33.1365 34.0 33.0 34.0 33.0 34.0 6 37.40825 38.0 38.0 38.0 37.0 38.0 7 37.474 38.0 38.0 38.0 38.0 38.0 8 37.4815 38.0 38.0 38.0 38.0 38.0 9 37.45075 38.0 38.0 38.0 37.0 38.0 10-14 37.400600000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.3786 38.0 38.0 38.0 37.0 38.0 20-24 37.443 38.0 38.0 38.0 37.8 38.0 25-29 37.393100000000004 38.0 38.0 38.0 37.4 38.0 30-34 37.393150000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.25675 38.0 38.0 38.0 37.0 38.0 40-44 37.20740000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.15755 38.0 38.0 38.0 36.6 38.0 50-54 37.17265 38.0 38.0 38.0 36.8 38.0 55-59 37.13495 38.0 38.0 38.0 36.8 38.0 60-64 37.14635 38.0 38.0 38.0 36.6 38.0 65-69 37.06665 38.0 38.0 38.0 36.2 38.0 70-74 37.0241 38.0 38.0 38.0 36.0 38.0 75-79 36.9414 38.0 38.0 38.0 36.0 38.0 80-84 36.90735 38.0 38.0 38.0 36.0 38.0 85-89 36.7618 38.0 38.0 38.0 35.6 38.0 90-94 36.68845 38.0 38.0 38.0 35.0 38.0 95-99 36.4963 38.0 38.0 38.0 34.2 38.0 100-104 36.33645 38.0 38.0 38.0 33.8 38.0 105-109 36.1399 38.0 37.8 38.0 33.6 38.0 110-114 36.1562 38.0 38.0 38.0 33.8 38.0 115-119 35.9057 38.0 37.4 38.0 32.8 38.0 120-124 35.73595 38.0 37.0 38.0 32.4 38.0 125-129 35.547250000000005 38.0 36.2 38.0 31.2 38.0 130-134 35.085950000000004 38.0 35.8 38.0 29.2 38.0 135-139 34.98675 38.0 35.8 38.0 28.6 38.0 140-144 34.58935 38.0 34.8 38.0 27.6 38.0 145-149 33.91895 38.0 34.6 38.0 23.2 38.0 150-151 30.36675 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 3.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 2.0 12 1.0 13 2.0 14 0.0 15 2.0 16 4.0 17 4.0 18 4.0 19 2.0 20 10.0 21 8.0 22 5.0 23 4.0 24 12.0 25 16.0 26 19.0 27 15.0 28 25.0 29 23.0 30 33.0 31 42.0 32 54.0 33 88.0 34 126.0 35 234.0 36 651.0 37 2607.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.30072554415812 22.241681260945708 15.111333500125093 28.34625969477108 2 27.445584188141105 26.99524643482612 27.77082812109082 17.788341255941955 3 20.95118898623279 29.411764705882355 29.912390488110134 19.72465581977472 4 23.117338003502628 32.57443082311734 24.293219914936202 20.01501125844383 5 24.468351263447584 35.226419814861146 22.416812609457093 17.888416312234177 6 21.224999999999998 37.85 22.225 18.7 7 19.825 23.7 36.449999999999996 20.025000000000002 8 23.1 25.224999999999998 26.924999999999997 24.75 9 22.475 25.7 28.225 23.599999999999998 10-14 22.7 29.43 26.245 21.625 15-19 23.400000000000002 28.37 26.85 21.38 20-24 23.18 28.599999999999998 27.175 21.044999999999998 25-29 22.71 28.43 27.465 21.395 30-34 22.645 28.395 28.055000000000003 20.905 35-39 23.66 28.384999999999998 27.060000000000002 20.895 40-44 23.56 28.42 26.845000000000002 21.175 45-49 23.26 28.360000000000003 27.465 20.915 50-54 22.82 27.76 28.13 21.29 55-59 23.785 28.01 27.310000000000002 20.895 60-64 23.294999999999998 27.55 27.77 21.385 65-69 23.285 27.575 27.889999999999997 21.25 70-74 23.93 27.315 27.689999999999998 21.065 75-79 23.549999999999997 27.48 27.755000000000003 21.215 80-84 23.54 27.52 27.779999999999998 21.16 85-89 23.505000000000003 27.96 27.865000000000002 20.669999999999998 90-94 23.330000000000002 27.810000000000002 27.725 21.135 95-99 23.595 27.605 27.565 21.235 100-104 23.71 27.43 27.85 21.01 105-109 23.73 27.61 27.395000000000003 21.265 110-114 24.060000000000002 27.889999999999997 27.465 20.585 115-119 23.93 27.779999999999998 27.500000000000004 20.79 120-124 23.95 27.395000000000003 28.09 20.565 125-129 24.215 27.845 27.395000000000003 20.544999999999998 130-134 24.895 27.455000000000002 27.355 20.294999999999998 135-139 24.67 27.52 27.195000000000004 20.615 140-144 24.5 28.389999999999997 27.12 19.99 145-149 24.945 27.79 27.12 20.145 150-151 25.074999999999996 26.9625 27.500000000000004 20.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.0 25 0.0 26 0.5 27 0.5 28 2.5 29 8.5 30 13.5 31 20.0 32 23.5 33 32.5 34 44.5 35 59.0 36 83.0 37 104.5 38 120.5 39 142.5 40 176.0 41 211.5 42 256.0 43 283.0 44 280.5 45 275.5 46 271.5 47 265.0 48 246.0 49 219.5 50 194.5 51 159.0 52 120.0 53 92.0 54 65.0 55 48.0 56 45.5 57 35.5 58 21.5 59 19.5 60 21.0 61 13.0 62 6.5 63 4.5 64 2.0 65 2.0 66 2.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.125 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0750000000000002 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.4375 0.0 0.0 0.0 0.0 124-125 1.7374999999999998 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.125 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.8375000000000004 0.0 0.0 0.0 0.0 134-135 3.0875 0.0 0.0 0.0 0.0 136-137 3.4 0.0 0.0 0.0 0.0 138-139 3.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAAAC 10 0.006830828 145.0 8 AAATGGT 10 0.006830828 145.0 9 CAAAACC 10 0.006830828 145.0 9 TCGGAAG 20 0.00593511 29.0 140-144 ATCGGAA 20 0.00593511 29.0 140-144 >>END_MODULE Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725307 spots for SRR7030813.sra Written 725307 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra Read 725303 spots for SRR7030813.sra Written 725303 spots for SRR7030813.sra SRR ids: ['SRR7030813.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d1p8dg21 SRR7030813.sra spots: 14506064 blocks: [[1, 725303], [725304, 1450606], [1450607, 2175909], [2175910, 2901212], [2901213, 3626515], [3626516, 4351818], [4351819, 5077121], [5077122, 5802424], [5802425, 6527727], [6527728, 7253030], [7253031, 7978333], [7978334, 8703636], [8703637, 9428939], [9428940, 10154242], [10154243, 10879545], [10879546, 11604848], [11604849, 12330151], [12330152, 13055454], [13055455, 13780757], [13780758, 14506064]] SRR7030813 file size 4893928 SRR7030813 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030813 SRR7030813_1.fastq SRR7030813_2.fastq Input file: SRR7030813_1.fastq Paired file: SRR7030813_2.fastq trimmed: SRR7030813-trimmed-pair1.fastq, SRR7030813-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:29:28 2025 >> started Wed Feb 12 19:29:46 2025 >> done (18.515s) 14506064 read pairs processed; of these: 12825 ( 0.09%) short read pairs filtered out after trimming by size control 11303 ( 0.08%) empty read pairs filtered out after trimming by size control 14481936 (99.83%) read pairs available; of these: 5376122 (37.12%) trimmed read pairs available after processing 9105814 (62.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 6 0.00% 23 4 0.00% 24 4 0.00% 25 2 0.00% 26 4 0.00% 27 6 0.00% 28 1 0.00% 29 1 0.00% 30 4 0.00% 31 5 0.00% 32 2 0.00% 33 4 0.00% 34 3 0.00% 35 2 0.00% 36 1 0.00% 37 4 0.00% 38 2 0.00% 39 2 0.00% 40 5 0.00% 41 3 0.00% 42 4 0.00% 43 4 0.00% 44 3 0.00% 45 4 0.00% 46 9 0.00% 47 7 0.00% 48 3 0.00% 49 11 0.00% 50 6 0.00% 51 13 0.00% 52 10 0.00% 53 17 0.00% 54 19 0.00% 55 14 0.00% 56 20 0.00% 57 21 0.00% 58 20 0.00% 59 28 0.00% 60 30 0.00% 61 33 0.00% 62 52 0.00% 63 54 0.00% 64 69 0.00% 65 48 0.00% 66 72 0.00% 67 79 0.00% 68 86 0.00% 69 107 0.00% 70 123 0.00% 71 141 0.00% 72 155 0.00% 73 171 0.00% 74 166 0.00% 75 221 0.00% 76 294 0.00% 77 338 0.00% 78 335 0.00% 79 360 0.00% 80 493 0.00% 81 520 0.00% 82 591 0.00% 83 705 0.00% 84 1418 0.01% 85 1849 0.01% 86 1969 0.01% 87 2037 0.01% 88 2280 0.02% 89 2422 0.02% 90 2470 0.02% 91 2778 0.02% 92 2979 0.02% 93 3018 0.02% 94 3254 0.02% 95 3495 0.02% 96 3795 0.03% 97 4142 0.03% 98 4239 0.03% 99 4577 0.03% 100 5129 0.04% 101 5350 0.04% 102 5972 0.04% 103 6452 0.04% 104 6919 0.05% 105 7691 0.05% 106 7999 0.06% 107 8602 0.06% 108 9013 0.06% 109 9628 0.07% 110 10571 0.07% 111 11105 0.08% 112 12179 0.08% 113 13110 0.09% 114 14031 0.10% 115 15350 0.11% 116 16414 0.11% 117 17080 0.12% 118 17953 0.12% 119 18574 0.13% 120 19578 0.14% 121 20721 0.14% 122 21963 0.15% 123 23398 0.16% 124 24697 0.17% 125 25999 0.18% 126 27554 0.19% 127 29064 0.20% 128 30288 0.21% 129 31877 0.22% 130 33341 0.23% 131 34843 0.24% 132 36875 0.25% 133 39553 0.27% 134 41769 0.29% 135 44239 0.31% 136 47514 0.33% 137 50633 0.35% 138 54714 0.38% 139 57871 0.40% 140 60528 0.42% 141 65287 0.45% 142 70669 0.49% 143 79023 0.55% 144 90670 0.63% 145 107195 0.74% 146 130497 0.90% 147 171137 1.18% 148 256405 1.77% 149 490305 3.39% 150 2886546 19.93% 151 9105814 62.88% 14481936 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=29 prefix-density=0.37 prefix-fanout=2.4 sequence=GTGGACTCCTTCTGGATGTTGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=121.37 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.8 sequence=AAAAAAAAAGACGCACAATTATGAAGAAAGAAAGAAGAATAAATATTCCAAGTATTGATCGATGTACACCAACAAGGGACTTTTCATTGAATCAAACGGTTATGTGCCTCTCCACAACAGATAAGATCAGGATCTTCACTTGGTGATGGCGTAGATAGCATAAATAATTCCAGGGAGGTAGCCAAAGAAGGTGAGAAGCAAGCAGATCCAAAACTCCACCCCGCAGCC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=37 prefix-density=0.38 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=32 fanout-score=152.49 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=23.2 sequence=CAAAGAAGAAAAACAGTTTCTCAAGAGCAGTATATATAGATCTTTCAGAAGAATTAAGGAGATGGCAGACGAGGGAACAGCTACTTGCATAGACATCTTGTTGGCCATCATCTTGCCTCCGCTTGGTGTCTTCCTCAAGTT SRR7030813 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:30:34 Started mapping on | Feb 12 19:30:35 Finished on | Feb 12 19:31:51 Mapping speed, Million of reads per hour | 685.99 Number of input reads | 14481936 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13860313 Uniquely mapped reads % | 95.71% Average mapped length | 296.51 Number of splices: Total | 12060939 Number of splices: Annotated (sjdb) | 11871981 Number of splices: GT/AG | 11859621 Number of splices: GC/AG | 157537 Number of splices: AT/AC | 9672 Number of splices: Non-canonical | 34109 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 440699 % of reads mapped to multiple loci | 3.04% Number of reads mapped to too many loci | 43193 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 194156 194156 194156 N_multimapping 440699 440699 440699 N_noFeature 195637 13714994 258845 N_ambiguous 143460 685 60986 UnstrandedReadsAssigned:13521216 PositiveStrandReadsAssigned:144634 NegativeStrandReadsAssigned:13540482 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030813 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030813-trimmed-pair1.fastq SRR7030813-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,481,936 reads, 13,588,758 reads pseudoaligned [quant] estimated average fragment length: 232.978 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR7030813.ke.tsv 34699 SRR7030813.se.tsv 87100 total ==> SRR7030813.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.02 1245 34.4202 Potri.005G024800.1.v4.1 1035 803.022 1046 64.3185 Potri.004G059700.1.v4.1 961 729.022 18 1.21917 Potri.007G009000.2.v4.1 1416 1184.02 0 0 Potri.003G141000.2.v4.1 2943 2711.02 507 9.23435 Potri.016G087400.1.v4.1 270 74.3664 1140 756.937 Potri.015G069301.1.v4.1 564 333.364 0 0 Potri.010G195200.1.v4.1 1773 1541.02 77 2.46725 Potri.012G127500.1.v4.1 977 745.022 18914 1253.56 ==> SRR7030813.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 43 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 290 Potri.001G212900.v4.1 76 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7030813 completed mapping pipeline successfully