Starting /dee2/code/volunteer_pipeline.sh SRR7030815 current disk space = 3050880888832 free memory = 1576261724 SRR7030815 SRAfilesize 81c8811c74c88d443c2c2bfd29e92050 SRR7030815.sra SRR7030815.sra file validated SRR7030815 is paired end SRR7030815 is conventional basespace SRR7030815 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030815_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.215 32.0 18.0 33.0 18.0 34.0 2 31.3205 33.0 30.0 34.0 27.0 34.0 3 31.97175 33.0 31.0 34.0 28.0 34.0 4 32.3025 33.0 33.0 33.0 31.0 34.0 5 32.51625 33.0 33.0 34.0 32.0 34.0 6 35.8015 38.0 36.0 38.0 31.0 38.0 7 36.7175 38.0 37.0 38.0 34.0 38.0 8 37.0365 38.0 38.0 38.0 36.0 38.0 9 37.269 38.0 38.0 38.0 36.0 38.0 10-14 37.33215 38.0 38.0 38.0 36.8 38.0 15-19 37.41325 38.0 38.0 38.0 37.0 38.0 20-24 37.4274 38.0 38.0 38.0 37.0 38.0 25-29 37.4167 38.0 38.0 38.0 37.0 38.0 30-34 37.298500000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.267599999999995 38.0 38.0 38.0 36.8 38.0 40-44 37.260149999999996 38.0 38.0 38.0 36.8 38.0 45-49 37.251850000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.1868 38.0 38.0 38.0 36.2 38.0 55-59 37.11435 38.0 38.0 38.0 36.0 38.0 60-64 37.099650000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.955349999999996 38.0 38.0 38.0 35.6 38.0 70-74 36.9854 38.0 38.0 38.0 35.6 38.0 75-79 36.9293 38.0 38.0 38.0 35.2 38.0 80-84 36.7972 38.0 38.0 38.0 35.2 38.0 85-89 36.724999999999994 38.0 38.0 38.0 34.4 38.0 90-94 36.63635 38.0 38.0 38.0 34.2 38.0 95-99 36.5067 38.0 38.0 38.0 33.8 38.0 100-104 36.41885 38.0 38.0 38.0 34.0 38.0 105-109 36.3546 38.0 38.0 38.0 34.0 38.0 110-114 36.261799999999994 38.0 37.4 38.0 33.8 38.0 115-119 36.02305 38.0 37.0 38.0 33.0 38.0 120-124 35.7384 38.0 36.4 38.0 31.0 38.0 125-129 35.50235 38.0 36.0 38.0 30.6 38.0 130-134 35.113 38.0 35.6 38.0 28.6 38.0 135-139 34.91435 38.0 35.0 38.0 28.0 38.0 140-144 34.8758 38.0 35.2 38.0 28.2 38.0 145-149 34.2807 38.0 35.0 38.0 27.2 38.0 150-151 30.526874999999997 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 3.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 2.0 19 0.0 20 6.0 21 4.0 22 3.0 23 4.0 24 7.0 25 12.0 26 17.0 27 17.0 28 27.0 29 30.0 30 37.0 31 64.0 32 85.0 33 103.0 34 173.0 35 345.0 36 745.0 37 2313.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.9965324086423 12.750066684449187 10.562816751133635 39.69058415577487 2 22.625 15.075 33.050000000000004 29.25 3 19.125 19.8 25.374999999999996 35.699999999999996 4 22.625 26.575 22.875 27.925 5 22.294752698970623 32.58850112980166 24.554356013055486 20.56239015817223 6 19.85 34.475 25.0 20.674999999999997 7 15.775 26.224999999999998 39.900000000000006 18.099999999999998 8 18.125 24.6 31.474999999999998 25.8 9 17.075000000000003 24.099999999999998 33.725 25.1 10-14 20.195 28.89 26.83 24.085 15-19 20.02 27.825 27.805000000000003 24.349999999999998 20-24 20.115 27.72 27.935 24.23 25-29 20.22 28.084999999999997 27.305 24.39 30-34 19.564999999999998 28.754999999999995 27.375 24.305 35-39 19.8 28.305000000000003 27.279999999999998 24.615000000000002 40-44 19.98 28.455000000000002 27.250000000000004 24.315 45-49 20.630000000000003 28.105000000000004 27.095000000000002 24.169999999999998 50-54 20.615 28.17 27.015 24.2 55-59 19.99 28.115000000000002 27.650000000000002 24.245 60-64 20.505000000000003 27.61 28.02 23.865 65-69 20.71 28.015 27.36 23.915 70-74 20.39 28.33 27.68 23.599999999999998 75-79 20.945 27.705000000000002 27.395000000000003 23.955000000000002 80-84 20.44 27.79 28.155 23.615 85-89 20.990000000000002 26.63 27.61 24.77 90-94 20.705000000000002 28.134999999999998 26.939999999999998 24.22 95-99 20.845 27.85 27.37 23.935000000000002 100-104 20.91 27.74 27.060000000000002 24.29 105-109 20.695 28.29 27.105 23.91 110-114 20.560000000000002 27.785 27.435 24.22 115-119 21.165 27.685 26.93 24.22 120-124 21.490000000000002 27.405 27.29 23.815 125-129 21.240000000000002 26.945000000000004 27.29 24.525 130-134 20.65 28.055000000000003 27.33 23.965 135-139 20.925 27.79 26.919999999999998 24.365000000000002 140-144 21.38 27.589999999999996 27.355 23.674999999999997 145-149 21.375 27.115000000000002 27.655 23.855 150-151 21.580928481806776 27.452948557089087 26.348808030112924 24.617314930991217 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 2.5 25 4.0 26 4.0 27 5.5 28 6.5 29 9.5 30 12.5 31 15.5 32 25.0 33 35.5 34 48.5 35 58.0 36 70.5 37 97.0 38 125.0 39 152.0 40 174.0 41 206.0 42 240.0 43 239.5 44 239.0 45 264.5 46 255.0 47 245.0 48 249.5 49 220.5 50 191.0 51 169.0 52 138.5 53 109.0 54 94.0 55 74.0 56 53.5 57 40.0 58 29.0 59 22.0 60 20.5 61 16.5 62 8.0 63 6.5 64 6.5 65 3.0 66 0.5 67 2.5 68 3.0 69 0.5 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.275 2 0.0 3 0.0 4 0.0 5 0.42500000000000004 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.4249999999999998 0.0 0.0 0.0 0.0 126-127 1.65 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.75 0.0 0.0 0.0 0.0 136-137 3.0250000000000004 0.0 0.0 0.0 0.0 138-139 3.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030815 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030815_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6905 33.0 33.0 34.0 32.0 34.0 2 32.8105 33.0 33.0 34.0 32.0 34.0 3 32.85425 33.0 33.0 34.0 32.0 34.0 4 32.794 34.0 33.0 34.0 32.0 34.0 5 32.8245 33.0 33.0 34.0 32.0 34.0 6 36.992 38.0 38.0 38.0 36.0 38.0 7 37.0995 38.0 38.0 38.0 36.0 38.0 8 37.0425 38.0 38.0 38.0 36.0 38.0 9 37.06775 38.0 38.0 38.0 37.0 38.0 10-14 36.92465 38.0 38.0 38.0 35.6 38.0 15-19 36.96845 38.0 38.0 38.0 36.0 38.0 20-24 36.97709999999999 38.0 38.0 38.0 36.0 38.0 25-29 36.91754999999999 38.0 38.0 38.0 36.0 38.0 30-34 36.93575 38.0 38.0 38.0 36.0 38.0 35-39 36.84035 38.0 38.0 38.0 35.8 38.0 40-44 36.797399999999996 38.0 38.0 38.0 35.6 38.0 45-49 36.6626 38.0 38.0 38.0 35.0 38.0 50-54 36.6962 38.0 38.0 38.0 35.2 38.0 55-59 36.69785 38.0 38.0 38.0 35.0 38.0 60-64 36.618700000000004 38.0 38.0 38.0 35.0 38.0 65-69 36.61335 38.0 38.0 38.0 34.8 38.0 70-74 36.46445000000001 38.0 38.0 38.0 34.2 38.0 75-79 36.3307 38.0 38.0 38.0 34.0 38.0 80-84 36.3579 38.0 38.0 38.0 34.0 38.0 85-89 36.265249999999995 38.0 37.8 38.0 33.6 38.0 90-94 36.1973 38.0 37.8 38.0 33.4 38.0 95-99 35.945350000000005 38.0 37.0 38.0 32.6 38.0 100-104 35.78765 38.0 37.0 38.0 31.8 38.0 105-109 35.64829999999999 38.0 37.0 38.0 31.0 38.0 110-114 35.351150000000004 38.0 36.6 38.0 29.2 38.0 115-119 35.143249999999995 38.0 36.0 38.0 28.6 38.0 120-124 34.957 38.0 35.8 38.0 27.8 38.0 125-129 34.714749999999995 38.0 35.2 38.0 27.4 38.0 130-134 34.406850000000006 38.0 35.0 38.0 24.6 38.0 135-139 34.251850000000005 38.0 35.0 38.0 24.0 38.0 140-144 33.8317 38.0 34.6 38.0 21.8 38.0 145-149 33.13165 38.0 33.6 38.0 18.4 38.0 150-151 29.20375 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 4.0 5 1.0 6 0.0 7 0.0 8 2.0 9 4.0 10 0.0 11 2.0 12 0.0 13 2.0 14 2.0 15 1.0 16 5.0 17 1.0 18 5.0 19 5.0 20 9.0 21 4.0 22 5.0 23 12.0 24 16.0 25 20.0 26 20.0 27 25.0 28 30.0 29 54.0 30 52.0 31 78.0 32 98.0 33 121.0 34 190.0 35 322.0 36 673.0 37 2224.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.0 19.925 16.075 30.0 2 26.3013013013013 26.126126126126124 29.52952952952953 18.043043043043046 3 21.146146146146148 29.77977977977978 27.852852852852855 21.22122122122122 4 22.42242242242242 34.28428428428428 23.123123123123122 20.17017017017017 5 23.936968484242122 34.79239619809905 22.71135567783892 18.55927963981991 6 21.085542771385693 37.718859429714854 22.36118059029515 18.8344172086043 7 20.605151287821954 21.45536384096024 37.53438359589897 20.40510127531883 8 21.425 26.1 26.650000000000002 25.825 9 20.375 27.025 28.875 23.724999999999998 10-14 23.075000000000003 29.115000000000002 25.82 21.990000000000002 15-19 22.905 28.000000000000004 26.93 22.165000000000003 20-24 22.46 29.225 26.19 22.125 25-29 22.495 28.1 27.235 22.17 30-34 22.875 28.115000000000002 27.375 21.634999999999998 35-39 23.145 28.27 27.005000000000003 21.58 40-44 22.88 28.46 27.21 21.45 45-49 23.025000000000002 27.595 27.425 21.955 50-54 23.315 27.67 27.21 21.805 55-59 22.835 27.700000000000003 28.000000000000004 21.465 60-64 23.18 27.575 27.13 22.115000000000002 65-69 23.325000000000003 26.945000000000004 27.985 21.745 70-74 23.53 27.73 26.884999999999998 21.855 75-79 23.305 27.74 27.255000000000003 21.7 80-84 23.175 27.810000000000002 27.37 21.645 85-89 24.05 27.26 27.04 21.65 90-94 23.18 28.005000000000003 27.150000000000002 21.665 95-99 24.044999999999998 27.38 27.205000000000002 21.37 100-104 24.04 27.529999999999998 27.315 21.115000000000002 105-109 23.805 26.650000000000002 28.044999999999998 21.5 110-114 24.2 27.965 26.924999999999997 20.91 115-119 24.154999999999998 27.015 27.155 21.675 120-124 23.29 27.62 27.860000000000003 21.23 125-129 24.39 27.51 27.35 20.75 130-134 24.445 27.445000000000004 27.529999999999998 20.580000000000002 135-139 24.7 27.32 27.185 20.794999999999998 140-144 24.265 27.689999999999998 26.810000000000002 21.235 145-149 25.515 26.650000000000002 27.474999999999998 20.36 150-151 25.4411212614191 28.344387435865347 26.59241646852709 19.622074834188464 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 2.0 25 4.0 26 3.5 27 2.0 28 3.5 29 6.0 30 6.5 31 8.0 32 13.0 33 25.5 34 42.0 35 56.5 36 69.5 37 88.5 38 119.0 39 148.0 40 187.5 41 234.0 42 263.5 43 260.0 44 254.5 45 259.5 46 261.5 47 264.5 48 247.5 49 216.5 50 189.0 51 164.5 52 127.5 53 103.5 54 89.5 55 62.0 56 48.0 57 35.0 58 28.5 59 30.5 60 19.5 61 12.5 62 10.5 63 9.0 64 4.5 65 3.0 66 2.5 67 1.0 68 1.5 69 1.5 70 2.5 71 2.0 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.1 4 0.1 5 0.05 6 0.05 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.6298815822625347 1.25 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.875 0.0 0.0 0.0 0.0 130-131 2.1375 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 2.9375 0.0 0.0 0.0 0.0 138-139 3.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGACTT 10 0.006830828 145.0 2 GCAGCAG 20 0.00593511 29.0 55-59 >>END_MODULE Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994798 spots for SRR7030815.sra Written 994798 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra Read 994782 spots for SRR7030815.sra Written 994782 spots for SRR7030815.sra SRR ids: ['SRR7030815.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eesj5eqa SRR7030815.sra spots: 19895656 blocks: [[1, 994782], [994783, 1989564], [1989565, 2984346], [2984347, 3979128], [3979129, 4973910], [4973911, 5968692], [5968693, 6963474], [6963475, 7958256], [7958257, 8953038], [8953039, 9947820], [9947821, 10942602], [10942603, 11937384], [11937385, 12932166], [12932167, 13926948], [13926949, 14921730], [14921731, 15916512], [15916513, 16911294], [16911295, 17906076], [17906077, 18900858], [18900859, 19895656]] SRR7030815 file size 6720284 SRR7030815 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030815 SRR7030815_1.fastq SRR7030815_2.fastq Input file: SRR7030815_1.fastq Paired file: SRR7030815_2.fastq trimmed: SRR7030815-trimmed-pair1.fastq, SRR7030815-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:55:33 2025 >> started Wed Feb 12 19:55:55 2025 >> done (21.685s) 19895656 read pairs processed; of these: 20872 ( 0.10%) short read pairs filtered out after trimming by size control 24505 ( 0.12%) empty read pairs filtered out after trimming by size control 19850279 (99.77%) read pairs available; of these: 7675263 (38.67%) trimmed read pairs available after processing 12175016 (61.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 1 0.00% 21 5 0.00% 22 2 0.00% 23 5 0.00% 24 2 0.00% 25 2 0.00% 26 4 0.00% 27 5 0.00% 28 4 0.00% 29 1 0.00% 30 8 0.00% 31 2 0.00% 32 3 0.00% 33 4 0.00% 34 4 0.00% 35 4 0.00% 36 1 0.00% 37 7 0.00% 38 6 0.00% 39 7 0.00% 40 5 0.00% 41 6 0.00% 42 9 0.00% 43 10 0.00% 44 8 0.00% 45 13 0.00% 46 12 0.00% 47 12 0.00% 48 19 0.00% 49 13 0.00% 50 16 0.00% 51 17 0.00% 52 25 0.00% 53 32 0.00% 54 31 0.00% 55 35 0.00% 56 24 0.00% 57 45 0.00% 58 42 0.00% 59 50 0.00% 60 58 0.00% 61 59 0.00% 62 72 0.00% 63 66 0.00% 64 82 0.00% 65 102 0.00% 66 104 0.00% 67 115 0.00% 68 110 0.00% 69 148 0.00% 70 156 0.00% 71 231 0.00% 72 224 0.00% 73 242 0.00% 74 297 0.00% 75 353 0.00% 76 461 0.00% 77 442 0.00% 78 456 0.00% 79 505 0.00% 80 620 0.00% 81 697 0.00% 82 950 0.00% 83 973 0.00% 84 2014 0.01% 85 2823 0.01% 86 2834 0.01% 87 2918 0.01% 88 3207 0.02% 89 3284 0.02% 90 3354 0.02% 91 3579 0.02% 92 3839 0.02% 93 4129 0.02% 94 4412 0.02% 95 4709 0.02% 96 4863 0.02% 97 5120 0.03% 98 5674 0.03% 99 5949 0.03% 100 6441 0.03% 101 6816 0.03% 102 7267 0.04% 103 7766 0.04% 104 8426 0.04% 105 8997 0.05% 106 9544 0.05% 107 9941 0.05% 108 10698 0.05% 109 11110 0.06% 110 11991 0.06% 111 12764 0.06% 112 14188 0.07% 113 14714 0.07% 114 15847 0.08% 115 16953 0.09% 116 18026 0.09% 117 18953 0.10% 118 19749 0.10% 119 20811 0.10% 120 21738 0.11% 121 23096 0.12% 122 24470 0.12% 123 26080 0.13% 124 27981 0.14% 125 29702 0.15% 126 31332 0.16% 127 33270 0.17% 128 34573 0.17% 129 36464 0.18% 130 38611 0.19% 131 41165 0.21% 132 43716 0.22% 133 46718 0.24% 134 50661 0.26% 135 54224 0.27% 136 58650 0.30% 137 62546 0.32% 138 68136 0.34% 139 74564 0.38% 140 79387 0.40% 141 86128 0.43% 142 95934 0.48% 143 109553 0.55% 144 128328 0.65% 145 156090 0.79% 146 197137 0.99% 147 268549 1.35% 148 409760 2.06% 149 812483 4.09% 150 4182476 21.07% 151 12175016 61.33% 19850279 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.06 fanout-score-rank=23 prefix-density=0.33 prefix-fanout=3.7 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=384.30 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=20.4 sequence=TCTTCAAGAGAGTAGCACGTAATTCAGCCGCATCGATTTCCTGAGCAACATTCTCTGGTCTGTAGAATCCAGTACGAGGATCTGGAACCCAGGAAATCTTCTCGGTGGTCTTGGTAACCTCCTCCCCTGTTTTCTTCATTACAGCAGCACCGCTTCTTGCCTTGGACACAGCAGCTCCTTGGGATGCAACAGCTGAGAATCCTCTGCCGTTGATTGCCTCGCTGATCAGGCCAGAGATGACCTTGGCGTTTGAGAAAGAACGAGCCATTCTACAAATACAGTGTGTGATTTGATTCAAACTTTGTGAAAGAAGTTTTACGAAAACAAGAGATGATGGATCTTTTATATATTTCAACTGCCGTAGAAACTTGTTTGTTTCTTC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=40 prefix-density=0.39 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=110.99 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=23.5 sequence=AGGAAGAAGAAGA SRR7030815 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:56:36 Started mapping on | Feb 12 19:56:36 Finished on | Feb 12 19:58:30 Mapping speed, Million of reads per hour | 626.85 Number of input reads | 19850279 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18786161 Uniquely mapped reads % | 94.64% Average mapped length | 296.95 Number of splices: Total | 19198358 Number of splices: Annotated (sjdb) | 18934578 Number of splices: GT/AG | 18889044 Number of splices: GC/AG | 255569 Number of splices: AT/AC | 13325 Number of splices: Non-canonical | 40420 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 612158 % of reads mapped to multiple loci | 3.08% Number of reads mapped to too many loci | 253521 % of reads mapped to too many loci | 1.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.79% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 471841 471841 471841 N_multimapping 612158 612158 612158 N_noFeature 286300 18620252 350233 N_ambiguous 204199 767 101678 UnstrandedReadsAssigned:18295662 PositiveStrandReadsAssigned:165142 NegativeStrandReadsAssigned:18334250 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030815 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030815-trimmed-pair1.fastq SRR7030815-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,850,279 reads, 18,545,859 reads pseudoaligned [quant] estimated average fragment length: 255.969 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7030815.ke.tsv 34699 SRR7030815.se.tsv 87100 total ==> SRR7030815.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.03 1013.53 23.2055 Potri.005G024800.1.v4.1 1035 780.031 143 7.40013 Potri.004G059700.1.v4.1 961 706.063 23 1.31492 Potri.007G009000.2.v4.1 1416 1161.03 0 0 Potri.003G141000.2.v4.1 2943 2688.03 493 7.40334 Potri.016G087400.1.v4.1 270 68.6313 1390.44 817.798 Potri.015G069301.1.v4.1 564 313.487 0 0 Potri.010G195200.1.v4.1 1773 1518.03 5 0.132955 Potri.012G127500.1.v4.1 977 722.044 6412 358.464 ==> SRR7030815.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7030815 completed mapping pipeline successfully