Starting /dee2/code/volunteer_pipeline.sh SRR7030814 current disk space = 3050928033792 free memory = 1581836372 SRR7030814 SRAfilesize ac3fe18f928bc5498cf37b89950db346 SRR7030814.sra SRR7030814.sra file validated SRR7030814 is paired end SRR7030814 is conventional basespace SRR7030814 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030814_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6075 33.0 32.0 33.0 25.0 34.0 2 32.50825 33.0 33.0 34.0 30.0 34.0 3 31.74875 33.0 32.0 33.0 28.0 34.0 4 31.6485 33.0 31.0 33.0 29.0 34.0 5 32.5615 33.0 33.0 33.0 32.0 34.0 6 36.69525 38.0 37.0 38.0 34.0 38.0 7 37.07375 38.0 38.0 38.0 36.0 38.0 8 37.1295 38.0 38.0 38.0 36.0 38.0 9 37.3675 38.0 38.0 38.0 37.0 38.0 10-14 37.46265 38.0 38.0 38.0 37.0 38.0 15-19 37.491550000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.4157 38.0 38.0 38.0 37.0 38.0 25-29 37.39005 38.0 38.0 38.0 37.0 38.0 30-34 37.33685 38.0 38.0 38.0 37.0 38.0 35-39 37.34135 38.0 38.0 38.0 37.0 38.0 40-44 37.2704 38.0 38.0 38.0 36.8 38.0 45-49 37.2718 38.0 38.0 38.0 36.8 38.0 50-54 37.24145 38.0 38.0 38.0 36.6 38.0 55-59 37.1017 38.0 38.0 38.0 36.0 38.0 60-64 36.983149999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.95094999999999 38.0 38.0 38.0 35.8 38.0 70-74 36.891 38.0 38.0 38.0 35.4 38.0 75-79 36.835449999999994 38.0 38.0 38.0 35.0 38.0 80-84 36.64665 38.0 38.0 38.0 34.2 38.0 85-89 36.727999999999994 38.0 38.0 38.0 34.8 38.0 90-94 36.626 38.0 38.0 38.0 34.4 38.0 95-99 36.21995 38.0 37.6 38.0 33.2 38.0 100-104 36.214999999999996 38.0 37.2 38.0 33.4 38.0 105-109 35.91645 38.0 37.0 38.0 31.8 38.0 110-114 36.023 38.0 37.0 38.0 32.6 38.0 115-119 35.916000000000004 38.0 37.0 38.0 32.6 38.0 120-124 35.876799999999996 38.0 37.0 38.0 32.2 38.0 125-129 35.7245 38.0 36.6 38.0 31.8 38.0 130-134 35.254949999999994 38.0 36.0 38.0 29.6 38.0 135-139 34.969199999999994 38.0 35.6 38.0 28.0 38.0 140-144 34.7196 38.0 35.0 38.0 27.6 38.0 145-149 34.1496 38.0 35.0 38.0 25.4 38.0 150-151 30.735875 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 3.0 15 1.0 16 0.0 17 1.0 18 3.0 19 5.0 20 2.0 21 3.0 22 4.0 23 7.0 24 7.0 25 16.0 26 11.0 27 25.0 28 20.0 29 35.0 30 56.0 31 55.0 32 79.0 33 106.0 34 176.0 35 299.0 36 683.0 37 2401.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.89153785695572 11.605973277443018 8.67173172648677 37.83075713911449 2 20.95 15.15 35.85 28.050000000000004 3 19.7 19.975 29.125 31.2 4 21.875 26.075 24.425 27.625 5 21.025 30.8 26.875 21.3 6 20.65 35.3 24.175 19.875 7 15.024999999999999 25.7 40.35 18.925 8 16.950000000000003 26.424999999999997 31.6 25.025 9 18.275 25.3 33.025 23.400000000000002 10-14 19.805 29.98 26.465 23.75 15-19 20.405 28.325 27.12 24.15 20-24 19.2 28.7 27.639999999999997 24.46 25-29 19.580000000000002 29.04 27.169999999999998 24.21 30-34 19.935 28.52 27.565 23.98 35-39 19.555 28.175 27.860000000000003 24.41 40-44 19.689999999999998 28.095 27.99 24.224999999999998 45-49 19.950000000000003 28.275 27.41 24.365000000000002 50-54 20.34 27.97 27.235 24.455 55-59 20.025000000000002 28.235 27.565 24.175 60-64 20.419999999999998 28.04 26.974999999999998 24.565 65-69 19.695 27.939999999999998 27.825 24.54 70-74 19.8 28.985 27.275 23.94 75-79 19.74 28.37 27.395000000000003 24.495 80-84 20.52 28.12 27.455000000000002 23.905 85-89 20.315 28.060000000000002 27.79 23.835 90-94 20.200000000000003 28.95 26.665 24.185000000000002 95-99 20.265 27.905 27.439999999999998 24.39 100-104 20.325 28.215 27.72 23.74 105-109 20.97 28.34 26.995 23.695 110-114 20.135 28.12 27.865000000000002 23.880000000000003 115-119 21.01 27.694999999999997 27.27 24.025 120-124 20.435 28.065 27.060000000000002 24.44 125-129 20.57 28.144999999999996 27.42 23.865 130-134 20.34 28.115000000000002 27.755000000000003 23.79 135-139 20.73 27.54 27.43 24.3 140-144 20.69 27.589999999999996 27.62 24.099999999999998 145-149 20.78 28.465 27.005000000000003 23.75 150-151 20.1625 28.349999999999998 25.85 25.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 2.5 25 2.5 26 5.0 27 6.5 28 8.5 29 13.5 30 18.0 31 20.5 32 22.0 33 33.5 34 43.5 35 61.0 36 82.5 37 103.5 38 126.5 39 161.5 40 186.0 41 208.5 42 225.0 43 253.5 44 270.5 45 261.0 46 277.0 47 271.5 48 239.0 49 210.5 50 187.5 51 140.5 52 120.5 53 112.5 54 73.0 55 53.0 56 49.0 57 35.0 58 29.5 59 25.5 60 15.0 61 10.5 62 8.0 63 5.5 64 3.5 65 2.5 66 1.5 67 1.5 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.3250000000000002 0.0 0.0 0.0 0.0 128-129 1.525 0.0 0.0 0.0 0.0 130-131 1.7625 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.3375 0.0 0.0 0.0 0.0 136-137 2.7125 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGCCC 10 0.0068396386 144.9375 145 >>END_MODULE SRR7030814 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030814_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.41925 33.0 33.0 34.0 32.0 34.0 2 32.57275 33.0 33.0 34.0 31.0 34.0 3 32.693 33.0 33.0 34.0 32.0 34.0 4 32.61325 33.0 33.0 34.0 32.0 34.0 5 32.62475 33.0 33.0 34.0 32.0 34.0 6 36.81425 38.0 38.0 38.0 35.0 38.0 7 36.8405 38.0 38.0 38.0 36.0 38.0 8 36.8605 38.0 38.0 38.0 36.0 38.0 9 36.812 38.0 38.0 38.0 36.0 38.0 10-14 36.89285 38.0 38.0 38.0 35.8 38.0 15-19 36.95075 38.0 38.0 38.0 36.0 38.0 20-24 36.90585 38.0 38.0 38.0 36.0 38.0 25-29 36.699149999999996 38.0 38.0 38.0 35.0 38.0 30-34 36.79235 38.0 38.0 38.0 35.4 38.0 35-39 36.621399999999994 38.0 38.0 38.0 34.8 38.0 40-44 36.49935 38.0 38.0 38.0 34.2 38.0 45-49 36.40605 38.0 38.0 38.0 33.8 38.0 50-54 36.37885 38.0 38.0 38.0 34.0 38.0 55-59 36.33579999999999 38.0 37.8 38.0 33.6 38.0 60-64 36.3761 38.0 38.0 38.0 34.0 38.0 65-69 36.14475 38.0 37.4 38.0 33.0 38.0 70-74 36.12245 38.0 37.0 38.0 33.0 38.0 75-79 36.00575 38.0 37.0 38.0 32.8 38.0 80-84 36.013149999999996 38.0 37.0 38.0 33.0 38.0 85-89 35.7088 38.0 37.0 38.0 30.8 38.0 90-94 35.64205 38.0 37.0 38.0 30.2 38.0 95-99 35.393600000000006 38.0 36.2 38.0 29.0 38.0 100-104 34.84095 38.0 35.6 38.0 26.4 38.0 105-109 34.867399999999996 38.0 35.4 38.0 27.0 38.0 110-114 34.8401 38.0 35.6 38.0 27.2 38.0 115-119 34.4388 38.0 35.0 38.0 25.0 38.0 120-124 34.215700000000005 38.0 34.6 38.0 23.8 38.0 125-129 34.06994999999999 38.0 34.4 38.0 23.0 38.0 130-134 33.2921 38.0 34.0 38.0 16.2 38.0 135-139 32.903949999999995 38.0 33.4 38.0 16.2 38.0 140-144 32.4101 37.8 33.2 38.0 14.2 38.0 145-149 31.379700000000003 36.4 32.0 38.0 8.8 38.0 150-151 27.330875 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 0.0 5 2.0 6 2.0 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 5.0 13 0.0 14 1.0 15 2.0 16 5.0 17 6.0 18 7.0 19 13.0 20 9.0 21 7.0 22 10.0 23 19.0 24 27.0 25 23.0 26 32.0 27 46.0 28 42.0 29 52.0 30 65.0 31 89.0 32 129.0 33 153.0 34 267.0 35 400.0 36 885.0 37 1686.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.752564423317494 22.266700025018764 12.984738553915436 27.995996997748314 2 27.033792240300375 26.608260325406757 29.28660826032541 17.07133917396746 3 19.774718397997496 28.911138923654566 31.614518147684606 19.69962453066333 4 23.30413016270338 35.36921151439299 23.454317897371716 17.872340425531917 5 24.031007751937985 36.78419604901225 22.05551387846962 17.129282320580145 6 20.815611708781585 39.229422066549915 21.691268451338505 18.263697773329998 7 20.625 22.2 38.1 19.075 8 21.6 26.0 27.35 25.05 9 22.625 25.5 28.999999999999996 22.875 10-14 23.115 29.354999999999997 26.13 21.4 15-19 22.7 28.904999999999998 27.3 21.095 20-24 22.785 28.63 27.29 21.295 25-29 23.575 28.18 27.195000000000004 21.05 30-34 23.01 28.215 27.639999999999997 21.135 35-39 22.74 27.889999999999997 28.17 21.2 40-44 23.3 28.095 27.79 20.815 45-49 23.150000000000002 27.655 27.625 21.57 50-54 23.48 27.55 28.265 20.705000000000002 55-59 23.23 28.65 27.339999999999996 20.78 60-64 23.525 28.115000000000002 27.57 20.79 65-69 24.245 27.375 27.189999999999998 21.19 70-74 23.565 27.74 27.755000000000003 20.94 75-79 23.49 27.915 27.944999999999997 20.65 80-84 23.515 28.425 27.43 20.630000000000003 85-89 23.555 27.54 27.62 21.285 90-94 23.95 27.425 28.035 20.59 95-99 24.01 27.71 27.49 20.79 100-104 23.685000000000002 28.105000000000004 27.845 20.365 105-109 24.09 28.005000000000003 27.47 20.435 110-114 24.095 27.99 27.435 20.48 115-119 24.095 28.16 27.22 20.525 120-124 24.18 28.255000000000003 27.045 20.52 125-129 24.26 27.894999999999996 27.589999999999996 20.255000000000003 130-134 25.055 27.500000000000004 27.384999999999998 20.06 135-139 24.635 27.700000000000003 27.700000000000003 19.965 140-144 24.83 27.875 27.425 19.869999999999997 145-149 24.759999999999998 27.725 26.634999999999998 20.880000000000003 150-151 24.762500000000003 27.487499999999997 27.4125 20.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 0.5 24 2.5 25 4.5 26 3.0 27 2.5 28 6.0 29 8.5 30 14.0 31 23.0 32 27.5 33 34.5 34 51.0 35 57.0 36 68.5 37 89.5 38 127.0 39 171.0 40 197.5 41 217.5 42 245.5 43 277.0 44 275.0 45 275.5 46 284.5 47 265.5 48 242.5 49 214.0 50 168.0 51 135.5 52 115.0 53 93.5 54 68.0 55 46.0 56 39.0 57 34.5 58 25.0 59 19.5 60 14.5 61 14.0 62 16.0 63 12.0 64 7.0 65 2.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.125 3 0.125 4 0.125 5 0.025 6 0.075 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09044972208186 98.05 2 0.7579585649317837 1.5 3 0.15159171298635674 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7125 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.1124999999999998 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.7375 0.0 0.0 0.0 0.0 132-133 2.05 0.0 0.0 0.0 0.0 134-135 2.325 0.0 0.0 0.0 0.0 136-137 2.7 0.0 0.0 0.0 0.0 138-139 2.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGACAAT 10 0.006830828 145.0 1 GACATGA 10 0.006830828 145.0 9 >>END_MODULE Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041516 spots for SRR7030814.sra Written 1041516 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra Read 1041512 spots for SRR7030814.sra Written 1041512 spots for SRR7030814.sra SRR ids: ['SRR7030814.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6pg4fx61 SRR7030814.sra spots: 20830244 blocks: [[1, 1041512], [1041513, 2083024], [2083025, 3124536], [3124537, 4166048], [4166049, 5207560], [5207561, 6249072], [6249073, 7290584], [7290585, 8332096], [8332097, 9373608], [9373609, 10415120], [10415121, 11456632], [11456633, 12498144], [12498145, 13539656], [13539657, 14581168], [14581169, 15622680], [15622681, 16664192], [16664193, 17705704], [17705705, 18747216], [18747217, 19788728], [19788729, 20830244]] SRR7030814 file size 7036985 SRR7030814 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030814 SRR7030814_1.fastq SRR7030814_2.fastq Input file: SRR7030814_1.fastq Paired file: SRR7030814_2.fastq trimmed: SRR7030814-trimmed-pair1.fastq, SRR7030814-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:00:48 2025 >> started Wed Feb 12 20:01:23 2025 >> done (34.897s) 20830244 read pairs processed; of these: 18244 ( 0.09%) short read pairs filtered out after trimming by size control 16644 ( 0.08%) empty read pairs filtered out after trimming by size control 20795356 (99.83%) read pairs available; of these: 8511978 (40.93%) trimmed read pairs available after processing 12283378 (59.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 2 0.00% 20 4 0.00% 21 5 0.00% 22 3 0.00% 23 3 0.00% 24 8 0.00% 25 7 0.00% 26 2 0.00% 27 4 0.00% 28 3 0.00% 29 6 0.00% 30 7 0.00% 31 8 0.00% 32 4 0.00% 33 3 0.00% 34 8 0.00% 35 4 0.00% 36 7 0.00% 37 4 0.00% 38 8 0.00% 39 5 0.00% 40 6 0.00% 41 10 0.00% 42 9 0.00% 43 10 0.00% 44 7 0.00% 45 16 0.00% 46 9 0.00% 47 12 0.00% 48 14 0.00% 49 17 0.00% 50 22 0.00% 51 15 0.00% 52 24 0.00% 53 19 0.00% 54 32 0.00% 55 29 0.00% 56 51 0.00% 57 45 0.00% 58 54 0.00% 59 64 0.00% 60 62 0.00% 61 79 0.00% 62 77 0.00% 63 97 0.00% 64 92 0.00% 65 106 0.00% 66 124 0.00% 67 135 0.00% 68 159 0.00% 69 143 0.00% 70 182 0.00% 71 244 0.00% 72 284 0.00% 73 314 0.00% 74 380 0.00% 75 361 0.00% 76 443 0.00% 77 501 0.00% 78 539 0.00% 79 648 0.00% 80 729 0.00% 81 847 0.00% 82 921 0.00% 83 1189 0.01% 84 2043 0.01% 85 2767 0.01% 86 2836 0.01% 87 3120 0.02% 88 3229 0.02% 89 3439 0.02% 90 3619 0.02% 91 3896 0.02% 92 4128 0.02% 93 4456 0.02% 94 4873 0.02% 95 5080 0.02% 96 5528 0.03% 97 5719 0.03% 98 6086 0.03% 99 6278 0.03% 100 6942 0.03% 101 7367 0.04% 102 8184 0.04% 103 8785 0.04% 104 9471 0.05% 105 10352 0.05% 106 10830 0.05% 107 11288 0.05% 108 12092 0.06% 109 12663 0.06% 110 13580 0.07% 111 14682 0.07% 112 15585 0.07% 113 16784 0.08% 114 18054 0.09% 115 19441 0.09% 116 20752 0.10% 117 21660 0.10% 118 22731 0.11% 119 23675 0.11% 120 24756 0.12% 121 26619 0.13% 122 28082 0.14% 123 30176 0.15% 124 31916 0.15% 125 33864 0.16% 126 35860 0.17% 127 38109 0.18% 128 39829 0.19% 129 41779 0.20% 130 44644 0.21% 131 46881 0.23% 132 50328 0.24% 133 53787 0.26% 134 57562 0.28% 135 62411 0.30% 136 66990 0.32% 137 71737 0.34% 138 78095 0.38% 139 85174 0.41% 140 91322 0.44% 141 99298 0.48% 142 111138 0.53% 143 126355 0.61% 144 148954 0.72% 145 178729 0.86% 146 225060 1.08% 147 308917 1.49% 148 465775 2.24% 149 911434 4.38% 150 4535148 21.81% 151 12283378 59.07% 20795356 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=41 prefix-density=0.34 prefix-fanout=2.0 sequence=ACTGATTCCTTTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=141.67 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=12.6 sequence=AAACAAGAATTTTATTGTTTCCTGTCACACCAAGGCAAACCAAACCAGTCTTCTTTTATGCACCCATACGGATAATACACCTCAGGCCAGCTCCACTAAGCATGTACTCGAAAGCCTTGTTGATTTCTGAGAAAGGGACTTCATGGGTGATGAATTTCTCTAGCTCCAGCTCCTTGTTCATGTACTTCTCGACAACTGAAGGAAGGTCGGAGCGCGGTTTGTAGTT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=33 prefix-density=0.31 prefix-fanout=2.0 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=223.38 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=24.1 sequence=CAAAGAAGAAAAACAGTTTCTCAAGAGCAGTATATATAGATCTTTCAGAAGAATTAAGGAGATGGCAGACGAGGGAACAGCTACTTGCATAGACATCTTGTTGGCCATCATCTTGCCTCCGCTTGGTGTCTTCCTCAAGTT SRR7030814 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:02:04 Started mapping on | Feb 12 20:02:04 Finished on | Feb 12 20:04:03 Mapping speed, Million of reads per hour | 629.10 Number of input reads | 20795356 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19635513 Uniquely mapped reads % | 94.42% Average mapped length | 296.50 Number of splices: Total | 18823254 Number of splices: Annotated (sjdb) | 18500332 Number of splices: GT/AG | 18534153 Number of splices: GC/AG | 228313 Number of splices: AT/AC | 12355 Number of splices: Non-canonical | 48433 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 572542 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 289176 % of reads mapped to too many loci | 1.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.25% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 606617 606617 606617 N_multimapping 572542 572542 572542 N_noFeature 394411 19433905 487617 N_ambiguous 210574 1374 101513 UnstrandedReadsAssigned:19030528 PositiveStrandReadsAssigned:200234 NegativeStrandReadsAssigned:19046383 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030814 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030814-trimmed-pair1.fastq SRR7030814-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,795,356 reads, 19,178,400 reads pseudoaligned [quant] estimated average fragment length: 252.116 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,113 rounds 52401 SRR7030814.ke.tsv 34699 SRR7030814.se.tsv 87100 total ==> SRR7030814.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.88 1786 37.6572 Potri.005G024800.1.v4.1 1035 783.884 1509 71.7154 Potri.004G059700.1.v4.1 961 709.902 32 1.67929 Potri.007G009000.2.v4.1 1416 1164.88 0 0 Potri.003G141000.2.v4.1 2943 2691.88 665 9.20323 Potri.016G087400.1.v4.1 270 69.4218 1275.38 684.414 Potri.015G069301.1.v4.1 564 316.307 0 0 Potri.010G195200.1.v4.1 1773 1521.88 41 1.00364 Potri.012G127500.1.v4.1 977 725.89 26794 1375.12 ==> SRR7030814.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 326 Potri.001G212900.v4.1 95 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7030814 completed mapping pipeline successfully