Starting /dee2/code/volunteer_pipeline.sh SRR7030817 current disk space = 3050907217920 free memory = 1579869908 SRR7030817 SRAfilesize 8e8b68d584503053e5d749a12dcfaed9 SRR7030817.sra SRR7030817.sra file validated SRR7030817 is paired end SRR7030817 is conventional basespace SRR7030817 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030817_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.62075 33.0 32.0 33.0 30.0 34.0 2 32.113 33.0 33.0 33.0 29.0 34.0 3 31.22225 33.0 31.0 33.0 28.0 33.0 4 32.13225 33.0 32.0 33.0 31.0 34.0 5 32.32825 33.0 33.0 33.0 31.0 34.0 6 36.3795 38.0 37.0 38.0 33.0 38.0 7 37.2805 38.0 38.0 38.0 36.0 38.0 8 37.45125 38.0 38.0 38.0 37.0 38.0 9 37.61625 38.0 38.0 38.0 38.0 38.0 10-14 37.5333 38.0 38.0 38.0 37.8 38.0 15-19 37.589600000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.51735 38.0 38.0 38.0 38.0 38.0 25-29 37.4862 38.0 38.0 38.0 38.0 38.0 30-34 37.443250000000006 38.0 38.0 38.0 37.8 38.0 35-39 37.41824999999999 38.0 38.0 38.0 37.6 38.0 40-44 37.485 38.0 38.0 38.0 38.0 38.0 45-49 37.39955 38.0 38.0 38.0 37.4 38.0 50-54 37.36155 38.0 38.0 38.0 37.0 38.0 55-59 37.342499999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.2576 38.0 38.0 38.0 36.8 38.0 65-69 37.2376 38.0 38.0 38.0 37.0 38.0 70-74 37.264849999999996 38.0 38.0 38.0 37.0 38.0 75-79 37.18945 38.0 38.0 38.0 36.8 38.0 80-84 36.9557 38.0 38.0 38.0 36.0 38.0 85-89 36.7508 38.0 38.0 38.0 35.2 38.0 90-94 36.801750000000006 38.0 38.0 38.0 35.2 38.0 95-99 36.765699999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.647400000000005 38.0 38.0 38.0 34.8 38.0 105-109 36.528 38.0 38.0 38.0 34.2 38.0 110-114 36.23835 38.0 37.8 38.0 33.6 38.0 115-119 36.12949999999999 38.0 37.8 38.0 33.6 38.0 120-124 36.01005 38.0 37.2 38.0 33.0 38.0 125-129 35.820350000000005 38.0 37.0 38.0 32.6 38.0 130-134 35.4979 38.0 36.2 38.0 30.4 38.0 135-139 35.2628 38.0 35.8 38.0 30.4 38.0 140-144 34.544799999999995 38.0 35.0 38.0 26.0 38.0 145-149 34.17675 38.0 34.6 38.0 25.2 38.0 150-151 29.93 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 3.0 17 2.0 18 3.0 19 1.0 20 7.0 21 4.0 22 3.0 23 8.0 24 4.0 25 8.0 26 12.0 27 14.0 28 23.0 29 25.0 30 46.0 31 45.0 32 65.0 33 102.0 34 139.0 35 235.0 36 637.0 37 2609.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.82615306639635 11.049163710086162 9.503294475418144 38.62138874809934 2 22.675 13.575000000000001 32.75 31.0 3 20.7 16.075 27.400000000000002 35.825 4 23.025000000000002 25.7 24.925 26.35 5 24.23711855927964 28.88944472236118 24.68734367183592 22.18609304652326 6 20.150000000000002 33.5 24.45 21.9 7 14.899999999999999 25.4 41.55 18.15 8 17.675 25.95 31.825 24.55 9 18.05 25.074999999999996 33.5 23.375 10-14 19.855 29.365000000000002 26.985 23.794999999999998 15-19 20.095 27.395000000000003 27.644999999999996 24.865000000000002 20-24 19.925 28.660000000000004 27.26 24.154999999999998 25-29 19.98 27.67 27.915 24.435000000000002 30-34 19.55 28.395 27.589999999999996 24.465 35-39 20.24 27.955000000000002 27.54 24.265 40-44 20.845 27.650000000000002 27.71 23.794999999999998 45-49 20.0 28.044999999999998 27.029999999999998 24.925 50-54 19.875 28.435 27.435 24.255 55-59 20.419999999999998 27.589999999999996 27.655 24.335 60-64 19.945 27.825 27.295 24.935 65-69 19.744999999999997 27.700000000000003 27.650000000000002 24.905 70-74 20.02 28.225 27.515 24.240000000000002 75-79 19.89 28.025 27.52 24.565 80-84 20.455000000000002 27.72 27.605 24.22 85-89 20.0 27.495000000000005 27.985 24.52 90-94 20.335 27.935 27.689999999999998 24.04 95-99 20.52 27.139999999999997 27.77 24.57 100-104 20.915 27.35 27.515 24.22 105-109 20.755000000000003 27.455000000000002 27.355 24.435000000000002 110-114 20.39 27.245 27.794999999999998 24.57 115-119 20.9 27.215 27.529999999999998 24.355 120-124 20.645 27.355 27.650000000000002 24.349999999999998 125-129 20.65 27.125 27.944999999999997 24.279999999999998 130-134 20.415 27.68 27.105 24.8 135-139 21.035 27.005000000000003 27.805000000000003 24.154999999999998 140-144 20.46 27.815 27.134999999999998 24.59 145-149 21.33 27.315 26.995 24.36 150-151 20.0875 27.6 26.737499999999997 25.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 0.5 24 0.5 25 2.0 26 3.5 27 5.5 28 8.0 29 9.5 30 13.5 31 22.0 32 29.5 33 34.0 34 46.5 35 66.0 36 76.0 37 102.0 38 129.0 39 144.5 40 170.5 41 196.5 42 224.0 43 238.0 44 248.0 45 272.5 46 276.0 47 251.5 48 232.0 49 223.0 50 201.0 51 153.0 52 114.5 53 101.0 54 80.5 55 58.5 56 50.5 57 41.5 58 30.5 59 25.5 60 26.0 61 22.0 62 16.5 63 9.0 64 4.5 65 7.0 66 6.0 67 5.0 68 4.0 69 4.5 70 3.5 71 1.5 72 1.0 73 1.5 74 1.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16645617580197 98.15 2 0.6819904016165698 1.35 3 0.10103561505430665 0.3 4 0.050517807527153326 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.05 0.0 0.0 0.0 0.0 118-119 1.2625 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.6375000000000002 0.0 0.0 0.0 0.0 126-127 1.9249999999999998 0.0 0.0 0.0 0.0 128-129 2.1625 0.0 0.0 0.0 0.0 130-131 2.5375 0.0 0.0 0.0 0.0 132-133 2.7625 0.0 0.0 0.0 0.0 134-135 2.875 0.0 0.0 0.0 0.0 136-137 3.0875 0.0 0.0 0.0 0.0 138-139 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7030817 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030817_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84925 34.0 33.0 34.0 32.0 34.0 2 32.91625 34.0 33.0 34.0 32.0 34.0 3 32.82075 34.0 33.0 34.0 32.0 34.0 4 32.8485 34.0 33.0 34.0 32.0 34.0 5 32.86475 34.0 33.0 34.0 32.0 34.0 6 37.0055 38.0 38.0 38.0 37.0 38.0 7 37.03825 38.0 38.0 38.0 37.0 38.0 8 37.047 38.0 38.0 38.0 37.0 38.0 9 37.09125 38.0 38.0 38.0 37.0 38.0 10-14 37.01145 38.0 38.0 38.0 37.0 38.0 15-19 37.042500000000004 38.0 38.0 38.0 37.0 38.0 20-24 36.93365 38.0 38.0 38.0 36.6 38.0 25-29 36.817899999999995 38.0 38.0 38.0 36.4 38.0 30-34 36.897450000000006 38.0 38.0 38.0 36.8 38.0 35-39 36.8369 38.0 38.0 38.0 36.6 38.0 40-44 36.805099999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.6856 38.0 38.0 38.0 35.8 38.0 50-54 36.630449999999996 38.0 38.0 38.0 35.8 38.0 55-59 36.6081 38.0 38.0 38.0 35.6 38.0 60-64 36.61215 38.0 38.0 38.0 35.4 38.0 65-69 36.60545 38.0 38.0 38.0 35.6 38.0 70-74 36.43795 38.0 38.0 38.0 34.8 38.0 75-79 36.2567 38.0 38.0 38.0 33.8 38.0 80-84 36.3375 38.0 38.0 38.0 34.0 38.0 85-89 36.37125 38.0 38.0 38.0 34.2 38.0 90-94 36.330200000000005 38.0 38.0 38.0 34.2 38.0 95-99 36.1249 38.0 38.0 38.0 33.8 38.0 100-104 35.835350000000005 38.0 37.6 38.0 32.6 38.0 105-109 35.6604 38.0 37.4 38.0 31.8 38.0 110-114 35.60455 38.0 37.0 38.0 31.4 38.0 115-119 35.44935 38.0 37.0 38.0 31.0 38.0 120-124 35.1135 38.0 36.2 38.0 28.8 38.0 125-129 34.70145 38.0 36.0 38.0 27.2 38.0 130-134 34.69375 38.0 35.8 38.0 27.4 38.0 135-139 34.214 38.0 34.8 38.0 24.0 38.0 140-144 33.6255 38.0 33.2 38.0 21.8 38.0 145-149 32.755849999999995 38.0 33.2 38.0 13.6 38.0 150-151 28.2865 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 9.0 4 1.0 5 2.0 6 4.0 7 3.0 8 0.0 9 0.0 10 0.0 11 0.0 12 4.0 13 2.0 14 4.0 15 8.0 16 4.0 17 9.0 18 5.0 19 3.0 20 8.0 21 3.0 22 14.0 23 14.0 24 14.0 25 20.0 26 22.0 27 22.0 28 27.0 29 37.0 30 45.0 31 52.0 32 56.0 33 116.0 34 149.0 35 273.0 36 596.0 37 2455.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.5501002004008 21.7685370741483 13.627254509018035 27.054108216432866 2 27.98498122653317 26.783479349186486 27.95994993742178 17.271589486858574 3 20.696567276371837 28.338762214983714 30.017539463793536 20.947131044850913 4 24.486730095142715 32.49874812218327 24.161241862794192 18.85327991987982 5 25.18796992481203 36.140350877192986 20.626566416040102 18.045112781954884 6 21.3 38.4 21.925 18.375 7 22.125 23.200000000000003 36.675000000000004 18.0 8 23.1807951987997 24.55613903475869 27.031757939484873 25.23130782695674 9 22.05 25.95 28.000000000000004 24.0 10-14 24.14 28.975 25.855 21.029999999999998 15-19 24.0 27.805000000000003 27.04 21.154999999999998 20-24 23.78094523630908 28.482120530132534 27.08677169292323 20.650162540635158 25-29 23.640638287229255 28.59786904106848 26.44189885448452 21.319593817217747 30-34 24.275 28.22 26.905 20.599999999999998 35-39 23.916195809790487 28.781439071953596 26.526326316315817 20.776038801940096 40-44 23.925 28.17 27.115000000000002 20.79 45-49 23.959375625375227 27.361416850110064 28.01681008605163 20.662397438463078 50-54 23.372914474673077 27.79698381682449 27.576531890375268 21.25356981812716 55-59 24.05849358974359 27.654246794871796 27.33874198717949 20.948517628205128 60-64 23.571785892946473 27.22361180590295 28.039019509754876 21.1655827913957 65-69 24.232423242324234 27.97779777977798 26.72767276727673 21.062106210621064 70-74 23.941197059852993 27.556377818890944 27.236361818090906 21.266063303165158 75-79 24.23605901475369 28.207051762940733 26.636659164791197 20.920230057514377 80-84 24.128619292893934 27.70915637345602 26.814022103315498 21.34820223033455 85-89 24.325 28.655 26.44 20.580000000000002 90-94 24.013602040306044 28.264239635945394 27.114067110066507 20.60809121368205 95-99 24.608456342256694 28.116087065298974 27.06529897423067 20.21015761821366 100-104 24.285070366104073 28.256623428657285 27.15480542895778 20.303500776280863 105-109 24.533119711610674 27.477094077003954 28.082911931106995 19.906874280278373 110-114 24.184836967393476 27.555511102220443 27.220444088817764 21.039207841568313 115-119 24.685000000000002 28.000000000000004 26.729999999999997 20.585 120-124 24.535 28.050000000000004 26.865 20.549999999999997 125-129 24.367436743674368 28.397839783978394 26.56265626562656 20.672067206720673 130-134 24.84 28.035 26.38 20.745 135-139 24.63 27.415 27.615000000000002 20.34 140-144 25.167684452898186 27.745520072079287 26.6943638001802 20.392431674842328 145-149 25.209325645525194 27.38530960140386 27.074454750564055 20.330910002506894 150-151 24.84355444305382 28.060075093867333 27.659574468085108 19.43679599499374 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 1.5 26 1.5 27 3.0 28 6.5 29 8.0 30 11.0 31 19.0 32 27.0 33 37.0 34 40.5 35 57.5 36 76.0 37 91.0 38 120.5 39 141.0 40 174.0 41 210.0 42 246.5 43 265.0 44 275.5 45 277.0 46 258.5 47 255.0 48 232.0 49 199.0 50 186.0 51 157.5 52 119.0 53 101.5 54 75.5 55 54.5 56 49.0 57 38.5 58 25.5 59 24.0 60 25.5 61 23.0 62 18.0 63 16.0 64 13.5 65 4.0 66 2.0 67 3.0 68 3.5 69 5.0 70 4.5 71 3.0 72 2.5 73 1.0 74 0.5 75 0.5 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.125 3 0.22499999999999998 4 0.15 5 0.25 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.0 20-24 0.025 25-29 0.045 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.06 50-54 0.20500000000000002 55-59 0.16 60-64 0.05 65-69 0.01 70-74 0.005 75-79 0.025 80-84 0.015 85-89 0.0 90-94 0.015 95-99 0.075 100-104 0.165 105-109 0.135 110-114 0.02 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.11 145-149 0.27499999999999997 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0628166160081 97.775 2 0.7092198581560284 1.4000000000000001 3 0.12664640324214793 0.375 4 0.07598784194528875 0.3 5 0.0 0.0 6 0.025329280648429587 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.05 0.0 0.0 0.0 0.0 118-119 1.2625 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.6375000000000002 0.0 0.0 0.0 0.0 126-127 1.9249999999999998 0.0 0.0 0.0 0.0 128-129 2.1500000000000004 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.7375 0.0 0.0 0.0 0.0 134-135 2.8499999999999996 0.0 0.0 0.0 0.0 136-137 3.0625 0.0 0.0 0.0 0.0 138-139 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGTTC 10 0.006597606 146.67088 145 AACAATC 10 0.0068537686 144.8375 2 CCTATTA 10 0.0068537686 144.8375 5 CACCGCT 10 0.0068537686 144.8375 1 TATTACA 10 0.0068537686 144.8375 7 >>END_MODULE Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774045 spots for SRR7030817.sra Written 774045 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra Read 774027 spots for SRR7030817.sra Written 774027 spots for SRR7030817.sra SRR ids: ['SRR7030817.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7hdkfsjm SRR7030817.sra spots: 15480558 blocks: [[1, 774027], [774028, 1548054], [1548055, 2322081], [2322082, 3096108], [3096109, 3870135], [3870136, 4644162], [4644163, 5418189], [5418190, 6192216], [6192217, 6966243], [6966244, 7740270], [7740271, 8514297], [8514298, 9288324], [9288325, 10062351], [10062352, 10836378], [10836379, 11610405], [11610406, 12384432], [12384433, 13158459], [13158460, 13932486], [13932487, 14706513], [14706514, 15480558]] SRR7030817 file size 5224152 SRR7030817 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030817 SRR7030817_1.fastq SRR7030817_2.fastq Input file: SRR7030817_1.fastq Paired file: SRR7030817_2.fastq trimmed: SRR7030817-trimmed-pair1.fastq, SRR7030817-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:33:05 2025 >> started Wed Feb 12 20:33:49 2025 >> done (44.097s) 15480558 read pairs processed; of these: 49444 ( 0.32%) short read pairs filtered out after trimming by size control 37270 ( 0.24%) empty read pairs filtered out after trimming by size control 15393844 (99.44%) read pairs available; of these: 6027936 (39.16%) trimmed read pairs available after processing 9365908 (60.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 6 0.00% 21 1 0.00% 22 5 0.00% 23 8 0.00% 24 5 0.00% 25 8 0.00% 26 9 0.00% 27 4 0.00% 28 6 0.00% 29 5 0.00% 30 4 0.00% 31 9 0.00% 32 5 0.00% 33 6 0.00% 34 3 0.00% 35 4 0.00% 36 7 0.00% 37 1 0.00% 38 7 0.00% 39 4 0.00% 40 8 0.00% 41 4 0.00% 42 8 0.00% 43 12 0.00% 44 13 0.00% 45 13 0.00% 46 9 0.00% 47 14 0.00% 48 6 0.00% 49 18 0.00% 50 17 0.00% 51 27 0.00% 52 26 0.00% 53 21 0.00% 54 32 0.00% 55 45 0.00% 56 36 0.00% 57 27 0.00% 58 46 0.00% 59 37 0.00% 60 46 0.00% 61 54 0.00% 62 62 0.00% 63 103 0.00% 64 104 0.00% 65 93 0.00% 66 112 0.00% 67 111 0.00% 68 120 0.00% 69 148 0.00% 70 163 0.00% 71 198 0.00% 72 217 0.00% 73 245 0.00% 74 280 0.00% 75 346 0.00% 76 362 0.00% 77 415 0.00% 78 446 0.00% 79 497 0.00% 80 616 0.00% 81 712 0.00% 82 894 0.01% 83 1145 0.01% 84 3367 0.02% 85 3838 0.02% 86 3545 0.02% 87 3583 0.02% 88 3619 0.02% 89 3531 0.02% 90 3720 0.02% 91 3687 0.02% 92 4050 0.03% 93 4239 0.03% 94 4444 0.03% 95 4823 0.03% 96 5404 0.04% 97 7870 0.05% 98 7524 0.05% 99 5709 0.04% 100 5785 0.04% 101 6366 0.04% 102 6871 0.04% 103 7242 0.05% 104 7758 0.05% 105 8388 0.05% 106 8863 0.06% 107 9481 0.06% 108 10020 0.07% 109 10441 0.07% 110 11087 0.07% 111 12120 0.08% 112 12991 0.08% 113 13480 0.09% 114 14750 0.10% 115 15727 0.10% 116 16810 0.11% 117 17602 0.11% 118 18322 0.12% 119 19278 0.13% 120 20013 0.13% 121 21503 0.14% 122 23198 0.15% 123 23654 0.15% 124 24333 0.16% 125 25769 0.17% 126 27485 0.18% 127 28720 0.19% 128 30020 0.20% 129 31450 0.20% 130 33463 0.22% 131 34616 0.22% 132 36942 0.24% 133 39569 0.26% 134 41627 0.27% 135 44979 0.29% 136 48041 0.31% 137 51727 0.34% 138 55463 0.36% 139 60437 0.39% 140 65687 0.43% 141 72441 0.47% 142 81146 0.53% 143 94434 0.61% 144 115348 0.75% 145 142046 0.92% 146 174013 1.13% 147 223116 1.45% 148 304686 1.98% 149 554117 3.60% 150 3183538 20.68% 151 9365908 60.84% 15393844 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.94 fanout-score-rank=17 prefix-density=0.40 prefix-fanout=3.6 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=106.67 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.6 sequence=TGGCAGCAAGGCCACTCTGCCACTTACAATACCCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGCGGCTCTTTCACCGCGAGGGCTTGGCCAACGGCACGTGCCTCCGGGGCCAAGAGGCCCCTACTGCAGGTCGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTAGAGGCGTTCAGTCATAATCCAACGCACGGTAGCTTCGCGCCACTGGCTTTTCAACCAAGCGCGATGACCAATTGTGCGAATCAACGGTTCCTCTCGTACTAGGTTGGATTACTATTGCGACACTGTCATCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGCTCACGTTCCCTATTGGTGGGTGAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=29 prefix-density=0.33 prefix-fanout=2.7 sequence=TGAGCTTCTCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=31 fanout-score=45.06 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=7.2 sequence=CCAAGGAAGCAGCTCGCTAC SRR7030817 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:35:01 Started mapping on | Feb 12 20:35:02 Finished on | Feb 12 20:36:48 Mapping speed, Million of reads per hour | 522.81 Number of input reads | 15393844 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13962936 Uniquely mapped reads % | 90.70% Average mapped length | 296.24 Number of splices: Total | 13605833 Number of splices: Annotated (sjdb) | 13354659 Number of splices: GT/AG | 13359567 Number of splices: GC/AG | 191494 Number of splices: AT/AC | 18493 Number of splices: Non-canonical | 36279 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463687 % of reads mapped to multiple loci | 3.01% Number of reads mapped to too many loci | 719217 % of reads mapped to too many loci | 4.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 995183 995183 995183 N_multimapping 463687 463687 463687 N_noFeature 402941 13824141 467758 N_ambiguous 146622 1099 72036 UnstrandedReadsAssigned:13413373 PositiveStrandReadsAssigned:137696 NegativeStrandReadsAssigned:13423142 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030817 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030817-trimmed-pair1.fastq SRR7030817-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,393,844 reads, 13,985,779 reads pseudoaligned [quant] estimated average fragment length: 244.359 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,045 rounds 52401 SRR7030817.ke.tsv 34699 SRR7030817.se.tsv 87100 total ==> SRR7030817.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.64 2574 69.5718 Potri.005G024800.1.v4.1 1035 791.641 2120 128.453 Potri.004G059700.1.v4.1 961 717.657 12 0.802047 Potri.007G009000.2.v4.1 1416 1172.64 0 0 Potri.003G141000.2.v4.1 2943 2699.64 529 9.39907 Potri.016G087400.1.v4.1 270 72.4051 1109.19 734.806 Potri.015G069301.1.v4.1 564 324.284 0 0 Potri.010G195200.1.v4.1 1773 1529.64 20 0.627156 Potri.012G127500.1.v4.1 977 733.652 13238 865.501 ==> SRR7030817.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 142 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR7030817 completed mapping pipeline successfully