Starting /dee2/code/volunteer_pipeline.sh SRR7030816 current disk space = 3050890719232 free memory = 1579780808 SRR7030816 SRAfilesize bb9fe25e466bf72fe13f64a34aee0785 SRR7030816.sra SRR7030816.sra file validated SRR7030816 is paired end SRR7030816 is conventional basespace SRR7030816 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030816_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.7185 32.0 25.0 33.0 18.0 34.0 2 31.47775 33.0 31.0 34.0 27.0 34.0 3 32.10625 33.0 31.0 34.0 28.0 34.0 4 32.283 33.0 33.0 33.0 31.0 34.0 5 31.67825 33.0 32.0 33.0 30.0 34.0 6 36.27525 38.0 36.0 38.0 33.0 38.0 7 36.3255 38.0 37.0 38.0 33.0 38.0 8 37.2245 38.0 38.0 38.0 36.0 38.0 9 37.42075 38.0 38.0 38.0 37.0 38.0 10-14 37.37945 38.0 38.0 38.0 36.8 38.0 15-19 37.435199999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.41395 38.0 38.0 38.0 37.0 38.0 25-29 37.36295 38.0 38.0 38.0 37.0 38.0 30-34 37.28595 38.0 38.0 38.0 37.0 38.0 35-39 37.26585 38.0 38.0 38.0 36.6 38.0 40-44 37.2187 38.0 38.0 38.0 36.6 38.0 45-49 37.23235 38.0 38.0 38.0 36.4 38.0 50-54 37.194100000000006 38.0 38.0 38.0 36.4 38.0 55-59 37.080200000000005 38.0 38.0 38.0 36.0 38.0 60-64 37.0383 38.0 38.0 38.0 36.0 38.0 65-69 36.93345 38.0 38.0 38.0 35.8 38.0 70-74 36.9188 38.0 38.0 38.0 35.6 38.0 75-79 36.81445 38.0 38.0 38.0 35.0 38.0 80-84 36.744749999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.7341 38.0 38.0 38.0 34.8 38.0 90-94 36.60914999999999 38.0 38.0 38.0 34.2 38.0 95-99 36.3705 38.0 37.8 38.0 33.8 38.0 100-104 36.33135 38.0 37.4 38.0 34.0 38.0 105-109 36.35435 38.0 38.0 38.0 34.0 38.0 110-114 36.11515 38.0 37.2 38.0 33.2 38.0 115-119 35.8636 38.0 37.0 38.0 31.8 38.0 120-124 35.637550000000005 38.0 36.6 38.0 31.4 38.0 125-129 35.41215 38.0 36.0 38.0 30.6 38.0 130-134 34.99795 38.0 35.4 38.0 28.4 38.0 135-139 34.64165 38.0 35.0 38.0 27.2 38.0 140-144 34.611749999999994 38.0 35.0 38.0 27.2 38.0 145-149 33.844550000000005 38.0 35.0 38.0 22.2 38.0 150-151 30.401000000000003 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 2.0 12 1.0 13 1.0 14 1.0 15 0.0 16 3.0 17 0.0 18 4.0 19 4.0 20 3.0 21 0.0 22 4.0 23 8.0 24 11.0 25 7.0 26 21.0 27 15.0 28 18.0 29 30.0 30 59.0 31 58.0 32 92.0 33 116.0 34 215.0 35 303.0 36 707.0 37 2316.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.626168224299064 12.016021361815755 7.049399198931909 41.308411214953274 2 18.725 13.5 37.0 30.775000000000002 3 17.8 18.65 27.875 35.675000000000004 4 24.625 25.05 24.05 26.275 5 23.227752639517345 31.850175967823024 24.032176973353444 20.889894419306184 6 19.5 35.3 24.9 20.3 7 15.1 26.700000000000003 40.575 17.625 8 16.775000000000002 24.474999999999998 33.2 25.55 9 17.375 22.5 35.375 24.75 10-14 20.215 29.294999999999998 27.325 23.165 15-19 19.6 28.275 27.839999999999996 24.285 20-24 20.1 27.54 28.384999999999998 23.974999999999998 25-29 19.49 28.244999999999997 27.794999999999998 24.47 30-34 19.31 28.449999999999996 28.23 24.01 35-39 20.465 27.779999999999998 28.095 23.66 40-44 19.835 28.199999999999996 27.639999999999997 24.325 45-49 20.19 27.765 27.705000000000002 24.34 50-54 19.575 28.01 28.134999999999998 24.279999999999998 55-59 20.275000000000002 28.27 27.22 24.235 60-64 19.564999999999998 28.1 27.72 24.615000000000002 65-69 20.28 28.244999999999997 27.605 23.87 70-74 20.53 27.855 27.685 23.93 75-79 19.74 27.345000000000002 28.485 24.43 80-84 20.685000000000002 27.62 27.74 23.955000000000002 85-89 19.875 27.975 27.415 24.735 90-94 19.925 27.134999999999998 28.62 24.32 95-99 20.16 28.215 27.384999999999998 24.240000000000002 100-104 20.419999999999998 27.985 27.935 23.66 105-109 20.32 27.74 27.575 24.365000000000002 110-114 20.84 27.034999999999997 27.650000000000002 24.474999999999998 115-119 20.745 27.150000000000002 28.32 23.785 120-124 20.22 28.015 27.800000000000004 23.965 125-129 20.285 27.205000000000002 27.715 24.795 130-134 20.95 27.07 27.860000000000003 24.12 135-139 20.674999999999997 27.725 27.555000000000003 24.044999999999998 140-144 20.445 27.994999999999997 27.3 24.26 145-149 20.835 27.87 27.644999999999996 23.65 150-151 20.38152610441767 26.869979919678716 27.986947791164656 24.761546184738954 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.5 25 4.0 26 6.5 27 10.0 28 12.5 29 12.5 30 14.5 31 24.0 32 31.5 33 37.5 34 51.5 35 65.0 36 80.5 37 101.0 38 127.5 39 140.5 40 177.5 41 213.5 42 224.0 43 249.5 44 248.5 45 264.0 46 275.0 47 240.5 48 236.5 49 221.0 50 179.5 51 161.0 52 128.5 53 94.5 54 81.0 55 69.5 56 55.0 57 44.5 58 35.5 59 25.0 60 16.0 61 8.5 62 7.5 63 5.5 64 1.0 65 1.0 66 2.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.375 2 0.0 3 0.0 4 0.0 5 0.5499999999999999 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.25 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.675 0.0 0.0 0.0 0.0 126-127 1.85 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.675 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138-139 3.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGAAT 10 0.0068396386 144.9375 6 >>END_MODULE SRR7030816 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030816_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8255 33.0 33.0 34.0 32.0 34.0 2 32.90225 33.0 33.0 34.0 32.0 34.0 3 32.8905 33.0 33.0 34.0 32.0 34.0 4 32.85675 33.0 33.0 34.0 32.0 34.0 5 32.8905 33.0 33.0 34.0 32.0 34.0 6 37.1485 38.0 38.0 38.0 36.0 38.0 7 37.20875 38.0 38.0 38.0 37.0 38.0 8 37.149 38.0 38.0 38.0 36.0 38.0 9 37.12175 38.0 38.0 38.0 36.0 38.0 10-14 37.0265 38.0 38.0 38.0 36.0 38.0 15-19 37.057399999999994 38.0 38.0 38.0 36.0 38.0 20-24 37.096399999999996 38.0 38.0 38.0 36.6 38.0 25-29 37.045300000000005 38.0 38.0 38.0 36.2 38.0 30-34 37.0133 38.0 38.0 38.0 36.0 38.0 35-39 36.896350000000005 38.0 38.0 38.0 35.8 38.0 40-44 36.932300000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.7944 38.0 38.0 38.0 35.8 38.0 50-54 36.768 38.0 38.0 38.0 35.2 38.0 55-59 36.832300000000004 38.0 38.0 38.0 35.8 38.0 60-64 36.71685 38.0 38.0 38.0 35.0 38.0 65-69 36.682300000000005 38.0 38.0 38.0 34.8 38.0 70-74 36.580999999999996 38.0 38.0 38.0 34.2 38.0 75-79 36.4726 38.0 38.0 38.0 34.0 38.0 80-84 36.486850000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.3675 38.0 38.0 38.0 33.8 38.0 90-94 36.2777 38.0 38.0 38.0 34.0 38.0 95-99 35.993449999999996 38.0 37.0 38.0 33.0 38.0 100-104 35.8893 38.0 37.0 38.0 32.4 38.0 105-109 35.7554 38.0 37.0 38.0 31.6 38.0 110-114 35.48180000000001 38.0 36.6 38.0 30.2 38.0 115-119 35.190799999999996 38.0 36.0 38.0 28.2 38.0 120-124 35.021 38.0 35.8 38.0 27.8 38.0 125-129 34.869150000000005 38.0 35.4 38.0 27.8 38.0 130-134 34.5594 38.0 35.0 38.0 26.0 38.0 135-139 34.37785 38.0 35.0 38.0 25.6 38.0 140-144 34.003699999999995 38.0 35.0 38.0 23.2 38.0 145-149 33.06115 38.0 33.8 38.0 18.0 38.0 150-151 29.12425 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 0.0 5 1.0 6 1.0 7 0.0 8 2.0 9 1.0 10 0.0 11 1.0 12 2.0 13 1.0 14 1.0 15 2.0 16 4.0 17 3.0 18 7.0 19 3.0 20 5.0 21 8.0 22 13.0 23 8.0 24 15.0 25 14.0 26 23.0 27 32.0 28 27.0 29 48.0 30 61.0 31 72.0 32 93.0 33 129.0 34 174.0 35 299.0 36 663.0 37 2279.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.975 22.425 11.225 30.375000000000004 2 26.59654395191585 25.64487853744052 32.03105434510393 15.727523165539695 3 20.716432865731463 27.655310621242485 32.74048096192384 18.887775551102205 4 23.34669338677355 34.59418837675351 22.970941883767534 19.08817635270541 5 25.125125125125123 36.38638638638639 23.073073073073072 15.415415415415415 6 20.42042042042042 39.36436436436436 22.822822822822822 17.39239239239239 7 21.45536384096024 20.7551887971993 38.584646161540384 19.204801200300075 8 21.0 26.650000000000002 27.775 24.575 9 22.8 24.85 29.075 23.275000000000002 10-14 23.189999999999998 29.720000000000002 25.885 21.205 15-19 22.98 28.575 27.0 21.445 20-24 22.900000000000002 28.78 26.919999999999998 21.4 25-29 23.11 28.144999999999996 27.665 21.08 30-34 22.75 28.560000000000002 27.12 21.57 35-39 22.74 28.52 27.975 20.765 40-44 23.599999999999998 28.275 27.32 20.805 45-49 22.595000000000002 28.52 27.765 21.12 50-54 23.41 28.199999999999996 27.415 20.974999999999998 55-59 22.85 27.375 28.15 21.625 60-64 23.150000000000002 28.050000000000004 27.775 21.025 65-69 23.380000000000003 27.98 27.91 20.73 70-74 23.365 28.43 27.310000000000002 20.895 75-79 23.380000000000003 28.444999999999997 27.465 20.71 80-84 23.57 28.515 26.91 21.005 85-89 24.135 28.04 27.355 20.47 90-94 23.89 28.23 27.485 20.395 95-99 24.19 27.82 27.805000000000003 20.185 100-104 23.535 28.34 27.32 20.805 105-109 24.125 27.725 27.605 20.544999999999998 110-114 24.36 27.76 27.305 20.575 115-119 24.404999999999998 27.439999999999998 27.51 20.645 120-124 24.065 28.265 26.83 20.84 125-129 24.975 28.475 25.86 20.69 130-134 24.03 28.005000000000003 27.650000000000002 20.315 135-139 24.86 27.779999999999998 27.18 20.18 140-144 24.54 28.050000000000004 27.150000000000002 20.26 145-149 24.515 28.335 26.655 20.495 150-151 25.01251877816725 27.491236855282924 27.078117175763644 20.41812719078618 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 3.0 26 2.0 27 3.0 28 5.0 29 4.5 30 7.5 31 17.5 32 29.0 33 39.0 34 46.5 35 58.0 36 83.0 37 114.5 38 142.0 39 170.5 40 197.0 41 224.5 42 253.0 43 270.0 44 289.5 45 289.5 46 261.5 47 239.0 48 229.5 49 206.5 50 166.0 51 135.5 52 111.5 53 91.0 54 72.5 55 54.0 56 44.0 57 39.0 58 27.5 59 14.5 60 13.5 61 13.0 62 8.5 63 6.5 64 5.5 65 3.5 66 1.0 67 0.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.2 4 0.2 5 0.1 6 0.1 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11705348133198 98.225 2 0.8577194752774974 1.7000000000000002 3 0.025227043390514632 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.225 0.0 0.0 0.0 0.0 122-123 1.475 0.0 0.0 0.0 0.0 124-125 1.65 0.0 0.0 0.0 0.0 126-127 1.85 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.1500000000000004 0.0 0.0 0.0 0.0 132-133 2.3875 0.0 0.0 0.0 0.0 134-135 2.6500000000000004 0.0 0.0 0.0 0.0 136-137 2.8499999999999996 0.0 0.0 0.0 0.0 138-139 3.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTATT 10 0.006347885 148.55127 1 >>END_MODULE Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra Read 1058730 spots for SRR7030816.sra Written 1058730 spots for SRR7030816.sra Read 1058723 spots for SRR7030816.sra Written 1058723 spots for SRR7030816.sra SRR ids: ['SRR7030816.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g2q3lv23 SRR7030816.sra spots: 21174467 blocks: [[1, 1058723], [1058724, 2117446], [2117447, 3176169], [3176170, 4234892], [4234893, 5293615], [5293616, 6352338], [6352339, 7411061], [7411062, 8469784], [8469785, 9528507], [9528508, 10587230], [10587231, 11645953], [11645954, 12704676], [12704677, 13763399], [13763400, 14822122], [14822123, 15880845], [15880846, 16939568], [16939569, 17998291], [17998292, 19057014], [19057015, 20115737], [20115738, 21174467]] SRR7030816 file size 7153631 SRR7030816 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030816 SRR7030816_1.fastq SRR7030816_2.fastq Input file: SRR7030816_1.fastq Paired file: SRR7030816_2.fastq trimmed: SRR7030816-trimmed-pair1.fastq, SRR7030816-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:38:49 2025 >> started Wed Feb 12 20:39:13 2025 >> done (23.419s) 21174467 read pairs processed; of these: 12760 ( 0.06%) short read pairs filtered out after trimming by size control 16430 ( 0.08%) empty read pairs filtered out after trimming by size control 21145277 (99.86%) read pairs available; of these: 8196615 (38.76%) trimmed read pairs available after processing 12948662 (61.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 2 0.00% 25 5 0.00% 26 3 0.00% 27 6 0.00% 28 5 0.00% 29 7 0.00% 30 3 0.00% 31 6 0.00% 32 6 0.00% 33 4 0.00% 34 8 0.00% 35 4 0.00% 36 9 0.00% 37 4 0.00% 38 7 0.00% 39 11 0.00% 40 12 0.00% 41 14 0.00% 42 1 0.00% 43 14 0.00% 44 11 0.00% 45 9 0.00% 46 19 0.00% 47 15 0.00% 48 12 0.00% 49 19 0.00% 50 27 0.00% 51 26 0.00% 52 37 0.00% 53 31 0.00% 54 33 0.00% 55 36 0.00% 56 40 0.00% 57 51 0.00% 58 55 0.00% 59 62 0.00% 60 71 0.00% 61 95 0.00% 62 101 0.00% 63 96 0.00% 64 127 0.00% 65 163 0.00% 66 126 0.00% 67 182 0.00% 68 217 0.00% 69 230 0.00% 70 257 0.00% 71 305 0.00% 72 379 0.00% 73 379 0.00% 74 464 0.00% 75 512 0.00% 76 588 0.00% 77 642 0.00% 78 735 0.00% 79 820 0.00% 80 894 0.00% 81 1063 0.01% 82 1190 0.01% 83 1429 0.01% 84 2119 0.01% 85 2711 0.01% 86 2897 0.01% 87 3122 0.01% 88 3381 0.02% 89 3465 0.02% 90 3869 0.02% 91 3902 0.02% 92 4409 0.02% 93 4724 0.02% 94 4977 0.02% 95 5409 0.03% 96 5674 0.03% 97 6139 0.03% 98 6653 0.03% 99 7042 0.03% 100 7483 0.04% 101 7953 0.04% 102 8333 0.04% 103 9015 0.04% 104 9510 0.04% 105 10183 0.05% 106 10811 0.05% 107 11453 0.05% 108 12068 0.06% 109 12804 0.06% 110 13577 0.06% 111 14367 0.07% 112 15472 0.07% 113 16127 0.08% 114 17182 0.08% 115 18419 0.09% 116 19759 0.09% 117 20753 0.10% 118 21773 0.10% 119 22542 0.11% 120 23479 0.11% 121 25000 0.12% 122 25894 0.12% 123 27601 0.13% 124 29051 0.14% 125 31101 0.15% 126 32342 0.15% 127 34356 0.16% 128 36031 0.17% 129 38058 0.18% 130 40438 0.19% 131 42706 0.20% 132 45926 0.22% 133 48193 0.23% 134 52170 0.25% 135 56177 0.27% 136 60413 0.29% 137 64450 0.30% 138 69879 0.33% 139 77446 0.37% 140 83053 0.39% 141 90384 0.43% 142 100868 0.48% 143 113424 0.54% 144 133578 0.63% 145 165259 0.78% 146 209715 0.99% 147 286503 1.35% 148 439520 2.08% 149 878585 4.15% 150 4473246 21.15% 151 12948662 61.24% 21145277 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=5.27 fanout-score-rank=23 prefix-density=0.27 prefix-fanout=3.4 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=115.52 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=22.0 sequence=CCTTCTTCTTGA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=38 prefix-density=0.42 prefix-fanout=2.0 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=168.74 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=8.1 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAA SRR7030816 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:40:14 Started mapping on | Feb 12 20:40:14 Finished on | Feb 12 20:42:23 Mapping speed, Million of reads per hour | 590.10 Number of input reads | 21145277 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19865659 Uniquely mapped reads % | 93.95% Average mapped length | 296.79 Number of splices: Total | 19163000 Number of splices: Annotated (sjdb) | 18842995 Number of splices: GT/AG | 18844588 Number of splices: GC/AG | 257638 Number of splices: AT/AC | 13922 Number of splices: Non-canonical | 46852 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 678792 % of reads mapped to multiple loci | 3.21% Number of reads mapped to too many loci | 324471 % of reads mapped to too many loci | 1.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.07% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 614894 614894 614894 N_multimapping 678792 678792 678792 N_noFeature 449203 19635690 548368 N_ambiguous 234246 1183 102731 UnstrandedReadsAssigned:19182210 PositiveStrandReadsAssigned:228786 NegativeStrandReadsAssigned:19214560 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030816 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030816-trimmed-pair1.fastq SRR7030816-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,145,277 reads, 19,389,723 reads pseudoaligned [quant] estimated average fragment length: 261.042 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR7030816.ke.tsv 34699 SRR7030816.se.tsv 87100 total ==> SRR7030816.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.96 3044 62.2182 Potri.005G024800.1.v4.1 1035 774.958 2180 101.079 Potri.004G059700.1.v4.1 961 700.964 40 2.05043 Potri.007G009000.2.v4.1 1416 1155.96 0 0 Potri.003G141000.2.v4.1 2943 2682.96 851 11.3972 Potri.016G087400.1.v4.1 270 67.8839 1297.75 686.919 Potri.015G069301.1.v4.1 564 308.239 0 0 Potri.010G195200.1.v4.1 1773 1512.96 92 2.18495 Potri.012G127500.1.v4.1 977 716.958 5696 285.468 ==> SRR7030816.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 74 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 286 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 163 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7030816 completed mapping pipeline successfully