Starting /dee2/code/volunteer_pipeline.sh SRR7030818 current disk space = 3050906726400 free memory = 1579860612 SRR7030818 SRAfilesize dba611ab1f264cf2c740ebf0daaef879 SRR7030818.sra SRR7030818.sra file validated SRR7030818 is paired end SRR7030818 is conventional basespace SRR7030818 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030818_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.30825 32.0 18.0 33.0 18.0 34.0 2 31.734 33.0 31.0 34.0 27.0 34.0 3 31.43925 33.0 31.0 33.0 27.0 34.0 4 32.64175 33.0 33.0 33.0 32.0 34.0 5 32.42325 33.0 33.0 33.0 31.0 34.0 6 35.60925 37.0 36.0 38.0 31.0 38.0 7 36.821 38.0 37.0 38.0 34.0 38.0 8 36.995 38.0 38.0 38.0 35.0 38.0 9 37.34325 38.0 38.0 38.0 37.0 38.0 10-14 37.5038 38.0 38.0 38.0 37.2 38.0 15-19 37.5589 38.0 38.0 38.0 37.8 38.0 20-24 37.5391 38.0 38.0 38.0 37.4 38.0 25-29 37.48425 38.0 38.0 38.0 37.4 38.0 30-34 37.413050000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.4044 38.0 38.0 38.0 37.0 38.0 40-44 37.3127 38.0 38.0 38.0 37.0 38.0 45-49 37.338550000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.306000000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.204600000000006 38.0 38.0 38.0 36.4 38.0 60-64 37.2144 38.0 38.0 38.0 36.4 38.0 65-69 37.18430000000001 38.0 38.0 38.0 36.2 38.0 70-74 37.1028 38.0 38.0 38.0 36.0 38.0 75-79 37.086149999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.90255 38.0 38.0 38.0 35.6 38.0 85-89 36.9661 38.0 38.0 38.0 36.0 38.0 90-94 36.754949999999994 38.0 38.0 38.0 34.8 38.0 95-99 36.64379999999999 38.0 38.0 38.0 34.4 38.0 100-104 36.5851 38.0 38.0 38.0 34.6 38.0 105-109 36.46865 38.0 38.0 38.0 34.0 38.0 110-114 36.38555 38.0 38.0 38.0 34.0 38.0 115-119 36.15795 38.0 37.6 38.0 33.6 38.0 120-124 35.937850000000005 38.0 37.0 38.0 33.0 38.0 125-129 35.68715 38.0 36.6 38.0 31.4 38.0 130-134 35.352 38.0 36.0 38.0 30.2 38.0 135-139 35.076299999999996 38.0 35.8 38.0 29.2 38.0 140-144 34.882349999999995 38.0 35.4 38.0 28.6 38.0 145-149 34.37525 38.0 35.0 38.0 27.4 38.0 150-151 31.119875 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 1.0 19 3.0 20 4.0 21 7.0 22 4.0 23 7.0 24 9.0 25 9.0 26 16.0 27 15.0 28 19.0 29 36.0 30 41.0 31 46.0 32 56.0 33 90.0 34 138.0 35 288.0 36 701.0 37 2505.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.553643452541 14.304920677601507 7.90535090077978 38.23608496907771 2 21.65 12.950000000000001 34.375 31.025000000000002 3 18.675 18.0 26.674999999999997 36.65 4 20.974999999999998 25.05 26.275 27.700000000000003 5 23.816679188580014 29.551715502128722 24.517906336088156 22.113698973203107 6 19.32983245811453 35.0587646911728 24.656164041010253 20.955238809702426 7 16.325 27.025 38.4 18.25 8 17.45 25.374999999999996 31.4 25.775 9 16.400000000000002 25.324999999999996 35.125 23.150000000000002 10-14 19.31 29.880000000000003 27.555000000000003 23.255 15-19 20.215 27.884999999999998 27.639999999999997 24.26 20-24 19.939999999999998 28.525 27.275 24.26 25-29 19.985 28.595 27.389999999999997 24.03 30-34 19.575 28.610000000000003 27.355 24.46 35-39 20.115 28.205000000000002 27.83 23.849999999999998 40-44 20.294999999999998 28.77 26.924999999999997 24.01 45-49 20.165 28.065 27.134999999999998 24.635 50-54 19.645000000000003 28.444999999999997 27.35 24.560000000000002 55-59 20.54 28.084999999999997 27.245 24.13 60-64 20.775 28.299999999999997 26.915 24.01 65-69 20.555 28.155 27.42 23.87 70-74 20.080000000000002 28.299999999999997 27.525 24.095 75-79 19.99 28.22 27.615000000000002 24.175 80-84 20.885 28.115000000000002 27.41 23.59 85-89 20.635 28.000000000000004 27.58 23.785 90-94 20.560000000000002 28.08 27.134999999999998 24.224999999999998 95-99 20.435 27.925 27.08 24.560000000000002 100-104 20.89 28.065 27.625 23.419999999999998 105-109 20.915 27.275 27.715 24.095 110-114 20.87 27.88 27.54 23.71 115-119 20.645 27.63 27.735 23.990000000000002 120-124 20.95 27.98 26.93 24.14 125-129 20.965 27.495000000000005 27.505000000000003 24.035 130-134 20.549999999999997 28.035 27.384999999999998 24.03 135-139 21.154999999999998 27.589999999999996 26.955000000000002 24.3 140-144 21.52 27.315 27.42 23.745 145-149 21.935 27.675 26.935 23.455000000000002 150-151 21.728240450845334 27.213525360050095 27.013149655604256 24.04508453350031 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.0 23 1.5 24 2.0 25 1.0 26 2.5 27 7.0 28 8.5 29 11.5 30 20.0 31 23.0 32 24.0 33 37.0 34 50.0 35 56.5 36 81.5 37 109.5 38 124.5 39 154.5 40 180.0 41 193.0 42 212.5 43 242.5 44 255.0 45 260.0 46 254.5 47 241.5 48 240.5 49 240.5 50 211.5 51 164.5 52 137.5 53 112.0 54 84.5 55 62.0 56 49.5 57 36.0 58 27.5 59 27.5 60 21.5 61 9.5 62 5.5 63 4.0 64 3.0 65 1.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.025 2 0.0 3 0.0 4 0.0 5 0.17500000000000002 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.05 0.0 0.0 0.025 0.0 92-93 0.075 0.0 0.0 0.025 0.0 94-95 0.075 0.0 0.0 0.025 0.0 96-97 0.0875 0.0 0.0 0.025 0.0 98-99 0.1375 0.0 0.0 0.025 0.0 100-101 0.225 0.0 0.0 0.025 0.0 102-103 0.275 0.0 0.0 0.025 0.0 104-105 0.375 0.0 0.0 0.025 0.0 106-107 0.44999999999999996 0.0 0.0 0.025 0.0 108-109 0.5625 0.0 0.0 0.025 0.0 110-111 0.6499999999999999 0.0 0.0 0.025 0.0 112-113 0.775 0.0 0.0 0.025 0.0 114-115 0.9125 0.0 0.0 0.025 0.0 116-117 1.125 0.0 0.0 0.025 0.0 118-119 1.2374999999999998 0.0 0.0 0.025 0.0 120-121 1.55 0.0 0.0 0.025 0.0 122-123 1.8125 0.0 0.0 0.025 0.0 124-125 2.05 0.0 0.0 0.025 0.0 126-127 2.2 0.0 0.0 0.025 0.0 128-129 2.45 0.0 0.0 0.025 0.0 130-131 2.75 0.0 0.0 0.025 0.0 132-133 3.075 0.0 0.0 0.025 0.0 134-135 3.2750000000000004 0.0 0.0 0.025 0.0 136-137 3.575 0.0 0.0 0.025 0.0 138-139 4.074999999999999 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATCC 10 0.0068343505 144.975 145 GTCAGAG 10 0.0068343505 144.975 5 >>END_MODULE SRR7030818 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7030818_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8775 33.0 33.0 34.0 32.0 34.0 2 32.92275 33.0 33.0 34.0 32.0 34.0 3 32.933 34.0 33.0 34.0 32.0 34.0 4 32.89275 34.0 33.0 34.0 32.0 34.0 5 32.94075 34.0 33.0 34.0 32.0 34.0 6 37.24375 38.0 38.0 38.0 37.0 38.0 7 37.3275 38.0 38.0 38.0 37.0 38.0 8 37.2365 38.0 38.0 38.0 37.0 38.0 9 37.2705 38.0 38.0 38.0 37.0 38.0 10-14 37.2038 38.0 38.0 38.0 37.0 38.0 15-19 37.1908 38.0 38.0 38.0 37.0 38.0 20-24 37.198499999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.1191 38.0 38.0 38.0 36.8 38.0 30-34 37.10085 38.0 38.0 38.0 37.0 38.0 35-39 36.9848 38.0 38.0 38.0 36.0 38.0 40-44 36.95315 38.0 38.0 38.0 36.0 38.0 45-49 36.7231 38.0 38.0 38.0 35.4 38.0 50-54 36.93725 38.0 38.0 38.0 36.0 38.0 55-59 36.846500000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.8187 38.0 38.0 38.0 36.0 38.0 65-69 36.7682 38.0 38.0 38.0 35.6 38.0 70-74 36.679 38.0 38.0 38.0 34.8 38.0 75-79 36.63745 38.0 38.0 38.0 35.0 38.0 80-84 36.45315 38.0 38.0 38.0 34.6 38.0 85-89 36.4544 38.0 38.0 38.0 34.2 38.0 90-94 36.354949999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.1785 38.0 38.0 38.0 34.0 38.0 100-104 36.03515 38.0 37.4 38.0 33.2 38.0 105-109 35.9193 38.0 37.2 38.0 32.8 38.0 110-114 35.68755 38.0 37.0 38.0 31.8 38.0 115-119 35.508449999999996 38.0 37.0 38.0 30.8 38.0 120-124 35.3812 38.0 36.8 38.0 30.2 38.0 125-129 35.116249999999994 38.0 36.0 38.0 28.4 38.0 130-134 34.68729999999999 38.0 35.2 38.0 27.2 38.0 135-139 34.511649999999996 38.0 35.0 38.0 26.8 38.0 140-144 34.016450000000006 38.0 35.0 38.0 23.6 38.0 145-149 33.5021 38.0 34.4 38.0 20.6 38.0 150-151 29.3805 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 2.0 4 1.0 5 2.0 6 1.0 7 2.0 8 1.0 9 0.0 10 0.0 11 0.0 12 3.0 13 2.0 14 4.0 15 3.0 16 2.0 17 3.0 18 2.0 19 4.0 20 3.0 21 8.0 22 5.0 23 13.0 24 13.0 25 20.0 26 14.0 27 30.0 28 34.0 29 36.0 30 47.0 31 54.0 32 72.0 33 96.0 34 156.0 35 292.0 36 665.0 37 2400.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.05 22.575 12.5 29.875 2 26.50300601202405 26.002004008016034 29.784569138276552 17.710420841683366 3 19.659403956924617 28.399699474079636 30.553468569997495 21.387427998998245 4 22.019038076152306 35.09519038076152 23.74749498997996 19.138276553106213 5 24.125 35.075 21.349999999999998 19.45 6 19.99498872463042 39.48884991230268 22.350288148333753 18.16587321473315 7 20.59118236472946 22.394789579158317 37.600200400801604 19.413827655310623 8 21.19238476953908 26.352705410821642 28.607214428857713 23.847695390781563 9 21.26753507014028 24.9248496993988 29.884769539078153 23.922845691382765 10-14 23.190583521162033 28.710242925118955 26.416228399699477 21.682945154019535 15-19 22.512643332832607 28.346101847679133 27.79029592909719 21.350958890391066 20-24 22.542050460552662 28.519223067681214 27.48798558269924 21.45074088906688 25-29 23.072301221710394 28.17945123172441 27.62367314239936 21.124574404165834 30-34 22.362953692115145 27.574468085106385 28.205256570713395 21.85732165206508 35-39 23.001500750375186 28.23911955977989 26.96848424212106 21.790895447723862 40-44 23.50175087543772 28.174087043521762 27.058529264632313 21.265632816408203 45-49 22.897172879659745 28.46634976232174 27.185389041781338 21.451088316237175 50-54 23.193193193193192 27.872872872872872 27.642642642642645 21.29129129129129 55-59 23.37272181053475 27.228119367113962 27.788904466252756 21.610254356098537 60-64 23.001051419416214 27.5972562959996 27.92770239823762 21.473989886346565 65-69 23.7465564738292 27.663410969196097 26.997245179063363 21.592787377911346 70-74 23.711495116453793 27.132481843225648 28.079138492361633 21.076884547958926 75-79 23.608676050693784 27.616089766067226 27.32555227170265 21.44968191153634 80-84 23.94852793911476 27.598638093330663 27.143000200280394 21.309833767274185 85-89 24.026818773141198 27.35915140598419 27.219053337336135 21.39497648353848 90-94 23.610972069276205 27.370107117829612 27.840624687155874 21.178296125738314 95-99 23.219829744616927 28.40761141712569 27.290936404606907 21.081622433650477 100-104 23.946907087402955 27.037315301778115 27.698472326571498 21.317305284247436 105-109 23.805708562844266 28.102153229844767 27.28092138207311 20.811216825237857 110-114 23.893672406888268 28.178814577492993 26.877252703243894 21.05026031237485 115-119 24.402704733283244 27.468069120961687 27.4129727022289 20.71625344352617 120-124 24.292511895817682 27.81868269471575 27.1274730778863 20.761332331580267 125-129 24.027047332832456 27.723516153268218 27.342849987478086 20.906586526421236 130-134 24.061279663562633 27.896265144688094 27.350555722439168 20.691899469310105 135-139 25.15137867187109 27.047990792173348 27.493369363959363 20.307261171996196 140-144 24.450783165690837 27.878696892358505 27.508382124806086 20.162137817144572 145-149 24.886130436958805 27.478852795435206 27.048400820861907 20.58661594674408 150-151 24.937468734367183 28.751875937968986 26.263131565782892 20.04752376188094 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 0.0 24 0.5 25 1.5 26 2.0 27 2.5 28 3.5 29 5.5 30 9.5 31 16.5 32 23.0 33 32.5 34 45.0 35 53.0 36 57.0 37 76.5 38 123.0 39 165.5 40 186.0 41 227.5 42 270.5 43 279.0 44 276.5 45 278.5 46 275.5 47 259.0 48 234.0 49 201.0 50 174.5 51 153.0 52 129.5 53 102.5 54 86.0 55 63.5 56 44.0 57 39.0 58 30.0 59 23.0 60 14.0 61 10.5 62 8.5 63 3.5 64 2.5 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.17500000000000002 4 0.2 5 0.0 6 0.22499999999999998 7 0.2 8 0.2 9 0.2 10-14 0.17500000000000002 15-19 0.145 20-24 0.12 25-29 0.13999999999999999 30-34 0.125 35-39 0.05 40-44 0.05 45-49 0.075 50-54 0.1 55-59 0.13999999999999999 60-64 0.135 65-69 0.17500000000000002 70-74 0.17500000000000002 75-79 0.185 80-84 0.13999999999999999 85-89 0.06999999999999999 90-94 0.11 95-99 0.15 100-104 0.17500000000000002 105-109 0.15 110-114 0.12 115-119 0.17500000000000002 120-124 0.17500000000000002 125-129 0.17500000000000002 130-134 0.13 135-139 0.08499999999999999 140-144 0.08499999999999999 145-149 0.105 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21815889029004 98.35000000000001 2 0.6809583858764187 1.35 3 0.1008827238335435 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.2625000000000002 0.0 0.0 0.0 0.0 120-121 1.55 0.0 0.0 0.0 0.0 122-123 1.8125 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.2249999999999996 0.0 0.0 0.0 0.0 128-129 2.475 0.0 0.0 0.0 0.0 130-131 2.775 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.3499999999999996 0.0 0.0 0.0 0.0 136-137 3.65 0.0 0.0 0.0 0.0 138-139 4.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGTTC 10 0.006830828 145.0 4 >>END_MODULE Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra Read 948928 spots for SRR7030818.sra Written 948928 spots for SRR7030818.sra Read 948914 spots for SRR7030818.sra Written 948914 spots for SRR7030818.sra SRR ids: ['SRR7030818.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_apx6i4lw SRR7030818.sra spots: 18978294 blocks: [[1, 948914], [948915, 1897828], [1897829, 2846742], [2846743, 3795656], [3795657, 4744570], [4744571, 5693484], [5693485, 6642398], [6642399, 7591312], [7591313, 8540226], [8540227, 9489140], [9489141, 10438054], [10438055, 11386968], [11386969, 12335882], [12335883, 13284796], [13284797, 14233710], [14233711, 15182624], [15182625, 16131538], [16131539, 17080452], [17080453, 18029366], [18029367, 18978294]] SRR7030818 file size 6409420 SRR7030818 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7030818 SRR7030818_1.fastq SRR7030818_2.fastq Input file: SRR7030818_1.fastq Paired file: SRR7030818_2.fastq trimmed: SRR7030818-trimmed-pair1.fastq, SRR7030818-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:39:39 2025 >> started Wed Feb 12 20:40:02 2025 >> done (22.940s) 18978294 read pairs processed; of these: 26425 ( 0.14%) short read pairs filtered out after trimming by size control 14955 ( 0.08%) empty read pairs filtered out after trimming by size control 18936914 (99.78%) read pairs available; of these: 7498277 (39.60%) trimmed read pairs available after processing 11438637 (60.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 5 0.00% 24 1 0.00% 25 5 0.00% 26 7 0.00% 27 5 0.00% 28 8 0.00% 29 4 0.00% 30 1 0.00% 31 2 0.00% 32 1 0.00% 33 5 0.00% 34 4 0.00% 35 5 0.00% 36 10 0.00% 37 10 0.00% 38 5 0.00% 39 6 0.00% 40 8 0.00% 41 1 0.00% 42 7 0.00% 43 8 0.00% 44 4 0.00% 45 11 0.00% 46 12 0.00% 47 10 0.00% 48 11 0.00% 49 12 0.00% 50 24 0.00% 51 24 0.00% 52 14 0.00% 53 19 0.00% 54 21 0.00% 55 28 0.00% 56 29 0.00% 57 29 0.00% 58 32 0.00% 59 47 0.00% 60 46 0.00% 61 56 0.00% 62 69 0.00% 63 69 0.00% 64 72 0.00% 65 89 0.00% 66 83 0.00% 67 98 0.00% 68 123 0.00% 69 132 0.00% 70 148 0.00% 71 207 0.00% 72 235 0.00% 73 287 0.00% 74 313 0.00% 75 350 0.00% 76 430 0.00% 77 450 0.00% 78 491 0.00% 79 572 0.00% 80 656 0.00% 81 744 0.00% 82 959 0.01% 83 1079 0.01% 84 1833 0.01% 85 2477 0.01% 86 2656 0.01% 87 2984 0.02% 88 3129 0.02% 89 3394 0.02% 90 3505 0.02% 91 3761 0.02% 92 3950 0.02% 93 4289 0.02% 94 4691 0.02% 95 4827 0.03% 96 5281 0.03% 97 5711 0.03% 98 6216 0.03% 99 7139 0.04% 100 7079 0.04% 101 7402 0.04% 102 7911 0.04% 103 8603 0.05% 104 9358 0.05% 105 10064 0.05% 106 10898 0.06% 107 11403 0.06% 108 12219 0.06% 109 12881 0.07% 110 13800 0.07% 111 14671 0.08% 112 15544 0.08% 113 16636 0.09% 114 18186 0.10% 115 19467 0.10% 116 20594 0.11% 117 21801 0.12% 118 22660 0.12% 119 23854 0.13% 120 25054 0.13% 121 26616 0.14% 122 28034 0.15% 123 29300 0.15% 124 31551 0.17% 125 33295 0.18% 126 35090 0.19% 127 36802 0.19% 128 38942 0.21% 129 41197 0.22% 130 42884 0.23% 131 44870 0.24% 132 47872 0.25% 133 50860 0.27% 134 54013 0.29% 135 57845 0.31% 136 61547 0.33% 137 66352 0.35% 138 71552 0.38% 139 76729 0.41% 140 81073 0.43% 141 87708 0.46% 142 96523 0.51% 143 107745 0.57% 144 124648 0.66% 145 148166 0.78% 146 184778 0.98% 147 246943 1.30% 148 374550 1.98% 149 752979 3.98% 150 4033686 21.30% 151 11438637 60.40% 18936914 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=25 prefix-density=0.41 prefix-fanout=2.8 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=318.22 fanout-score-rank=1 prefix-density=1.11 prefix-fanout=35.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=35 prefix-density=0.32 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=170.15 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=7.4 sequence=AAAGGAAAGCCCGGAGGAACCAATGTAAATGCAGGAAAGGGTGGTGTGAATGTTGATGCTGGGAAAGGAAAGCCAGGCAGCGGCACCCATGTCAGCGTCGGGGGCAAAGGTGTTGGTGTTGCCGCTGGAAAGCCAGGGAAGAGAACCGATGTTGGTGTTGGCAAAGGCGGAGTATCTGTGACCAAAGGGCACCATGGCAAGCCCGTAATTGTTGGGGTACGCCCAGGGCCAGGCCCGTTCAACTACATTTATGCTGCAACTGAGACTCAACTCCATGATGACCCAAATGTAGCCCTTTTTTTCTTGGAGAAAGACATGCATCCAGGCAAAATTATGAACTTGCAATTCACTGAAAACACTAACACAGCAACTTTCTTACCACGTCAAGTCGCCGATTCAATACCCTTTTCATCTGACAAATTGCCAGAAATCTACAGTGAGTTTTCAGTGAAACCTGGATCAATGGAAGCTGCGGAGATGGAGAATACAATCAAGGAATGTGAAAGCCCTG SRR7030818 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:41:18 Started mapping on | Feb 12 20:41:20 Finished on | Feb 12 20:43:12 Mapping speed, Million of reads per hour | 608.69 Number of input reads | 18936914 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17891142 Uniquely mapped reads % | 94.48% Average mapped length | 296.49 Number of splices: Total | 17896270 Number of splices: Annotated (sjdb) | 17685642 Number of splices: GT/AG | 17590157 Number of splices: GC/AG | 251055 Number of splices: AT/AC | 14694 Number of splices: Non-canonical | 40364 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 773106 % of reads mapped to multiple loci | 4.08% Number of reads mapped to too many loci | 110251 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.76% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 289262 289262 289262 N_multimapping 773106 773106 773106 N_noFeature 194740 17723050 264500 N_ambiguous 189163 539 90466 UnstrandedReadsAssigned:17507239 PositiveStrandReadsAssigned:167553 NegativeStrandReadsAssigned:17536176 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7030818 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7030818-trimmed-pair1.fastq SRR7030818-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,936,914 reads, 17,789,698 reads pseudoaligned [quant] estimated average fragment length: 242.81 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,253 rounds 52401 SRR7030818.ke.tsv 34699 SRR7030818.se.tsv 87100 total ==> SRR7030818.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.19 931 22.1224 Potri.005G024800.1.v4.1 1035 793.19 340 18.0915 Potri.004G059700.1.v4.1 961 719.213 30 1.7605 Potri.007G009000.2.v4.1 1416 1174.19 0 0 Potri.003G141000.2.v4.1 2943 2701.19 478 7.4687 Potri.016G087400.1.v4.1 270 74.221 1723.15 979.871 Potri.015G069301.1.v4.1 564 325.782 0 0 Potri.010G195200.1.v4.1 1773 1531.19 4 0.110256 Potri.012G127500.1.v4.1 977 735.205 3343 191.911 ==> SRR7030818.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 54 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 277 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR7030818 completed mapping pipeline successfully